Homologs in group_612

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01930 FBDBKF_01930 61.9 Morganella morganii S1 prmC peptide chain release factor N(5)-glutamine methyltransferase
EHELCC_02400 EHELCC_02400 61.9 Morganella morganii S2 prmC peptide chain release factor N(5)-glutamine methyltransferase
NLDBIP_01060 NLDBIP_01060 61.9 Morganella morganii S4 prmC peptide chain release factor N(5)-glutamine methyltransferase
LHKJJB_00975 LHKJJB_00975 61.9 Morganella morganii S3 prmC peptide chain release factor N(5)-glutamine methyltransferase
HKOGLL_01015 HKOGLL_01015 61.9 Morganella morganii S5 prmC peptide chain release factor N(5)-glutamine methyltransferase
F4V73_RS04275 F4V73_RS04275 64.0 Morganella psychrotolerans prmC peptide chain release factor N(5)-glutamine methyltransferase

Distribution of the homologs in the orthogroup group_612

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_612

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P40816 6.67e-128 367 66 0 276 3 prmC Release factor glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ACC2 3.12e-127 365 65 0 275 3 prmC Release factor glutamine methyltransferase Shigella flexneri
P0ACC1 3.12e-127 365 65 0 275 1 prmC Release factor glutamine methyltransferase Escherichia coli (strain K12)
Q32GZ5 1e-125 362 65 0 275 3 prmC Release factor glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q7CIA2 1.56e-112 328 58 1 275 3 prmC Release factor glutamine methyltransferase Yersinia pestis
P45253 1.22e-102 304 55 7 292 3 prmC Release factor glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q5E6T2 1.96e-102 303 55 1 266 3 prmC Release factor glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KQ26 1.44e-97 291 55 1 269 3 prmC Release factor glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8EAR4 3.07e-89 270 50 1 270 3 prmC Release factor glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P57269 3.38e-88 266 45 1 274 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AT0 2.9e-85 259 46 3 276 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9CN82 7.97e-85 259 53 7 298 3 prmC Release factor glutamine methyltransferase Pasteurella multocida (strain Pm70)
Q8K9W9 1.18e-83 255 46 1 274 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9HVC8 1.61e-83 254 50 0 263 3 prmC Release factor glutamine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PC99 3.75e-77 239 45 2 276 3 prmC Release factor glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9PD67 2.04e-67 213 43 1 255 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
Q87DF7 4.66e-67 213 43 1 255 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q83AD8 4.82e-66 210 42 2 259 3 prmC Release factor glutamine methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5F5B4 1.53e-59 193 38 4 277 3 prmC Release factor glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q63QE9 6.17e-58 189 42 3 259 3 prmC Release factor glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
Q7W022 5.09e-56 184 40 3 262 3 prmC Release factor glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q5NIA7 1.17e-53 179 38 1 255 3 prmC Release factor glutamine methyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q98G94 8.34e-50 169 40 5 265 3 prmC Release factor glutamine methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A9CG70 1.07e-49 169 38 4 270 3 prmC Release factor glutamine methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1II29 1.98e-47 162 38 7 280 3 prmC Release factor glutamine methyltransferase Koribacter versatilis (strain Ellin345)
Q8R619 6.1e-47 163 34 4 260 3 prmC Release factor glutamine methyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q727D9 2.03e-46 160 37 4 274 3 prmC Release factor glutamine methyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
B5YIQ8 5.19e-46 159 35 4 256 3 prmC Release factor glutamine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q1RH40 9.96e-46 164 31 4 298 3 prmC/trmB Bifunctional methyltransferase Rickettsia bellii (strain RML369-C)
