Homologs in group_612

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_01930 FBDBKF_01930 100.0 Morganella morganii S1 prmC peptide chain release factor N(5)-glutamine methyltransferase
NLDBIP_01060 NLDBIP_01060 100.0 Morganella morganii S4 prmC peptide chain release factor N(5)-glutamine methyltransferase
LHKJJB_00975 LHKJJB_00975 100.0 Morganella morganii S3 prmC peptide chain release factor N(5)-glutamine methyltransferase
HKOGLL_01015 HKOGLL_01015 100.0 Morganella morganii S5 prmC peptide chain release factor N(5)-glutamine methyltransferase
F4V73_RS04275 F4V73_RS04275 83.8 Morganella psychrotolerans prmC peptide chain release factor N(5)-glutamine methyltransferase
PMI_RS05270 PMI_RS05270 61.9 Proteus mirabilis HI4320 prmC peptide chain release factor N(5)-glutamine methyltransferase

Distribution of the homologs in the orthogroup group_612

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_612

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P40816 6.87e-123 354 65 0 274 3 prmC Release factor glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0ACC2 9.53e-123 354 63 0 274 3 prmC Release factor glutamine methyltransferase Shigella flexneri
P0ACC1 9.53e-123 354 63 0 274 1 prmC Release factor glutamine methyltransferase Escherichia coli (strain K12)
Q32GZ5 1.58e-122 353 63 0 274 3 prmC Release factor glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q7CIA2 1.18e-119 346 61 1 274 3 prmC Release factor glutamine methyltransferase Yersinia pestis
P57269 6.3e-98 291 48 1 278 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q5E6T2 6.32e-97 289 55 1 262 3 prmC Release factor glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q9KQ26 1.55e-95 285 54 2 277 3 prmC Release factor glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P45253 1.11e-90 273 52 6 290 3 prmC Release factor glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8EAR4 1.66e-84 257 50 0 264 3 prmC Release factor glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q89AT0 2.03e-84 257 46 3 278 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8K9W9 8.56e-84 255 44 1 276 3 prmC Release factor glutamine methyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9HVC8 8.84e-84 255 53 0 263 3 prmC Release factor glutamine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PC99 8.01e-78 240 49 2 275 3 prmC Release factor glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q9CN82 1.04e-73 230 47 6 296 3 prmC Release factor glutamine methyltransferase Pasteurella multocida (strain Pm70)
Q87DF7 2.17e-67 213 46 1 255 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PD67 8.78e-67 212 45 1 255 3 prmC Release factor glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
Q83AD8 5.18e-66 210 41 2 260 3 prmC Release factor glutamine methyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q5F5B4 1.17e-64 206 45 6 276 3 prmC Release factor glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q7W022 4.62e-61 197 43 3 256 3 prmC Release factor glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q1II29 1.57e-57 188 40 6 280 3 prmC Release factor glutamine methyltransferase Koribacter versatilis (strain Ellin345)
Q5NIA7 2.14e-57 188 37 2 277 3 prmC Release factor glutamine methyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q63QE9 7.87e-57 187 44 3 259 3 prmC Release factor glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
Q98G94 1.89e-53 178 43 5 277 3 prmC Release factor glutamine methyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q2RFW1 7.08e-50 169 41 4 283 3 prmC Release factor glutamine methyltransferase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q748B2 3.49e-49 167 40 4 272 3 prmC Release factor glutamine methyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
A9CG70 1.01e-48 166 42 5 264 3 prmC Release factor glutamine methyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q2RWE0 1.32e-46 161 40 3 265 3 prmC Release factor glutamine methyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q8R619 3.78e-46 161 37 3 229 3 prmC Release factor glutamine methyltransferase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q9A9T7 4.48e-45 156 37 5 278 3 prmC Release factor glutamine methyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q1RH40 1.69e-44 161 31 4 300 3 prmC/trmB Bifunctional methyltransferase Rickettsia bellii (strain RML369-C)
Q92G13 2.99e-43 157 32 6 301 3 prmC/trmB Bifunctional methyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q97F67 1.77e-42 149 33 4 282 3 prmC Release factor glutamine methyltransferase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8DPZ3 1.02e-41 147 39 4 237 3 prmC Release factor glutamine methyltransferase Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q68VR6 2.33e-41 152 33 4 272 3 prmC/trmB Bifunctional methyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCB3 5.77e-41 151 33 3 272 3 prmC/trmB Bifunctional methyltransferase Rickettsia prowazekii (strain Madrid E)
