Homologs in group_1802

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13375 FBDBKF_13375 83.1 Morganella morganii S1 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
EHELCC_08720 EHELCC_08720 83.1 Morganella morganii S2 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
NLDBIP_09045 NLDBIP_09045 83.1 Morganella morganii S4 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
LHKJJB_05220 LHKJJB_05220 83.1 Morganella morganii S3 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
HKOGLL_05695 HKOGLL_05695 83.1 Morganella morganii S5 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
F4V73_RS03385 F4V73_RS03385 82.8 Morganella psychrotolerans arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase

Distribution of the homologs in the orthogroup group_1802

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1802

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ETL6 0.0 674 100 0 326 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Proteus mirabilis (strain HI4320)
Q7N3Q6 0.0 569 86 0 323 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GDR6 0.0 543 79 1 326 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Serratia proteamaculans (strain 568)
B1JJ29 0.0 532 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q93PD9 0.0 532 76 0 324 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIM3 0.0 532 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis (strain Pestoides F)
B2K5L4 0.0 532 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CIH6 0.0 530 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R094 0.0 530 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX7 0.0 530 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis
Q1C741 0.0 530 76 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Antiqua)
A1JPP5 0.0 524 79 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7N5L9 0.0 517 72 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q32DT4 0.0 517 72 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella dysenteriae serotype 1 (strain Sd197)
B1LLK8 0.0 517 72 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain SMS-3-5 / SECEC)
Q3YZV2 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella sonnei (strain Ss046)
Q31YK3 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella boydii serotype 4 (strain Sb227)
B6I7J7 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain SE11)
P77757 0.0 515 71 1 325 1 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12)
B1IXT3 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2C1 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O9:H4 (strain HS)
B1X8W7 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12 / DH10B)
C4ZU96 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7NNT3 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LAR9 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain 55989 / EAEC)
B5YX45 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDZ5 0.0 515 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O157:H7
B7M5T6 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O8 (strain IAI1)
A7ZP72 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7UC63 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella flexneri
Q1R9G1 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain UTI89 / UPEC)
Q8FFM2 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFI8 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADA6 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O1:K1 / APEC
B7MXT5 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O81 (strain ED1a)
B7MG21 0.0 514 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q0T2M9 0.0 513 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella flexneri serotype 5b (strain 8401)
A4WAM4 0.0 513 72 1 327 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Enterobacter sp. (strain 638)
B7UFR6 0.0 511 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B7LM77 0.0 510 73 0 314 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A6TF99 1.03e-180 505 74 2 327 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B5XTK8 3.02e-179 501 73 2 327 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Klebsiella pneumoniae (strain 342)
C5BDQ5 1.24e-176 494 70 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Edwardsiella ictaluri (strain 93-146)
Q57M56 2.96e-175 491 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella choleraesuis (strain SC-B67)
C0Q070 4.38e-175 491 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi C (strain RKS4594)
Q8Z541 6.16e-175 490 70 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella typhi