Q2RWE0 5.61e-45 157 35 3 265 3 prmC Release factor glutamine methyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q748B2 7.25e-45 156 36 3 258 3 prmC Release factor glutamine methyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q4UJU4 5.17e-44 159 34 5 302 3 prmC/trmB Bifunctional methyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68VR6 5.23e-44 159 33 5 290 3 prmC/trmB Bifunctional methyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCB3 1.05e-43 158 34 5 290 3 prmC/trmB Bifunctional methyltransferase Rickettsia prowazekii (strain Madrid E)
Q92G13 1.74e-43 158 33 4 298 3 prmC/trmB Bifunctional methyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q2RFW1 7.72e-41 145 35 4 274 3 prmC Release factor glutamine methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q97F67 1.28e-38 140 33 3 256 3 prmC Release factor glutamine methyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7ULT2 3.63e-38 139 35 5 263 3 prmC Release factor glutamine methyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q9A9T7 5.27e-38 138 32 3 262 3 prmC Release factor glutamine methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A9WBM9 9.49e-38 137 34 8 283 3 prmC Release factor glutamine methyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q9CHX0 1.67e-37 136 37 5 226 3 prmC Release factor glutamine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
O66506 1.98e-37 136 32 4 259 3 prmC Release factor glutamine methyltransferase Aquifex aeolicus (strain VF5)
Q831F7 8.74e-37 135 34 4 222 3 prmC Release factor glutamine methyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
Q89XT8 1.57e-36 134 37 4 234 3 prmC Release factor glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q7NJS7 1.53e-35 132 36 5 230 3 prmC Release factor glutamine methyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q8DPZ3 6.21e-35 130 36 6 238 3 prmC Release factor glutamine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q2FWE1 2.13e-33 126 31 5 279 3 prmC Release factor glutamine methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q8KCD5 1.16e-32 124 34 6 264 3 prmC Release factor glutamine methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2S0V8 1.39e-32 124 31 5 269 3 prmC Release factor glutamine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
P45873 9.85e-32 122 32 6 275 3 prmC Release factor glutamine methyltransferase Bacillus subtilis (strain 168)
Q9RXR2 2.85e-31 120 32 5 277 3 prmC Release factor glutamine methyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q81JX2 2.78e-29 115 30 5 256 3 prmC Release factor glutamine methyltransferase Bacillus anthracis
Q814U1 4.19e-29 115 30 5 256 3 prmC Release factor glutamine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8Y4A9 3.52e-28 112 31 6 271 3 prmC Release factor glutamine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8P7Q8 2.35e-27 110 34 2 202 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
A6H162 7.1e-27 108 29 5 276 3 prmC Release factor glutamine methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q3J2B7 1.32e-26 108 34 4 259 3 prmC Release factor glutamine methyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
B8E004 2.33e-26 107 29 9 279 3 prmC Release factor glutamine methyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
A0R213 6.11e-26 106 33 6 259 3 prmC Release factor glutamine methyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A5HY34 6.22e-26 106 30 4 257 3 prmC Release factor glutamine methyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
O51215 1.97e-25 105 31 6 218 3 prmC Release factor glutamine methyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q8G3P4 6.97e-25 103 28 8 283 3 prmC Release factor glutamine methyltransferase Bifidobacterium longum (strain NCC 2705)
Q8DHV7 1.13e-24 103 34 5 215 3 prmC Release factor glutamine methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9I347 1.46e-24 103 32 3 202 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7VDL7 4.83e-24 101 34 6 215 3 prmC Release factor glutamine methyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8F987 6.31e-24 101 30 6 261 3 prmC Release factor glutamine methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B0B9D1 1.19e-23 100 32 6 239 1 prmC Release factor glutamine methyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q8A1D7 1.21e-23 100 31 5 232 3 prmC Release factor glutamine methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q9K4E3 1.38e-23 100 30 6 273 3 prmC Release factor glutamine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O84027 1.61e-23 100 32 6 239 3 prmC Release factor glutamine methyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