Q7ULT2 8.81e-41 145 36 8 275 3 prmC Release factor glutamine methyltransferase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q4UJU4 9.04e-41 150 32 6 304 3 prmC/trmB Bifunctional methyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
O66506 1.08e-37 137 33 3 257 3 prmC Release factor glutamine methyltransferase Aquifex aeolicus (strain VF5)
A9WBM9 2.38e-37 136 36 8 280 3 prmC Release factor glutamine methyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q9CHX0 7.04e-37 134 40 4 212 3 prmC Release factor glutamine methyltransferase Lactococcus lactis subsp. lactis (strain IL1403)
B5YIQ8 8.57e-37 134 32 3 241 3 prmC Release factor glutamine methyltransferase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
Q727D9 9.7e-37 135 36 5 281 3 prmC Release factor glutamine methyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8KCD5 4.04e-36 133 38 6 264 3 prmC Release factor glutamine methyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q2S0V8 6.79e-35 130 34 6 275 3 prmC Release factor glutamine methyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q831F7 2.19e-34 128 35 3 210 3 prmC Release factor glutamine methyltransferase Enterococcus faecalis (strain ATCC 700802 / V583)
Q7NJS7 3.73e-33 125 33 6 272 3 prmC Release factor glutamine methyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q9RXR2 2.26e-32 123 34 5 278 3 prmC Release factor glutamine methyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6H162 1.01e-31 121 34 5 222 3 prmC Release factor glutamine methyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q89XT8 1.16e-31 122 39 4 234 3 prmC Release factor glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P45873 3.74e-31 120 32 5 269 3 prmC Release factor glutamine methyltransferase Bacillus subtilis (strain 168)
Q3J2B7 1.78e-30 118 38 5 269 3 prmC Release factor glutamine methyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q6MU88 2.23e-29 115 28 6 252 3 prmC Release factor glutamine methyltransferase Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q8A1D7 2.34e-29 115 33 5 233 3 prmC Release factor glutamine methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8Y4A9 3.35e-29 115 33 6 253 3 prmC Release factor glutamine methyltransferase Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q2FWE1 1.45e-27 110 30 5 254 3 prmC Release factor glutamine methyltransferase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6F0I4 1.64e-27 110 29 7 267 3 prmC Release factor glutamine methyltransferase Mesoplasma florum (strain ATCC 33453 / NBRC 100688 / NCTC 11704 / L1)
P39200 1.94e-26 108 36 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio anguillarum (strain ATCC 68554 / 775)
Q8F987 2.15e-26 107 32 6 252 3 prmC Release factor glutamine methyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q8DHV7 2.44e-26 107 35 6 221 3 prmC Release factor glutamine methyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q9K4E3 5.35e-26 106 34 9 256 3 prmC Release factor glutamine methyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A5HY34 9.53e-26 105 29 5 290 3 prmC Release factor glutamine methyltransferase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
Q814U1 9.93e-26 105 28 6 277 3 prmC Release factor glutamine methyltransferase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8P7Q8 1.08e-24 103 31 4 245 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q81JX2 2.33e-24 102 28 6 277 3 prmC Release factor glutamine methyltransferase Bacillus anthracis
P45106 2.8e-24 102 34 2 193 3 prmB Ribosomal protein uL3 glutamine methyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B8E004 3.45e-24 101 31 6 216 3 prmC Release factor glutamine methyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
P39199 3.65e-24 102 35 3 196 1 prmB Ribosomal protein uL3 glutamine methyltransferase Escherichia coli (strain K12)
A0R213 4.52e-24 101 34 8 262 3 prmC Release factor glutamine methyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
B0B9D1 5.26e-24 101 33 8 256 1 prmC Release factor glutamine methyltransferase Chlamydia trachomatis serovar L2 (strain ATCC VR-902B / DSM 19102 / 434/Bu)
Q8G3P4 6.13e-24 101 28 8 290 3 prmC Release factor glutamine methyltransferase Bifidobacterium longum (strain NCC 2705)
O84027 8.03e-24 100 33 8 256 3 prmC Release factor glutamine methyltransferase Chlamydia trachomatis serovar D (strain ATCC VR-885 / DSM 19411 / UW-3/Cx)
