Homologs in group_1838

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13375 FBDBKF_13375 100.0 Morganella morganii S1 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
EHELCC_08720 EHELCC_08720 100.0 Morganella morganii S2 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
LHKJJB_05220 LHKJJB_05220 100.0 Morganella morganii S3 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
HKOGLL_05695 HKOGLL_05695 100.0 Morganella morganii S5 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
F4V73_RS03385 F4V73_RS03385 96.0 Morganella psychrotolerans arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
PMI_RS05075 PMI_RS05075 83.1 Proteus mirabilis HI4320 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase

Distribution of the homologs in the orthogroup group_1838

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1838

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ETL6 0.0 573 82 0 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Proteus mirabilis (strain HI4320)
Q7N3Q6 0.0 550 81 0 324 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GDR6 0.0 527 78 0 319 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Serratia proteamaculans (strain 568)
B1JJ29 0.0 523 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q93PD9 0.0 523 75 1 323 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIM3 0.0 523 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis (strain Pestoides F)
B2K5L4 0.0 523 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CIH6 0.0 522 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R094 0.0 522 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX7 0.0 522 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis
Q1C741 0.0 522 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Antiqua)
B7LM77 0.0 519 75 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A4WAM4 0.0 518 74 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Enterobacter sp. (strain 638)
A1JPP5 0.0 515 78 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B7N5L9 0.0 514 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LLK8 0.0 513 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain SMS-3-5 / SECEC)
B7NNT3 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q3YZV2 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella sonnei (strain Ss046)
Q31YK3 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella boydii serotype 4 (strain Sb227)
B6I7J7 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain SE11)
P77757 0.0 512 73 0 317 1 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12)
B1IXT3 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2C1 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O9:H4 (strain HS)
B1X8W7 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12 / DH10B)
C4ZU96 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LAR9 0.0 512 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain 55989 / EAEC)
Q7UC63 0.0 511 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella flexneri
Q32DT4 0.0 511 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella dysenteriae serotype 1 (strain Sd197)
B7M5T6 0.0 511 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O8 (strain IAI1)
A7ZP72 0.0 511 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T2M9 0.0 511 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella flexneri serotype 5b (strain 8401)
Q1R9G1 0.0 510 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain UTI89 / UPEC)
Q8FFM2 0.0 510 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFI8 0.0 510 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADA6 0.0 510 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O1:K1 / APEC
B7MXT5 0.0 510 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O81 (strain ED1a)
B7MG21 0.0 510 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B5YX45 0.0 509 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDZ5 0.0 509 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O157:H7
B7UFR6 0.0 508 73 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5XTK8 2.32e-180 504 74 1 329 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Klebsiella pneumoniae (strain 342)
A6TF99 3.4e-180 504 74 1 329 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C0Q070 1.69e-177 497 71 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi C (strain RKS4594)
Q57M56 5.01e-177 496 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella choleraesuis (strain SC-B67)
Q8Z541 6.38e-177 495 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella typhi
A9N5B3 6.38e-177 495 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYX0 6.38e-177 495 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella newport (strain SL254)
B5BCP7 7.68e-177 495 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi A (strain AKU_12601)
Q5PNA5 7.68e-177 495 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O52324 1.16e-176 494 70 0 321 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPI1 1.16e-176 494 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella schwarzengrund (strain CVM19633)
B4TBG5 1.16e-176 494 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella heidelberg (strain SL476)
B5EZH7 1.16e-176 494 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella agona (strain SL483)