P39199 2.72e-23 100 33 3 196 1 prmB Ribosomal protein uL3 glutamine methyltransferase Escherichia coli (strain K12)
Q921L7 1e-22 99 32 7 236 2 Hemk1 MTRF1L release factor glutamine methyltransferase Mus musculus
Q32DK7 1.33e-22 98 33 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
P74003 1.43e-22 97 32 6 225 3 prmC Release factor glutamine methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6F0I4 1.61e-22 97 29 6 245 3 prmC Release factor glutamine methyltransferase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
Q5E3U5 1.72e-22 97 31 3 199 3 prmB Ribosomal protein uL3 glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
P39200 4e-22 96 32 3 192 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio anguillarum (strain ATCC 68554 / 775)
Q6MU88 6e-22 95 25 3 237 3 prmC Release factor glutamine methyltransferase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9KQ83 6.37e-22 96 32 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87DS5 1.08e-21 95 31 3 210 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PDL1 1.24e-21 95 31 3 210 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
Q8ECQ4 1.83e-21 95 31 7 237 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P0A293 1.83e-21 95 32 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A294 1.83e-21 95 32 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhi
Q9Y5R4 2.74e-21 95 28 7 270 1 HEMK1 MTRF1L release factor glutamine methyltransferase Homo sapiens
Q5NEL0 4.67e-21 94 28 2 201 3 prmB Ribosomal protein uL3 glutamine methyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
P45106 1.32e-20 92 33 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WHV2 4.43e-20 91 28 9 269 3 prmC Release factor glutamine methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0DJB1 5.14e-20 90 28 5 215 3 prmC Release factor glutamine methyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QDG2 5.14e-20 90 28 5 215 3 prmC Release factor glutamine methyltransferase Corynebacterium glutamicum (strain R)
Q0WDE1 1.71e-19 89 31 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Yersinia pestis
Q9CNN7 9.72e-19 87 31 2 192 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pasteurella multocida (strain Pm70)
Q9WYV8 1.48e-18 86 33 7 210 1 prmC Release factor glutamine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P9WHV3 2.63e-18 86 28 9 269 1 prmC Release factor glutamine methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P45832 3.68e-18 85 26 8 284 3 prmC Release factor glutamine methyltransferase Mycobacterium leprae (strain TN)
P72542 1.73e-16 80 27 4 263 1 papM 4-amino-L-phenylalanine/4-methylamino-L-phenylalanine methyltransferase Streptomyces pristinaespiralis
P75419 2.13e-15 79 31 5 180 4 MPN_362 Uncharacterized protein MG259 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q9JTA1 3.32e-15 77 28 6 233 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9JYC0 3.8e-15 77 28 6 233 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q5F783 7.45e-14 73 27 6 233 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7VXJ6 8.62e-14 73 25 3 231 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q89DG5 6.88e-13 70 27 3 210 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q58338 9.25e-13 68 29 5 170 3 MJ0928 Putative protein N5-glutamine methyltransferase MJ0928 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P53944 9.09e-12 67 30 6 179 1 MTQ1 Mitochondrial MRF1 N(5)-glutamine methyltransferase MTQ1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q49404 2.85e-10 63 27 9 197 4 MG259 Uncharacterized protein MG259 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q65W50 5.99e-10 61 36 3 93 3 MS0203 tRNA1(Val) (adenine(37)-N6)-methyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O14028 8.22e-10 62 26 9 220 3 mtq1 Probable MRF1 mitochondrial N(5)-glutamine methyltransferase mtq1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q63SZ9 1.75e-09 60 25 4 235 3 prmB Ribosomal protein uL3 glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