Q5E3U5 1.69e-23 100 34 3 199 3 prmB Ribosomal protein uL3 glutamine methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q32DK7 1.82e-23 100 34 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
P0A293 5.1e-23 99 35 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A294 5.1e-23 99 35 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Salmonella typhi
Q8ECQ4 6.19e-23 99 35 5 198 3 prmB Ribosomal protein uL3 glutamine methyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9I347 9.09e-23 98 34 5 229 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KQ83 1.96e-22 97 34 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P74003 7.91e-22 95 33 6 219 3 prmC Release factor glutamine methyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q0WDE1 1.83e-21 94 33 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Yersinia pestis
Q9CNN7 2.53e-21 94 33 3 196 3 prmB Ribosomal protein uL3 glutamine methyltransferase Pasteurella multocida (strain Pm70)
Q9PDL1 7.37e-21 93 32 5 246 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xylella fastidiosa (strain 9a5c)
Q87DS5 7.45e-21 93 31 5 246 3 prmB Ribosomal protein uL3 glutamine methyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9WYV8 9.81e-21 92 33 7 233 1 prmC Release factor glutamine methyltransferase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O51215 1.74e-20 91 29 7 219 3 prmC Release factor glutamine methyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P45832 1.43e-19 89 29 11 292 3 prmC Release factor glutamine methyltransferase Mycobacterium leprae (strain TN)
Q9Y5R4 1.01e-18 87 28 5 269 1 HEMK1 MTRF1L release factor glutamine methyltransferase Homo sapiens
P9WHV3 1.29e-18 87 30 11 268 1 prmC Release factor glutamine methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WHV2 2.95e-18 85 29 11 272 3 prmC Release factor glutamine methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q5NEL0 6.19e-18 85 33 5 184 3 prmB Ribosomal protein uL3 glutamine methyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
P0DJB1 1.25e-17 84 28 6 217 3 prmC Release factor glutamine methyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QDG2 1.25e-17 84 28 6 217 3 prmC Release factor glutamine methyltransferase Corynebacterium glutamicum (strain R)
P75419 2.77e-17 84 33 6 171 4 MPN_362 Uncharacterized protein MG259 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q7VDL7 6.49e-17 82 33 6 218 3 prmC Release factor glutamine methyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q921L7 1.58e-15 78 30 6 276 2 Hemk1 MTRF1L release factor glutamine methyltransferase Mus musculus
Q7VXJ6 3.56e-15 77 30 4 194 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q89DG5 5.74e-14 73 29 4 223 3 prmB Ribosomal protein uL3 glutamine methyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9JYC0 3.64e-13 71 27 8 293 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JTA1 1.59e-12 69 27 8 293 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5F783 9.55e-12 67 27 8 293 3 prmB Ribosomal protein uL3 glutamine methyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q63SZ9 1.92e-11 66 26 7 260 3 prmB Ribosomal protein uL3 glutamine methyltransferase Burkholderia pseudomallei (strain K96243)
Q58338 3.11e-11 64 28 5 159 3 MJ0928 Putative protein N5-glutamine methyltransferase MJ0928 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q49404 6.34e-11 65 27 7 168 4 MG259 Uncharacterized protein MG259 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P53944 6.52e-11 65 26 9 234 1 MTQ1 Mitochondrial MRF1 N(5)-glutamine methyltransferase MTQ1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P72542 3.76e-10 62 28 2 225 1 papM 4-amino-L-phenylalanine/4-methylamino-L-phenylalanine methyltransferase Streptomyces pristinaespiralis
O14028 3.59e-09 60 25 10 243 3 mtq1 Probable MRF1 mitochondrial N(5)-glutamine methyltransferase mtq1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P37872 1.82e-08 56 26 6 171 3 ybxB Uncharacterized protein YbxB Bacillus subtilis (strain 168)
A7MXM2 2.48e-07 53 34 1 81 3 VIBHAR_00953 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q0I4T7 2.87e-07 53 38 3 81 3 HS_1296 tRNA1(Val) (adenine(37)-N6)-methyltransferase Histophilus somni (strain 129Pt)
B8F678 4.31e-07 53 34 2 93 3 HAPS_1234 tRNA1(Val) (adenine(37)-N6)-methyltransferase Glaesserella parasuis serovar 5 (strain SH0165)
Q65W50 7.87e-07 52 37 3 83 3 MS0203 tRNA1(Val) (adenine(37)-N6)-methyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q8DSK3 1.01e-06 53 29 4 124 3 SMU_1779c Uncharacterized RNA methyltransferase SMU_1779c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q9KL20 1.27e-06 52 27 6 173 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C6X2D2 1.36e-06 51 34 3 85 3 FIC_02159 tRNA1(Val) (adenine(37)-N6)-methyltransferase Flavobacteriaceae bacterium (strain 3519-10)