A9N5B3 6.16e-175 490 70 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYX0 6.16e-175 490 70 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella newport (strain SL254)
B5BCP7 6.58e-175 490 70 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi A (strain AKU_12601)
Q5PNA5 6.58e-175 490 70 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O52324 7.75e-175 490 72 0 308 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPI1 7.75e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella schwarzengrund (strain CVM19633)
B4TBG5 7.75e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella heidelberg (strain SL476)
B5EZH7 7.75e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella agona (strain SL483)
B5RCC3 8.19e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R271 8.19e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella enteritidis PT4 (strain P125109)
B5FNT8 8.19e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella dublin (strain CT_02021853)
Q2NRV6 3.2e-173 486 71 1 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Sodalis glossinidius (strain morsitans)
B2VBJ0 8.85e-170 477 74 0 312 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4SQW8 1.78e-169 476 68 0 319 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Aeromonas salmonicida (strain A449)
Q6D2F0 2.88e-166 468 75 0 315 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DAW6 3.11e-166 468 75 0 315 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A0KGY7 9.43e-165 464 69 1 320 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4KC83 5.07e-162 458 69 0 309 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KCC2 5.09e-162 458 68 0 309 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain Pf0-1)
Q4ZSZ3 3.36e-159 451 66 0 313 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas syringae pv. syringae (strain B728a)
C3KAD3 3.57e-158 448 68 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain SBW25)
Q48HZ2 2.86e-157 446 66 0 306 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A8FRR3 7.27e-148 422 66 0 314 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shewanella sediminis (strain HAW-EB3)
Q9HY64 8.9e-141 404 65 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7VBN3 8.9e-141 404 65 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain LESB58)
Q02R24 1.18e-140 404 65 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6V1P1 1.46e-140 404 65 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain PA7)
Q8D342 7.79e-95 287 56 0 221 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Wigglesworthia glossinidia brevipalpis
P57022 8.76e-56 186 34 7 314 3 gtrB Bactoprenol glucosyl transferase Salmonella phage P22
Q55487 3.26e-54 182 33 4 311 1 sll0501 Uncharacterized glycosyltransferase sll0501 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P77293 1.45e-53 181 32 7 315 1 yfdH Prophage bactoprenol glucosyl transferase homolog Escherichia coli (strain K12)
P68667 4.13e-53 179 33 7 310 3 gtrB SfII prophage-derived bactoprenol glucosyl transferase Shigella flexneri
P68668 4.13e-53 179 33 7 310 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfII
O34319 5.07e-53 179 32 5 312 3 ykcC Uncharacterized glycosyltransferase YkcC Bacillus subtilis (strain 168)
Q9T1D6 1.06e-51 176 32 7 309 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfX
O22007 1.38e-51 175 33 7 309 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfV
P74505 8.92e-45 158 35 9 313 3 slr1943 Uncharacterized glycosyltransferase slr1943 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q45539 1.58e-43 155 31 3 316 2 csbB Putative glycosyltransferase CsbB Bacillus subtilis (strain 168)
Q1MJ95 5.85e-42 151 31 4 313 1 rgtE Dodecaprenyl-phosphate galacturonate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P9WMX5 1.98e-25 107 25 5 310 1 pimF Putative glycosyltransferases Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMX4 1.98e-25 107 25 5 310 3 pimF Putative glycosyltransferases Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8U4M3 1.09e-21 97 30 8 212 1 PF0058 Dolichol-phosphate mannosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O60762 4.33e-21 94 28 8 236 1 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Homo sapiens
O70152 7.78e-21 93 28 8 236 1 Dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Mus musculus
A5GFZ5 1.12e-20 92 28 8 240 3 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Sus scrofa
O34755 1.32e-20 94 24 8 313 1 ykoT Uncharacterized glycosyltransferase YkoT Bacillus subtilis (strain 168)
Q9WU83 1.65e-20 92 28 8 236 2 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Cricetulus griseus