B8F678 6.36e-08 55 34 1 83 3 HAPS_1234 tRNA1(Val) (adenine(37)-N6)-methyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
P37872 1.41e-07 54 39 1 74 3 ybxB Uncharacterized protein YbxB Bacillus subtilis (strain 168)
B3H2W9 2e-07 54 37 3 81 3 APP7_1987 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q0I4T7 4.98e-07 53 34 3 91 3 HS_1296 tRNA1(Val) (adenine(37)-N6)-methyltransferase Histophilus somni (strain 129Pt)
A3N3J4 9.62e-07 52 35 3 81 3 APL_1900 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A4SRS5 1.19e-06 52 39 3 83 3 ASA_3636 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas salmonicida (strain A449)
C6X2D2 1.27e-06 52 32 1 82 3 FIC_02159 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacteriaceae bacterium (strain 3519-10)
A6L532 1.31e-06 52 39 3 83 3 BVU_3164 tRNA1(Val) (adenine(37)-N6)-methyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A0KPC4 2.28e-06 51 32 6 136 3 AHA_3669 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A6VKA4 2.88e-06 50 38 3 85 3 Asuc_0019 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
C6AQR4 3.2e-06 50 34 3 87 3 NT05HA_1847 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aggregatibacter aphrophilus (strain NJ8700)
C6Y2G0 4.16e-06 50 36 1 80 3 Phep_2972 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pedobacter heparinus (strain ATCC 13125 / DSM 2366 / CIP 104194 / JCM 7457 / NBRC 12017 / NCIMB 9290 / NRRL B-14731 / HIM 762-3)
C5BAI6 4.92e-06 50 32 3 99 3 NT01EI_3041 tRNA1(Val) (adenine(37)-N6)-methyltransferase Edwardsiella ictaluri (strain 93-146)
A5UGT6 6.47e-06 49 34 3 81 3 CGSHiGG_05325 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain PittGG)
C6VS84 8.12e-06 49 27 4 138 3 Dfer_5119 tRNA1(Val) (adenine(37)-N6)-methyltransferase Dyadobacter fermentans (strain ATCC 700827 / DSM 18053 / CIP 107007 / KCTC 52180 / NS114)
B4F055 8.87e-06 49 25 4 162 3 PMI1896 tRNA1(Val) (adenine(37)-N6)-methyltransferase Proteus mirabilis (strain HI4320)
P45558 8.88e-06 50 33 2 83 2 prmA Ribosomal protein L11 methyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q87SB8 9.99e-06 49 33 2 89 3 VP0506 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A6LD46 1.4e-05 48 38 3 84 3 BDI_1875 tRNA1(Val) (adenine(37)-N6)-methyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A5UA66 1.53e-05 48 33 3 81 3 CGSHiEE_00885 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain PittEE)
Q0HRP2 1.69e-05 48 33 3 87 3 Shewmr7_3230 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sp. (strain MR-7)
Q8A9H7 1.74e-05 48 38 3 81 3 BT_0838 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8IZ69 1.75e-05 49 38 5 108 1 TRMT2A tRNA (uracil-5-)-methyltransferase homolog A Homo sapiens
Q0HM44 1.88e-05 48 33 3 87 3 Shewmr4_0793 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella sp. (strain MR-4)
Q2RKY6 2.2e-05 48 35 3 90 3 prmA Ribosomal protein L11 methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q84BQ9 2.39e-05 48 34 2 90 1 prmA Ribosomal protein L11 methyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
B0UWL8 2.46e-05 48 32 3 91 3 HSM_0322 tRNA1(Val) (adenine(37)-N6)-methyltransferase Histophilus somni (strain 2336)
A7MXM2 2.83e-05 47 26 6 153 3 VIBHAR_00953 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
B5YRC4 2.83e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAK8 2.83e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O157:H7
B5F9T8 2.92e-05 47 30 2 93 3 VFMJ11_0445 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio fischeri (strain MJ11)
Q1R6P6 2.96e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli (strain UTI89 / UPEC)
Q8FDE5 2.96e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AG02 2.96e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O1:K1 / APEC
P42596 3.04e-05 48 26 4 142 1 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli (strain K12)
B1IRN3 3.04e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B1XG88 3.04e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli (strain K12 / DH10B)