Q87SB8 1.5e-06 51 35 2 91 3 VP0506 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P9WKL5 1.53e-06 51 40 4 101 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WKL4 1.53e-06 51 40 4 101 3 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZU0 1.53e-06 51 40 4 101 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KG37 1.53e-06 51 40 4 101 1 htm 2-heptyl-1-hydroxyquinolin-4(1H)-one methyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
C6Y2G0 1.85e-06 51 36 3 93 3 Phep_2972 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pedobacter heparinus (strain ATCC 13125 / DSM 2366 / CIP 104194 / JCM 7457 / NBRC 12017 / NCIMB 9290 / NRRL B-14731 / HIM 762-3)
Q15NR8 2.18e-06 51 36 3 83 3 Patl_3970 tRNA1(Val) (adenine(37)-N6)-methyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
C3LWJ3 2.81e-06 51 27 6 173 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Vibrio cholerae serotype O1 (strain M66-2)
A5F0U5 2.81e-06 51 27 6 173 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
A5UGT6 4.16e-06 50 34 3 85 3 CGSHiGG_05325 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain PittGG)
B4T4F9 9.97e-06 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella newport (strain SL254)
B4TGY8 1.01e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella heidelberg (strain SL476)
B5BL07 1.02e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi A (strain AKU_12601)
Q5PK16 1.02e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TU29 1.03e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella schwarzengrund (strain CVM19633)
B5R9T9 1.03e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5F512 1.03e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella agona (strain SL483)
Q8ZJW6 1.05e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5R2I6 1.05e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella enteritidis PT4 (strain P125109)
B5FTB3 1.05e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella dublin (strain CT_02021853)
Q57G51 1.08e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella choleraesuis (strain SC-B67)
Q8Z0V2 1.12e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella typhi
A9N7C4 1.14e-05 49 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
A8ALZ1 1.24e-05 49 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B1LEH4 1.34e-05 49 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain SMS-3-5 / SECEC)
Q1R2D5 1.37e-05 49 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain UTI89 / UPEC)
A1AJP2 1.37e-05 49 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O1:K1 / APEC
Q58292 1.48e-05 48 34 3 93 1 MJ0882 Probable S-adenosylmethionine-dependent methyltransferase MJ0882 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q0T8U3 1.51e-05 49 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7MTB6 1.53e-05 49 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O81 (strain ED1a)
Q8A9H7 1.78e-05 48 39 3 78 3 BT_0838 tRNA1(Val) (adenine(37)-N6)-methyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
C3LSR6 1.98e-05 48 32 3 96 3 VCM66_0619 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q9KU62 1.98e-05 48 32 3 96 3 VC_0661 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q327M6 2.05e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Shigella dysenteriae serotype 1 (strain Sd197)
P39406 2.05e-05 48 26 8 189 1 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain K12)
B1XFI0 2.05e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain K12 / DH10B)
B7MNC1 2.05e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O45:K1 (strain S88 / ExPEC)
A5UA66 2.21e-05 48 32 3 85 3 CGSHiEE_00885 tRNA1(Val) (adenine(37)-N6)-methyltransferase Haemophilus influenzae (strain PittEE)
Q39Q76 2.28e-05 48 40 6 95 3 prmA Ribosomal protein L11 methyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A9MRB9 2.79e-05 48 35 2 84 3 rsmC Ribosomal RNA small subunit methyltransferase C Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B5Y286 2.79e-05 48 33 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Klebsiella pneumoniae (strain 342)
B1IS49 2.84e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B5Z4Q2 2.98e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X510 2.98e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O157:H7
B7LEL6 3e-05 48 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain 55989 / EAEC)
B7NPF5 3.8e-05 48 39 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7UMV1 3.94e-05 48 39 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LNK6 4.24e-05 47 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7LN23 5.46e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q7MNQ4 5.77e-05 47 29 2 94 3 VV0662 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain YJ016)