B5RCC3 1.4e-176 494 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R271 1.4e-176 494 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella enteritidis PT4 (strain P125109)
B5FNT8 1.4e-176 494 70 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella dublin (strain CT_02021853)
Q6D2F0 3.1e-174 489 77 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C5BDQ5 7.41e-174 488 71 1 326 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Edwardsiella ictaluri (strain 93-146)
C6DAW6 2.25e-173 486 76 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NRV6 1.53e-172 484 74 1 322 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Sodalis glossinidius (strain morsitans)
B2VBJ0 7.4e-170 478 73 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4SQW8 3.48e-167 471 67 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Aeromonas salmonicida (strain A449)
A0KGY7 1.41e-162 459 67 1 327 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q4KC83 5.26e-159 451 69 0 311 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KCC2 1.55e-157 447 68 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain Pf0-1)
Q4ZSZ3 1.73e-156 444 65 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas syringae pv. syringae (strain B728a)
Q48HZ2 9.22e-156 442 68 0 306 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C3KAD3 4.5e-155 441 67 0 311 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain SBW25)
A8FRR3 2.12e-150 428 63 1 330 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shewanella sediminis (strain HAW-EB3)
A6V1P1 3.6e-144 413 68 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain PA7)
Q9HY64 4.34e-144 413 68 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7VBN3 4.34e-144 413 68 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain LESB58)
Q02R24 4.58e-144 412 68 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8D342 2.17e-95 288 57 0 222 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Wigglesworthia glossinidia brevipalpis
Q55487 1.29e-54 184 32 3 310 1 sll0501 Uncharacterized glycosyltransferase sll0501 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P57022 1.99e-54 183 34 7 314 3 gtrB Bactoprenol glucosyl transferase Salmonella phage P22
P68667 6.64e-54 181 35 7 310 3 gtrB SfII prophage-derived bactoprenol glucosyl transferase Shigella flexneri
P68668 6.64e-54 181 35 7 310 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfII
O34319 6.88e-54 182 32 5 314 3 ykcC Uncharacterized glycosyltransferase YkcC Bacillus subtilis (strain 168)
P77293 9.8e-54 181 33 7 315 1 yfdH Prophage bactoprenol glucosyl transferase homolog Escherichia coli (strain K12)
Q9T1D6 1.14e-52 178 34 7 309 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfX
O22007 1.74e-52 178 34 7 309 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfV
P74505 1.64e-44 158 33 8 311 3 slr1943 Uncharacterized glycosyltransferase slr1943 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q45539 5.13e-41 149 29 3 322 2 csbB Putative glycosyltransferase CsbB Bacillus subtilis (strain 168)
Q1MJ95 3.05e-39 144 32 8 324 1 rgtE Dodecaprenyl-phosphate galacturonate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
P9WMX5 1.67e-26 110 26 6 323 1 pimF Putative glycosyltransferases Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMX4 1.67e-26 110 26 6 323 3 pimF Putative glycosyltransferases Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8U4M3 6.7e-26 108 34 9 213 1 PF0058 Dolichol-phosphate mannosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
O34755 1.29e-21 97 26 11 339 1 ykoT Uncharacterized glycosyltransferase YkoT Bacillus subtilis (strain 168)
O70152 4.92e-21 94 29 8 235 1 Dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Mus musculus
Q9WU83 5.91e-20 90 28 8 235 2 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Cricetulus griseus
O60762 9.72e-20 90 28 8 235 1 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Homo sapiens
Q1JQ93 1.91e-19 89 28 8 235 2 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Bos taurus
A5GFZ5 2.18e-19 89 27 8 242 3 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Sus scrofa
A0QZ12 1.84e-17 84 28 6 231 1 ppm1 Polyprenol monophosphomannose synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A2E3C6 3.31e-17 84 30 10 256 1 ALG5D Dolichyl-phosphate beta-glucosyltransferase ALG5D Trichomonas vaginalis (strain ATCC PRA-98 / G3)
C5CBV8 5.05e-17 82 31 10 224 1 Mlut_12000 Undecaprenyl-phosphate mannosyltransferase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q9VIU7 5.56e-17 82 26 8 235 3 Dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Drosophila melanogaster
O14466 1.78e-16 80 27 9 236 2 dpm1 Dolichol-phosphate mannosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q54LP3 1.17e-15 79 24 5 230 3 dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Dictyostelium discoideum
O53493 1.96e-14 77 28 7 224 1 ppm1 Bifunctional apolipoprotein N-acyltransferase/polyprenol monophosphomannose synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0H3M5A8 1.96e-14 77 28 7 224 1 lnt Bifunctional apolipoprotein N-acyltransferase/polyprenol monophosphomannose synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P14020 2.13e-14 75 30 4 159 1 DPM1 Dolichol-phosphate mannosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9LM93 4.73e-14 73 25 7 235 1 DPMS1 Dolichol-phosphate mannosyltransferase subunit 1 Arabidopsis thaliana