B1LFI2 3.07e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli (strain SMS-3-5 / SECEC)
Q0TD22 3.07e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A0LXM6 3.12e-05 47 32 9 129 3 GFO_0132 tRNA1(Val) (adenine(37)-N6)-methyltransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q4QNC1 3.13e-05 47 30 3 84 3 NTHI0547 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain 86-028NP)
Q32BN8 3.16e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Shigella dysenteriae serotype 1 (strain Sd197)
P44702 3.22e-05 47 32 3 84 3 HI_0423 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WKL5 3.39e-05 47 33 6 122 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKL4 3.39e-05 47 33 6 122 3 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZU0 3.39e-05 47 33 6 122 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KG37 3.39e-05 47 33 6 122 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
A7ZRW7 3.55e-05 48 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O139:H28 (strain E24377A / ETEC)
Q4QPN2 3.95e-05 48 33 6 118 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain 86-028NP)
Q821A5 4.7e-05 47 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Shigella flexneri
Q3YXQ6 4.74e-05 47 33 1 77 3 rlmG Ribosomal RNA large subunit methyltransferase G Shigella sonnei (strain Ss046)
Q0T0I4 4.74e-05 47 33 1 77 3 rlmG Ribosomal RNA large subunit methyltransferase G Shigella flexneri serotype 5b (strain 8401)
Q31WU9 4.74e-05 47 33 1 77 3 rlmG Ribosomal RNA large subunit methyltransferase G Shigella boydii serotype 4 (strain Sb227)
B2U1T3 4.78e-05 47 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8A4P1 4.78e-05 47 26 4 142 3 rlmG Ribosomal RNA large subunit methyltransferase G Escherichia coli O9:H4 (strain HS)
A8GI34 5.17e-05 47 34 2 85 3 Spro_3678 tRNA1(Val) (adenine(37)-N6)-methyltransferase Serratia proteamaculans (strain 568)
A8APY0 6.16e-05 47 33 1 77 3 rlmG Ribosomal RNA large subunit methyltransferase G Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8XA22 6.45e-05 47 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O157:H7
C6UQY1 6.88e-05 47 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5Z149 6.88e-05 47 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q3YYU0 7.9e-05 46 33 4 89 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella sonnei (strain Ss046)
Q31XR1 8.2e-05 46 33 4 89 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TYI8 8.2e-05 46 33 4 89 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A9MGW2 8.51e-05 46 36 2 85 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q83QI2 8.59e-05 46 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella flexneri
Q0T1T1 8.59e-05 46 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella flexneri serotype 5b (strain 8401)
B6I5E9 8.59e-05 46 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain SE11)
B7M8I9 8.59e-05 46 34 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O8 (strain IAI1)
A4TKY7 9.15e-05 46 34 4 87 3 YPDSF_1562 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis (strain Pestoides F)
Q1CKF3 9.15e-05 46 34 4 87 3 YPN_1197 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3Z3 9.15e-05 46 34 4 87 3 YpAngola_A3602 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q1C564 9.15e-05 46 34 4 87 3 YPA_2443 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT0 9.15e-05 46 34 4 87 3 YpsIP31758_1127 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q74IX0 9.42e-05 46 32 2 89 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q667U2 9.97e-05 46 34 4 87 3 YPTB2899 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q74SR9 9.97e-05 46 34 4 87 3 YPO2709 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis
B2KA56 9.97e-05 46 34 4 87 3 YPTS_3010 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JRB8 0.000101 46 34 4 87 3 YPK_1180 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q043X8 0.000103 46 32 2 89 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A4WER8 0.000105 47 23 10 254 3 rlmG Ribosomal RNA large subunit methyltransferase G Enterobacter sp. (strain 638)