A4W687 6.2e-05 47 31 2 100 3 rsmC Ribosomal RNA small subunit methyltransferase C Enterobacter sp. (strain 638)
B2TUM0 6.43e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q0SX40 6.56e-05 47 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Shigella flexneri serotype 5b (strain 8401)
Q9KPR9 7.11e-05 47 34 2 87 3 rlmG Ribosomal RNA large subunit methyltransferase G Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F5X3 7.11e-05 47 34 2 87 3 rlmG Ribosomal RNA large subunit methyltransferase G Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q820Z6 7.31e-05 47 26 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Shigella flexneri
Q7VP87 7.82e-05 47 37 2 80 3 rsmC Ribosomal RNA small subunit methyltransferase C Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q323P2 7.99e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Shigella boydii serotype 4 (strain Sb227)
B1IWR3 8.13e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYG2 8.13e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O9:H4 (strain HS)
B1LN12 8.2e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli (strain SMS-3-5 / SECEC)
Q83S14 8.35e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Shigella flexneri
Q0T8K2 8.35e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Shigella flexneri serotype 5b (strain 8401)
Q1RE66 8.35e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli (strain UTI89 / UPEC)
Q0TJI9 8.35e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A998 8.35e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O1:K1 / APEC
B7MHG3 8.35e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O45:K1 (strain S88 / ExPEC)
B7NAK5 8.58e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q8FJE7 8.74e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7MQW3 8.82e-05 47 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O81 (strain ED1a)
Q8DEQ3 8.92e-05 46 29 2 92 3 VV1_0533 tRNA1(Val) (adenine(37)-N6)-methyltransferase Vibrio vulnificus (strain CMCP6)
Q72W54 9.03e-05 47 32 2 91 3 LIC_10086 Uncharacterized RNA methyltransferase LIC_10086 Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q8F9U1 9.61e-05 47 32 2 91 3 LA_0098 Uncharacterized RNA methyltransferase LA_0098 Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
B0UWL8 0.000107 46 35 3 81 3 HSM_0322 tRNA1(Val) (adenine(37)-N6)-methyltransferase Histophilus somni (strain 2336)
B7NVD9 0.000114 46 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O7:K1 (strain IAI39 / ExPEC)
A6LD46 0.000122 45 39 3 78 3 BDI_1875 tRNA1(Val) (adenine(37)-N6)-methyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
Q32ID7 0.000122 46 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Shigella dysenteriae serotype 1 (strain Sd197)
Q8FA64 0.000127 46 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4TKY7 0.000129 45 34 3 82 3 YPDSF_1562 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis (strain Pestoides F)
Q1CKF3 0.000129 45 34 3 82 3 YPN_1197 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3Z3 0.000129 45 34 3 82 3 YpAngola_A3602 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Angola)
Q1C564 0.000129 45 34 3 82 3 YPA_2443 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FFT0 0.000129 45 34 3 82 3 YpsIP31758_1127 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
Q667U2 0.000143 45 34 3 82 3 YPTB2899 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q74SR9 0.000143 45 34 3 82 3 YPO2709 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pestis
B2KA56 0.000143 45 34 3 82 3 YPTS_3010 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
B1JRB8 0.000148 45 34 3 82 3 YPK_1180 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
B7NH38 0.000159 46 30 3 102 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
A8AIQ7 0.000212 45 38 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q043X8 0.000218 45 32 2 89 3 prmA Ribosomal protein L11 methyltransferase Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q31SW8 0.000229 45 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Shigella boydii serotype 4 (strain Sb227)
A7MUT5 0.000236 45 30 1 84 3 rsmC Ribosomal RNA small subunit methyltransferase C Vibrio campbellii (strain ATCC BAA-1116)
B2TZQ2 0.000264 45 26 9 193 3 rsmC Ribosomal RNA small subunit methyltransferase C Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A3N3J4 0.000273 45 35 3 81 3 APL_1900 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6VKA4 0.000286 44 39 5 107 3 Asuc_0019 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A3D0V3 0.000297 44 31 5 106 3 Sbal_0841 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E5T2 0.000297 44 31 5 106 3 Sbal223_3451 tRNA1(Val) (adenine(37)-N6)-methyltransferase Shewanella baltica (strain OS223)
