Homologs in group_23

Help

18 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_20020 FBDBKF_20020 28.8 Morganella morganii S1 - Molecular chaperone
FBDBKF_20060 FBDBKF_20060 31.3 Morganella morganii S1 - Fimbria/pilus periplasmic chaperone
EHELCC_03470 EHELCC_03470 31.3 Morganella morganii S2 - Fimbria/pilus periplasmic chaperone
EHELCC_03510 EHELCC_03510 28.8 Morganella morganii S2 - Molecular chaperone
NLDBIP_03470 NLDBIP_03470 31.3 Morganella morganii S4 - Fimbria/pilus periplasmic chaperone
NLDBIP_03510 NLDBIP_03510 28.8 Morganella morganii S4 - Molecular chaperone
LHKJJB_09300 LHKJJB_09300 31.3 Morganella morganii S3 - Fimbria/pilus periplasmic chaperone
LHKJJB_09340 LHKJJB_09340 28.8 Morganella morganii S3 - Molecular chaperone
HKOGLL_09635 HKOGLL_09635 28.8 Morganella morganii S5 - Molecular chaperone
HKOGLL_09675 HKOGLL_09675 31.3 Morganella morganii S5 - Fimbria/pilus periplasmic chaperone
PMI_RS05730 PMI_RS05730 29.2 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS07100 PMI_RS07100 29.7 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone
PMI_RS10905 PMI_RS10905 36.7 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS12535 PMI_RS12535 29.9 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS12550 PMI_RS12550 31.5 Proteus mirabilis HI4320 - molecular chaperone
PMI_RS13450 PMI_RS13450 33.0 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone
PMI_RS15275 PMI_RS15275 20.7 Proteus mirabilis HI4320 - fimbria/pilus chaperone family protein
PMI_RS17125 PMI_RS17125 30.8 Proteus mirabilis HI4320 - fimbria/pilus periplasmic chaperone

Distribution of the homologs in the orthogroup group_23

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_23

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8X5K6 1.06e-34 126 33 4 223 2 lpfB Probable fimbrial chaperone LpfB Escherichia coli O157:H7
P43661 5.1e-34 124 35 5 213 3 lpfB Chaperone protein LpfB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8X5E4 1.28e-32 120 32 6 230 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli O157:H7
P75856 2.85e-32 120 31 6 230 2 elfD Probable fimbrial chaperone protein ElfD Escherichia coli (strain K12)
P37923 2.15e-30 115 35 6 224 3 fimC Chaperone protein FimC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P62609 2.18e-29 112 35 6 199 1 focC Chaperone protein FocC Escherichia coli
P62610 2.18e-29 112 35 6 199 3 focC Chaperone protein FocC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P45991 9.64e-29 111 33 8 221 3 hifB Chaperone protein HifB Haemophilus influenzae
P35757 1.11e-28 110 34 9 221 3 hifB Chaperone protein HifB Haemophilus influenzae
P42914 7.58e-28 108 29 5 234 2 yraI Probable fimbrial chaperone YraI Escherichia coli (strain K12)
P53520 7.52e-26 103 29 6 208 3 pmfD Chaperone protein PmfD Proteus mirabilis (strain HI4320)
P75749 1.84e-25 102 28 5 216 3 ybgP Uncharacterized fimbrial chaperone YbgP Escherichia coli (strain K12)
P59590 4.56e-25 101 29 6 212 3 fimC Chaperone protein FimC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P15319 3e-24 99 30 4 203 1 papD Chaperone protein PapD Escherichia coli
P31697 3.59e-24 99 29 6 212 1 fimC Chaperone protein FimC Escherichia coli (strain K12)
P77616 5.67e-24 99 30 8 239 3 yqiH Uncharacterized fimbrial chaperone YqiH Escherichia coli (strain K12)
P77249 8.07e-24 98 30 4 228 2 sfmC Probable fimbrial chaperone SfmC Escherichia coli (strain K12)
P25402 2.36e-23 96 33 8 215 3 fanE Chaperone protein FanE Escherichia coli
P33409 1.75e-22 94 27 7 229 3 fimB Chaperone protein FimB/FhaD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P33128 2.25e-22 94 27 10 241 1 yadV Probable fimbrial chaperone YadV Escherichia coli (strain K12)
P77599 4.85e-20 88 25 3 197 2 yfcS Probable fimbrial chaperone YfcS Escherichia coli (strain K12)
P21646 9.06e-20 87 29 9 215 3 mrkB Chaperone protein MrkB Klebsiella pneumoniae
P15483 2.67e-19 86 28 4 203 3 None Chaperone protein CS3-1 Escherichia coli
P33342 3.7e-19 85 26 8 221 2 yehC Probable fimbrial chaperone YehC Escherichia coli (strain K12)
P53519 9.35e-18 82 29 4 226 3 cssC Chaperone protein CssC Escherichia coli
P40876 9.61e-18 82 28 6 224 2 ycbF Uncharacterized fimbrial chaperone YcbF Escherichia coli (strain K12)
P53518 9.74e-18 82 28 4 226 3 cssC Chaperone protein CssC Escherichia coli
P25401 2.24e-16 78 25 7 216 1 faeE Chaperone protein FaeE Escherichia coli
Q05433 2.88e-16 78 25 7 216 3 clpE Chaperone protein ClpE Escherichia coli
P46004 3.57e-15 75 29 9 218 3 aggD Chaperone protein AggD Escherichia coli
P53516 6.85e-15 74 27 6 181 3 afaB Chaperone protein AfaB Escherichia coli
P26926 8.03e-15 74 29 8 211 1 caf1M Chaperone protein caf1M Yersinia pestis
P33407 5.62e-13 69 24 7 197 3 myfB Chaperone protein MyfB Yersinia enterocolitica
P46738 3.74e-10 61 25 6 181 3 nfaE Chaperone protein NfaE Escherichia coli
P33387 3.82e-08 55 24 6 201 3 sefB Chaperone protein SefB Salmonella enteritidis
P69966 2.12e-07 53 23 8 218 3 psaB Chaperone protein PsaB Yersinia pseudotuberculosis serotype I (strain IP32953)
P69965 2.12e-07 53 23 8 218 3 psaB Chaperone protein PsaB Yersinia pestis
P42183 0.000133 43 30 3 100 3 prsD Chaperone protein PrsD (Fragment) Escherichia coli