Q82N59 0.000107 47 33 0 77 3 rlmG Ribosomal RNA large subunit methyltransferase G Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q15NR8 0.00012 46 29 4 95 3 Patl_3970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q7MNQ4 0.000123 45 29 2 95 3 VV0662 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain YJ016)
Q3IG80 0.000133 45 28 0 83 3 PSHAa0511 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pseudoalteromonas translucida (strain TAC 125)
B4T690 0.000174 46 26 4 147 3 rlmG Ribosomal RNA large subunit methyltransferase G Salmonella newport (strain SL254)
A8AD10 0.000178 45 38 5 88 3 CKO_00207 tRNA1(Val) (adenine(37)-N6)-methyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q57JN9 0.000182 46 26 4 147 3 rlmG Ribosomal RNA large subunit methyltransferase G Salmonella choleraesuis (strain SC-B67)
B5F6B6 0.000182 46 26 4 147 3 rlmG Ribosomal RNA large subunit methyltransferase G Salmonella agona (strain SL483)
P44453 0.000183 45 33 5 117 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0TNT3 0.000197 45 33 2 83 3 prmA Ribosomal protein L11 methyltransferase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
A5UFI6 0.000208 45 33 5 117 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus influenzae (strain PittGG)
Q9CJZ9 0.000214 45 34 3 89 3 PM1839 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pasteurella multocida (strain Pm70)
B6EMW5 0.000218 45 28 2 95 3 VSAL_I0559 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio salmonicida (strain LFI1238)
A0Q1R2 0.000225 45 23 5 177 3 prmA Ribosomal protein L11 methyltransferase Clostridium novyi (strain NT)
Q0TER3 0.000277 45 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q1R8F7 0.000282 45 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain UTI89 / UPEC)
Q8FF14 0.000282 45 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1AEA5 0.000282 45 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O1:K1 / APEC
B7MIR0 0.000282 45 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UH15 0.000282 45 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
O86951 0.000287 45 34 3 81 3 prmA Ribosomal protein L11 methyltransferase Thermotoga neapolitana
A9MPU2 0.000288 45 32 1 77 3 rlmG Ribosomal RNA large subunit methyltransferase G Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q5FKI8 0.000289 45 28 2 89 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B2RK25 0.000308 45 34 1 79 3 PGN_1201 tRNA1(Val) (adenine(37)-N6)-methyltransferase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
B7LDG8 0.000327 44 33 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain 55989 / EAEC)
A7ZQ20 0.000327 44 33 2 86 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7MVG0 0.000328 44 34 1 79 3 PG_1104 tRNA1(Val) (adenine(37)-N6)-methyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q8DEQ3 0.000363 44 30 2 91 3 VV1_0533 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain CMCP6)
Q8DSK3 0.000371 45 29 6 117 3 SMU_1779c Uncharacterized RNA methyltransferase SMU_1779c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8YR05 0.000371 45 28 10 203 3 alr3654 Uncharacterized RNA methyltransferase alr3654 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B1LP88 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B7N6G4 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P31825 0.000389 44 35 3 87 1 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain K12)
B1IVQ2 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A386 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O9:H4 (strain HS)
B1XBQ2 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain K12 / DH10B)
C4ZYJ8 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
C6UBI3 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain B / REL606)
C5W7S9 0.000389 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli (strain B / BL21-DE3)
A7MGA7 0.000412 45 31 5 120 3 rsmC Ribosomal RNA small subunit methyltransferase C Cronobacter sakazakii (strain ATCC BAA-894)
B7MYK8 0.000415 44 34 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O81 (strain ED1a)
Q32CU6 0.000419 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