B6I2Q2 0.000303 45 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli (strain SE11)
A8A899 0.000303 45 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O9:H4 (strain HS)
B7LXT2 0.000303 45 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O8 (strain IAI1)
A7ZVR0 0.000303 45 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Escherichia coli O139:H28 (strain E24377A / ETEC)
Q3YU23 0.000308 45 25 8 189 3 rsmC Ribosomal RNA small subunit methyltransferase C Shigella sonnei (strain Ss046)
Q7MHY6 0.000315 45 32 1 84 3 rsmC Ribosomal RNA small subunit methyltransferase C Vibrio vulnificus (strain YJ016)
Q72HI4 0.000322 44 46 1 60 3 menG Demethylmenaquinone methyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q81Z48 0.000346 45 30 4 105 3 BA_0426 Uncharacterized RNA methyltransferase BA_0426/GBAA_0426/BAS0414 Bacillus anthracis
B3H2W9 0.000367 44 35 3 81 3 APP7_1987 tRNA1(Val) (adenine(37)-N6)-methyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q73E18 0.000393 45 30 4 105 3 BCE_0542 Uncharacterized RNA methyltransferase BCE_0542 Bacillus cereus (strain ATCC 10987 / NRS 248)
B4F055 0.000414 44 33 2 80 3 PMI1896 tRNA1(Val) (adenine(37)-N6)-methyltransferase Proteus mirabilis (strain HI4320)
Q84BQ9 0.000415 44 39 2 71 1 prmA Ribosomal protein L11 methyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q8DBY0 0.000417 44 32 1 84 3 rsmC Ribosomal RNA small subunit methyltransferase C Vibrio vulnificus (strain CMCP6)
A3QHZ8 0.000434 44 33 2 96 3 rsmC Ribosomal RNA small subunit methyltransferase C Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q87LY1 0.000474 44 29 1 84 3 rsmC Ribosomal RNA small subunit methyltransferase C Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5E7Q6 0.000487 44 27 2 95 3 VF_0445 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8DI86 0.000506 43 26 2 123 3 rsmG Ribosomal RNA small subunit methyltransferase G Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
B6EMW5 0.000524 43 28 2 94 3 VSAL_I0559 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aliivibrio salmonicida (strain LFI1238)
B6EL06 0.000565 44 29 1 87 3 rsmC Ribosomal RNA small subunit methyltransferase C Aliivibrio salmonicida (strain LFI1238)
A7MGA7 0.000601 44 33 2 84 3 rsmC Ribosomal RNA small subunit methyltransferase C Cronobacter sakazakii (strain ATCC BAA-894)
A0KPC4 0.000719 43 31 5 109 3 AHA_3669 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B5F101 0.000783 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella agona (strain SL483)
Q8ZQJ5 0.000784 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5BBV5 0.00079 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella paratyphi A (strain AKU_12601)
Q5PGN2 0.00079 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TRN5 0.000797 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella schwarzengrund (strain CVM19633)
B5QYK4 0.000797 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella enteritidis PT4 (strain P125109)
Q5E2W4 0.000804 43 31 1 87 3 rsmC Ribosomal RNA small subunit methyltransferase C Aliivibrio fischeri (strain ATCC 700601 / ES114)
A0KPP9 0.000824 43 35 1 81 3 rsmC Ribosomal RNA small subunit methyltransferase C Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q8Z841 0.000826 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella typhi
B5FPZ6 0.000826 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Salmonella dublin (strain CT_02021853)
A4SRS5 0.000841 43 32 4 82 3 ASA_3636 tRNA1(Val) (adenine(37)-N6)-methyltransferase Aeromonas salmonicida (strain A449)
A6L532 0.000847 43 36 3 82 3 BVU_3164 tRNA1(Val) (adenine(37)-N6)-methyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q65S65 0.000854 43 35 2 80 3 rsmC Ribosomal RNA small subunit methyltransferase C Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0C384 0.000855 43 26 1 124 3 rsmG Ribosomal RNA small subunit methyltransferase G Acaryochloris marina (strain MBIC 11017)
B5FAM0 0.000888 43 31 1 87 3 rsmC Ribosomal RNA small subunit methyltransferase C Aliivibrio fischeri (strain MJ11)
B6I8H9 0.001 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli (strain SE11)
B7M7D4 0.001 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O8 (strain IAI1)
B7LD52 0.001 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli (strain 55989 / EAEC)
A7ZJS7 0.001 43 36 2 73 3 rlmC 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7K3B9 0.001 43 22 3 154 2 CG7544 U6 small nuclear RNA (adenine-(43)-N(6))-methyltransferase Drosophila melanogaster
A1JKJ4 0.001 43 34 3 82 3 YE1008 tRNA1(Val) (adenine(37)-N6)-methyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)