Q1JQ93 3.4e-20 91 27 8 236 2 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Bos taurus
Q9VIU7 4.11e-18 85 26 6 236 3 Dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Drosophila melanogaster
A0QZ12 4.57e-18 85 27 6 237 1 ppm1 Polyprenol monophosphomannose synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
O14466 1.94e-16 80 25 8 234 2 dpm1 Dolichol-phosphate mannosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A2E3C6 5.44e-15 77 29 9 241 1 ALG5D Dolichyl-phosphate beta-glucosyltransferase ALG5D Trichomonas vaginalis (strain ATCC PRA-98 / G3)
O53493 4.74e-14 76 27 6 222 1 ppm1 Bifunctional apolipoprotein N-acyltransferase/polyprenol monophosphomannose synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0H3M5A8 4.74e-14 76 27 6 222 1 lnt Bifunctional apolipoprotein N-acyltransferase/polyprenol monophosphomannose synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P14020 6.79e-14 73 33 2 118 1 DPM1 Dolichol-phosphate mannosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q54LP3 1.31e-13 72 22 6 231 3 dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Dictyostelium discoideum
P0A598 1.75e-13 72 26 5 213 3 BQ2027_MB0553 Uncharacterized glycosyltransferase Mb0553 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMY1 1.75e-13 72 26 5 213 1 Rv0539 Uncharacterized glycosyltransferase Rv0539 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMY0 1.75e-13 72 26 5 213 3 MT0564 Uncharacterized glycosyltransferase MT0564 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
C5CBV8 2.74e-13 72 29 8 220 1 Mlut_12000 Undecaprenyl-phosphate mannosyltransferase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q9LM93 3.33e-12 68 23 7 239 1 DPMS1 Dolichol-phosphate mannosyltransferase subunit 1 Arabidopsis thaliana
A2DSR8 5.19e-12 69 27 9 236 1 ALG5E Dolichyl-phosphate beta-glucosyltransferase ALG5E Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2ELE6 1.1e-11 68 27 8 239 1 ALG5C Dolichyl-phosphate beta-glucosyltransferase ALG5C Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2DZE8 2.56e-11 67 29 6 175 1 ALG5A Dolichyl-phosphate beta-glucosyltransferase ALG5A Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2EK20 1.38e-10 65 27 8 236 1 ALG5B Dolichyl-phosphate beta-glucosyltransferase ALG5B Trichomonas vaginalis (strain ATCC PRA-98 / G3)
P54856 3.47e-10 63 26 7 216 3 DPM1 Dolichol-phosphate mannosyltransferase Ustilago maydis (strain 521 / FGSC 9021)
Q47536 7.15e-10 63 30 3 123 3 yaiP Uncharacterized glycosyltransferase YaiP Escherichia coli (strain K12)
Q5X9A9 1.41e-09 62 30 8 189 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0C0H0 1.45e-09 62 30 8 189 3 hasA Hyaluronan synthase Streptococcus pyogenes
Q8NKX1 1.45e-09 62 30 8 189 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0C0H1 1.46e-09 62 30 8 189 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M1
P0DB61 1.56e-09 62 31 9 189 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB60 1.56e-09 62 31 9 189 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q9DB25 3.39e-09 60 32 2 101 1 Alg5 Dolichyl-phosphate beta-glucosyltransferase Mus musculus
P04340 7.41e-09 60 28 5 139 3 nodC N-acetylglucosaminyltransferase Rhizobium leguminosarum bv. viciae
O60061 7.53e-09 59 25 7 240 3 alg5 Dolichyl-phosphate beta-glucosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54J42 7.93e-09 59 34 2 99 2 alg5 Dolichyl-phosphate beta-glucosyltransferase Dictyostelium discoideum
D4GYG7 8.37e-09 59 32 3 117 1 aglE Glycosyltransferase AglE Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q58619 8.92e-09 58 26 10 226 4 MJ1222 Uncharacterized protein MJ1222 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9Y673 1.14e-08 59 31 2 101 1 ALG5 Dolichyl-phosphate beta-glucosyltransferase Homo sapiens
Q57964 1.76e-08 57 26 6 215 4 MJ0544 Uncharacterized protein MJ0544 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P96587 5.52e-08 57 33 3 108 3 ydaM Uncharacterized glycosyltransferase YdaM Bacillus subtilis (strain 168)
Q07755 8.96e-08 56 25 7 190 3 nodC N-acetylglucosaminyltransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q6GDD8 1.04e-07 56 33 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MRSA252)
Q7A351 1.04e-07 56 33 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain N315)
Q99QX3 1.04e-07 56 33 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCN1 1.04e-07 56 33 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain COL)