B7NRM8 0.000422 44 35 3 87 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q39Q76 0.000425 44 37 5 87 3 prmA Ribosomal protein L11 methyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A6GWI6 0.000435 44 31 2 83 3 FP0346 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q64TX7 0.000481 44 30 3 94 3 BF2305 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides fragilis (strain YCH46)
B1KZN5 0.000505 44 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Loch Maree / Type A3)
A7GHH4 0.000543 44 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1ILM1 0.000543 44 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Okra / Type B1)
C1FVT8 0.000558 44 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Kyoto / Type A2)
A5I638 0.000558 44 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXL3 0.000558 44 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain ATCC 19397 / Type A)
Q11RK8 0.000561 43 25 3 126 3 CHU_2705 tRNA1(Val) (adenine(37)-N6)-methyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
A5N6M4 0.000599 44 31 2 90 3 prmA Ribosomal protein L11 methyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E043 0.000599 44 31 2 90 3 prmA Ribosomal protein L11 methyltransferase Clostridium kluyveri (strain NBRC 12016)
A8MG53 0.000623 44 25 1 90 3 prmA Ribosomal protein L11 methyltransferase Alkaliphilus oremlandii (strain OhILAs)
A8ALZ1 0.000653 44 37 3 79 3 rsmC Ribosomal RNA small subunit methyltransferase C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q8E6W1 0.00069 44 28 4 108 3 gbs0448 Uncharacterized RNA methyltransferase gbs0448 Streptococcus agalactiae serotype III (strain NEM316)
B5Y286 0.00079 43 32 3 95 3 rsmC Ribosomal RNA small subunit methyltransferase C Klebsiella pneumoniae (strain 342)
Q72HI4 0.000804 43 41 2 68 3 menG Demethylmenaquinone methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q57G51 0.000811 43 35 2 77 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella choleraesuis (strain SC-B67)
Q5LCS1 0.000876 43 30 3 94 3 BF2394 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
C3L3G5 0.001 43 30 2 82 3 prmA Ribosomal protein L11 methyltransferase Clostridium botulinum (strain 657 / Type Ba4)
Q6D3S2 0.001 43 35 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8Z4J9 0.001 43 30 6 146 3 yfiC tRNA1(Val) (adenine(37)-N6)-methyltransferase Salmonella typhi
C4LCN4 0.001 43 27 5 165 3 Tola_0970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05270
Feature type CDS
Gene prmC
Product peptide chain release factor N(5)-glutamine methyltransferase
Location 1151628 - 1152476 (strand: 1)
Length 849 (nucleotides) / 282 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_612
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13847 Methyltransferase domain
PF17827 PrmC N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2890 Translation, ribosomal structure and biogenesis (J) J Methylase of polypeptide chain release factors

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02493 release factor glutamine methyltransferase [EC:2.1.1.297] - -

Protein Sequence

MNYKQWLHQAALQLIDSDSPKRDAEILLGHVTKRARTYLIAFSETVLLEDEQVQLSSLLARRIKGEPIAYLVGEREFWSLPLKVSPATLIPRPDTECLVEKALEKLSAQASRILDLGTGTGAIALAIASERSDCRVLGVDFQPEAVALAIENAQHLALSNVEFTESCWFSSLSGYQFDMIISNPPYIDEEDEHLYQGDVRFEPLTALVAADHGFADIELIITNARQFLANNGWVLIEHGWQQGERVRNIFIDKGYCCVETFRDYGGNERVTVGRWNDDRNHS

Flanking regions ( +/- flanking 50bp)

GTCACTGAATATCAAGCCGATCAGCTATCCGCTTTATCTGAGCAAGATTAATGAATTATAAACAATGGCTGCATCAAGCAGCCTTGCAATTAATTGATAGTGACAGCCCAAAGCGGGACGCAGAAATTCTATTAGGGCACGTAACAAAGCGTGCTCGTACTTATTTGATTGCTTTTAGTGAAACTGTACTTTTAGAAGATGAACAAGTGCAATTGTCATCCCTCCTTGCTCGACGTATAAAGGGCGAGCCTATCGCTTATTTAGTAGGAGAGAGAGAATTTTGGTCACTACCTTTAAAAGTCTCTCCTGCAACACTTATCCCTCGGCCCGATACCGAATGTCTAGTTGAAAAAGCATTAGAGAAACTCTCTGCACAAGCAAGTCGAATTTTAGATTTAGGTACGGGGACAGGGGCTATTGCCTTAGCGATAGCTTCGGAACGTTCTGACTGCCGTGTCCTTGGTGTTGATTTTCAACCAGAAGCGGTAGCATTAGCGATAGAAAATGCACAACATTTGGCACTTAGCAACGTAGAATTTACGGAAAGTTGCTGGTTTAGTTCACTCTCTGGTTATCAATTTGATATGATAATCAGCAATCCTCCTTATATTGATGAAGAAGATGAGCATCTTTATCAAGGAGACGTTCGCTTTGAGCCATTAACCGCATTGGTCGCGGCAGATCATGGTTTTGCTGATATTGAGCTTATTATTACAAATGCCCGTCAGTTTTTAGCTAATAACGGTTGGGTATTAATAGAGCATGGTTGGCAACAAGGTGAAAGAGTACGTAATATTTTTATTGATAAGGGTTACTGCTGCGTGGAAACTTTCCGTGATTACGGCGGTAATGAGCGAGTGACAGTAGGTCGTTGGAATGATGATAGAAACCATAGCTGATTACGAATTTAACAAAGCCCCTTTGGTTAAGGGTATGATCCTTATCTCTC