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05770
Feature type CDS
Gene -
Product molecular chaperone
Location 1260445 - 1261119 (strand: -1)
Length 675 (nucleotides) / 224 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_23
Orthogroup size 19
N. genomes 6

Actions

Genomic region

Domains

PF00345 Pili and flagellar-assembly chaperone, PapD N-terminal domain
PF02753 Pili assembly chaperone PapD, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3121 Extracellular structures (W) W P pilus assembly protein, chaperone PapD

Protein Sequence

MKYNVYILFIIILCSTFFTQANVIYSGTRFIYNEDDNDIIINIKNKNSATDYLIQSWITKDENDKNTPFMITPPLFKLNKEQSAILRIAKITSIAQTDRESLFYINSKAIPIAESKHNSIHISIKSVFKLFYRPHGLTETVEEATKKIIFSINNKKEMIIKNNSEYYFTIINIFSNGEKKEISVMLSPFSEINIGKNHFGTAKVGWSYINDFGNEVNINIKNSE

Flanking regions ( +/- flanking 50bp)

ATTTTACCGTTAAATATTCTTAATTAAAAAAAACACAGGATTATTTTATTATGAAGTATAATGTTTATATTTTATTTATCATAATTCTGTGTTCTACTTTTTTTACACAAGCAAATGTAATTTATAGTGGAACACGGTTTATCTATAATGAAGACGATAATGATATTATTATTAATATAAAAAATAAAAACTCCGCTACTGATTATTTAATACAAAGCTGGATCACAAAGGATGAAAATGATAAAAATACACCTTTTATGATTACCCCACCTTTATTTAAATTAAATAAAGAACAATCTGCAATTTTGCGAATTGCCAAAATCACATCAATAGCTCAAACAGATCGTGAAAGTCTTTTTTATATAAATAGCAAAGCGATCCCTATAGCTGAATCAAAACATAATAGTATTCATATATCAATTAAGTCAGTGTTTAAATTATTTTACCGACCACATGGCTTAACAGAAACAGTTGAAGAAGCGACAAAAAAAATTATTTTTTCTATAAATAATAAAAAAGAAATGATAATAAAAAACAACTCTGAATACTACTTCACTATTATAAATATTTTTTCTAATGGGGAAAAAAAAGAGATCTCAGTCATGCTATCCCCTTTTAGTGAAATTAATATAGGAAAAAATCATTTTGGTACAGCTAAAGTAGGCTGGAGCTATATAAATGATTTTGGTAATGAAGTTAATATCAACATAAAAAATAGCGAATAGTATTAATTATGATAAAGTTATCTCCTATTTCTTTACTCTTATTATTTACG