  • Number of RefSeq hits:

General

Source Morganella morganii S2
Locus tag EHELCC_02400
Feature type CDS
Gene prmC
Product peptide chain release factor N(5)-glutamine methyltransferase
Location 461359 - 462195 (strand: 1)
Length 837 (nucleotides) / 278 (amino acids)

Contig

Accession ZDB_213
Length 680219 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_612
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF13847 Methyltransferase domain
PF17827 PrmC N-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2890 Translation, ribosomal structure and biogenesis (J) J Methylase of polypeptide chain release factors

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02493 release factor glutamine methyltransferase [EC:2.1.1.297] - -

Protein Sequence

MTFRTWLAEAVSRLSHSDSPKRDAEILLTFVTGRTRSYIIAFDETPLSGDEQQRLEALLVRREQGEPVAYITGVREFWSLPLEVSPATLIPRPDTECLVEAALELLPAASCDILDLGTGTGAIALALASERPDCHVTGADIQPDAVALAQRNAARLGLTNTTFKESRWFASLPIHQFAMIVSNPPYIDENDEHLVQGDVRFEPRSALVAPQNGLADLAEIAAQSAHYLTLGGWLIVEHGWRQGDAVRELFRENGFYRVETRRDYGGNDRVTLGQREEK

Flanking regions ( +/- flanking 50bp)

GTGAACGAATATCAGGCAGATCAGCTCGCCGCGCTGTCTGAGCAGGACTGATGACGTTCCGGACCTGGCTGGCAGAGGCTGTCAGCCGTTTAAGTCACAGCGACAGCCCGAAACGGGATGCGGAAATCCTGCTGACGTTTGTCACCGGCCGAACCCGCAGCTACATTATTGCTTTTGATGAAACCCCGCTCAGCGGGGATGAACAGCAGCGTCTTGAGGCGCTGCTTGTCCGCCGGGAGCAGGGCGAGCCGGTGGCGTATATCACCGGTGTGCGCGAGTTTTGGTCACTGCCGCTGGAAGTGTCTCCCGCCACACTTATTCCGCGTCCTGATACCGAATGTCTGGTGGAGGCAGCGCTGGAATTGTTACCGGCAGCATCCTGCGATATTCTGGATCTCGGTACCGGCACCGGCGCGATTGCGCTGGCACTGGCCTCTGAACGGCCGGATTGCCATGTGACCGGGGCGGATATCCAGCCGGATGCGGTGGCGCTGGCACAGCGCAATGCCGCCCGTCTGGGGCTGACGAATACAACCTTTAAAGAAAGTCGCTGGTTTGCTTCACTGCCGATTCATCAATTTGCTATGATAGTGAGTAATCCGCCATATATTGATGAGAATGATGAGCATCTGGTGCAGGGGGATGTCCGTTTCGAGCCGCGCAGTGCGCTGGTCGCCCCGCAGAACGGCCTGGCCGATCTGGCGGAAATCGCTGCGCAGTCCGCTCATTATCTGACACTTGGCGGGTGGCTGATTGTGGAACATGGCTGGCGGCAGGGAGACGCTGTCCGCGAACTGTTCCGGGAAAACGGATTTTACCGGGTGGAAACCCGCCGCGATTATGGCGGAAATGATCGGGTTACTTTAGGTCAACGGGAAGAGAAATGAAAAGCATTGCCGATTTTGAATTCAATGGTGCGCCGTTACTGAGCGGCATT