Q9RQP9 1.04e-07 56 33 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q0P9C6 1.09e-07 56 32 4 116 1 pglI GalNAc(5)-diNAcBac-PP-undecaprenol beta-1,3-glucosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q8GLC5 2.23e-07 55 33 3 102 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus epidermidis
Q8NUI7 2.93e-07 55 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MW2)
Q6G608 2.93e-07 55 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MSSA476)
Q5HLM5 3.67e-07 55 34 2 96 1 tagF Teichoic acid poly(glycerol phosphate) polymerase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
D4GUA0 4.12e-07 55 23 5 177 1 aglD Glycosyltransferase AglD Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
B3VA58 4.29e-07 53 29 4 140 1 aglK UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminyltransferase Methanococcus voltae
Q5HKQ0 6.12e-07 54 32 3 102 1 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A0A0H2UR96 8.07e-07 53 35 2 93 1 glyG Glycosyltransferase GlyG Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q57022 1.29e-06 52 37 3 94 3 HI_0868 Uncharacterized glycosyltransferase HI_0868 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O51519 3.47e-06 51 34 2 94 1 BB_0572 Cholesterol galactosyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
P71054 4.22e-06 51 31 5 122 2 epsE Putative glycosyltransferase EpsE Bacillus subtilis (strain 168)
P50357 4.7e-06 51 25 3 135 3 nodC N-acetylglucosaminyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P17862 5.67e-06 51 27 4 143 3 nodC N-acetylglucosaminyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
A0A0H2URH7 5.67e-06 51 33 2 95 3 glyA Glycosyltransferase GlyA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9VLQ1 8.68e-06 50 26 6 180 1 wol Dolichyl-phosphate beta-glucosyltransferase Drosophila melanogaster
P04678 1.99e-05 48 26 0 98 3 nodC N-acetylglucosaminyltransferase (Fragment) Rhizobium leguminosarum bv. trifolii
Q4L977 2.42e-05 49 33 1 100 3 crtQ 4,4'-diaponeurosporenoate glycosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
P22639 3.32e-05 48 36 4 118 3 alr2836 Uncharacterized glycosyltransferase alr2836 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P40350 3.34e-05 48 29 2 110 1 ALG5 Dolichyl-phosphate beta-glucosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P04341 3.95e-05 48 27 3 138 3 nodC N-acetylglucosaminyltransferase Rhizobium meliloti (strain 1021)
P75905 5.7e-05 48 31 4 97 1 pgaC Poly-beta-1,6-N-acetyl-D-glucosamine synthase Escherichia coli (strain K12)
Q8XAR5 6.07e-05 48 31 4 97 3 pgaC Poly-beta-1,6-N-acetyl-D-glucosamine synthase Escherichia coli O157:H7
P11290 8.9e-05 47 31 3 117 3 yibD Uncharacterized glycosyltransferase YibD Escherichia coli (strain K12)
P46917 0.000103 47 31 2 94 3 ggaA Minor teichoic acid biosynthesis protein GgaA Bacillus subtilis (strain 168)
P72334 0.000135 47 28 4 137 3 nodC N-acetylglucosaminyltransferase Rhizobium sp. (strain N33)
B3VA59 0.000143 46 27 1 95 1 aglC Dolichyl N-acetyl-alpha-D-glucosaminyl phosphate 3-beta-D-2,3-diacetamido-2,3-dideoxy-beta-D-glucuronosyltransferase Methanococcus voltae
P24151 0.000209 46 30 3 103 3 nodC N-acetylglucosaminyltransferase Rhizobium leguminosarum bv. phaseoli
P53417 0.0003 44 25 4 137 3 nodC N-acetylglucosaminyltransferase (Fragment) Bradyrhizobium elkanii
P71057 0.000306 45 28 3 115 2 epsH Putative glycosyltransferase EpsH Bacillus subtilis (strain 168)
A0A0H3JPC6 0.000331 45 27 4 148 1 tarS Poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase TarS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0H3JVA1 0.000343 45 27 4 148 1 tarS Poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase TarS Staphylococcus aureus (strain MW2)
O06483 0.000455 45 29 5 125 3 yfnE Uncharacterized glycosyltransferase YfnE Bacillus subtilis (strain 168)
P71059 0.000462 45 29 3 117 2 epsJ Uncharacterized glycosyltransferase EpsJ Bacillus subtilis (strain 168)
P9WMW9 0.000513 45 25 8 202 1 gpgS Glucosyl-3-phosphoglycerate synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMW8 0.000513 45 25 8 202 3 gpgS Glucosyl-3-phosphoglycerate synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q7U0E1 0.000513 45 25 8 202 1 gpgS Glucosyl-3-phosphoglycerate synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS05075
Feature type CDS
Gene arnC
Product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
Location 1108799 - 1109779 (strand: 1)
Length 981 (nucleotides) / 326 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1802
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00535 Glycosyl transferase family 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0463 Cell wall/membrane/envelope biogenesis (M) M Glycosyltransferase involved in cell wall bisynthesis

Kegg Ortholog Annotation(s)

Protein Sequence

MSTFEKINKVSVVIPVYNEEESLPQLLERTIKSCKQLEQEYELILVDDGSSDNSAKMLEEAANIEDNHVIAIILNRNYGQHSAIMAGFNQADGDLVITLDADLQNPPEEIPRLVATAEEGYDVVGTRRRNRQDSWFRKTASKMINAMITKATGRSMGDYGCMLRAYRRHIIDAMLQCHERSTFIPILANTFARRTIEIEVAHAEREYGDSKYSFLKLINLMYDLLTCLTTAPLRLLSVVGSVIAVAGFLLAVLLIVLRLIFGAIWAADGVFTLFAILFMFIGAQFVAMGLLGEYIGRIYNDVRARPRYFIQKVVGVKKPNKNQEED

Flanking regions ( +/- flanking 50bp)

GTTATTCGCGTTGTCGATGCGATCAATGAAATTCTTTCGGAGCATATCTAGTGTCAACATTTGAAAAAATCAATAAAGTATCAGTCGTTATTCCCGTTTATAACGAGGAAGAGAGTCTCCCACAGCTTTTAGAGCGAACAATCAAAAGCTGTAAACAGTTAGAACAAGAGTATGAGCTGATCCTTGTTGATGACGGAAGTAGCGATAATTCAGCAAAAATGCTAGAAGAAGCTGCCAACATTGAAGATAACCATGTTATTGCGATTATTTTAAATCGCAACTATGGTCAACACTCCGCTATTATGGCGGGTTTTAACCAAGCTGATGGGGATTTAGTCATTACCTTAGATGCTGATTTACAAAACCCACCAGAGGAGATCCCCCGTTTAGTGGCAACCGCAGAAGAGGGGTATGATGTTGTCGGAACTCGACGCCGTAACCGTCAAGATTCGTGGTTTCGTAAAACGGCCTCTAAAATGATTAATGCCATGATAACCAAGGCAACAGGTCGTTCAATGGGGGATTATGGTTGTATGTTAAGAGCATATCGTCGTCATATTATTGATGCGATGTTGCAATGCCATGAGCGTAGTACTTTTATCCCAATTTTAGCGAATACCTTCGCTCGTCGTACGATTGAAATTGAAGTTGCTCACGCTGAGCGTGAATATGGTGATTCAAAATACAGTTTCTTAAAACTCATCAATTTGATGTACGACTTATTAACCTGTCTGACAACTGCACCATTACGTTTATTAAGTGTCGTAGGTAGTGTGATTGCTGTTGCCGGCTTTTTACTTGCCGTATTATTGATTGTACTACGACTTATTTTCGGTGCAATTTGGGCGGCAGACGGAGTGTTTACACTCTTTGCTATCTTATTCATGTTTATCGGTGCGCAGTTCGTTGCAATGGGTCTATTAGGTGAATATATAGGCCGAATTTATAATGATGTAAGAGCGCGTCCTCGGTATTTTATCCAAAAAGTGGTTGGCGTTAAAAAACCCAACAAAAATCAGGAAGAAGACTAATGAAAGCAATAGTATTTGCCTATCATGATATTGGCTGTGTTGGTTTAAAA