A2DSR8 2.71e-13 73 28 11 239 1 ALG5E Dolichyl-phosphate beta-glucosyltransferase ALG5E Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2DZE8 3.68e-13 72 28 10 238 1 ALG5A Dolichyl-phosphate beta-glucosyltransferase ALG5A Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2ELE6 3.46e-12 69 27 8 238 1 ALG5C Dolichyl-phosphate beta-glucosyltransferase ALG5C Trichomonas vaginalis (strain ATCC PRA-98 / G3)
P0A598 1.5e-11 66 27 5 211 3 BQ2027_MB0553 Uncharacterized glycosyltransferase Mb0553 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMY1 1.5e-11 66 27 5 211 1 Rv0539 Uncharacterized glycosyltransferase Rv0539 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMY0 1.5e-11 66 27 5 211 3 MT0564 Uncharacterized glycosyltransferase MT0564 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A2EK20 2.06e-11 67 26 8 238 1 ALG5B Dolichyl-phosphate beta-glucosyltransferase ALG5B Trichomonas vaginalis (strain ATCC PRA-98 / G3)
Q54J42 2.06e-11 67 33 4 130 2 alg5 Dolichyl-phosphate beta-glucosyltransferase Dictyostelium discoideum
P54856 2.51e-11 67 28 10 218 3 DPM1 Dolichol-phosphate mannosyltransferase Ustilago maydis (strain 521 / FGSC 9021)
Q58619 1.4e-10 63 28 11 224 4 MJ1222 Uncharacterized protein MJ1222 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P04340 6.53e-10 63 28 4 142 3 nodC N-acetylglucosaminyltransferase Rhizobium leguminosarum bv. viciae
Q07755 9.28e-10 62 29 8 187 3 nodC N-acetylglucosaminyltransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P96587 2.01e-09 62 35 4 110 3 ydaM Uncharacterized glycosyltransferase YdaM Bacillus subtilis (strain 168)
Q9DB25 5.05e-09 60 31 4 119 1 Alg5 Dolichyl-phosphate beta-glucosyltransferase Mus musculus
Q9Y673 7.1e-09 59 30 4 119 1 ALG5 Dolichyl-phosphate beta-glucosyltransferase Homo sapiens
D4GUA0 2.23e-08 58 26 6 176 1 aglD Glycosyltransferase AglD Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P04678 3.85e-08 55 26 2 137 3 nodC N-acetylglucosaminyltransferase (Fragment) Rhizobium leguminosarum bv. trifolii
Q6GDD8 4.17e-08 57 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MRSA252)
Q7A351 4.17e-08 57 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain N315)
Q99QX3 4.17e-08 57 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCN1 4.17e-08 57 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain COL)
Q9RQP9 4.17e-08 57 32 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
P17862 6.12e-08 57 29 3 136 3 nodC N-acetylglucosaminyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P50357 7.11e-08 57 27 4 140 3 nodC N-acetylglucosaminyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B3VA58 7.2e-08 56 26 6 143 1 aglK UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminyltransferase Methanococcus voltae
Q57964 1.08e-07 55 29 3 111 4 MJ0544 Uncharacterized protein MJ0544 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8NUI7 1.16e-07 56 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MW2)
Q6G608 1.16e-07 56 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MSSA476)
O60061 1.23e-07 56 23 8 242 3 alg5 Dolichyl-phosphate beta-glucosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D4GYG7 3.45e-07 54 27 4 154 1 aglE Glycosyltransferase AglE Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P53417 6.14e-07 52 26 5 139 3 nodC N-acetylglucosaminyltransferase (Fragment) Bradyrhizobium elkanii
P72334 7.42e-07 53 28 3 139 3 nodC N-acetylglucosaminyltransferase Rhizobium sp. (strain N33)
Q47536 8.56e-07 53 30 4 120 3 yaiP Uncharacterized glycosyltransferase YaiP Escherichia coli (strain K12)
P04341 1.54e-06 53 28 3 137 3 nodC N-acetylglucosaminyltransferase Rhizobium meliloti (strain 1021)
P50356 3.31e-06 52 27 4 132 3 nodC N-acetylglucosaminyltransferase Neorhizobium galegae
P24151 4.04e-06 51 29 2 119 3 nodC N-acetylglucosaminyltransferase Rhizobium leguminosarum bv. phaseoli
P0C0H1 4.89e-06 51 29 9 191 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M1
P0C0H0 5.06e-06 51 29 9 191 3 hasA Hyaluronan synthase Streptococcus pyogenes
Q8NKX1 5.06e-06 51 29 9 191 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M18 (strain MGAS8232)
E0U4V7 5.18e-06 51 32 1 94 1 tarQ Poly(ribitol-phosphate) beta-glucosyltransferase Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
Q5X9A9 5.2e-06 51 29 9 191 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0DB61 5.54e-06 51 29 9 191 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M3 (strain SSI-1)
P0DB60 5.54e-06 51 29 9 191 3 hasA Hyaluronan synthase Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q57022 6.5e-06 50 33 4 96 3 HI_0868 Uncharacterized glycosyltransferase HI_0868 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P22639 7.48e-06 50 35 3 117 3 alr2836 Uncharacterized glycosyltransferase alr2836 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A0A0H2URH7 8.79e-06 50 34 3 94 3 glyA Glycosyltransferase GlyA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9VLQ1 1.96e-05 49 31 2 100 1 wol Dolichyl-phosphate beta-glucosyltransferase Drosophila melanogaster
P71059 4.66e-05 48 31 4 120 2 epsJ Uncharacterized glycosyltransferase EpsJ Bacillus subtilis (strain 168)
Q4L977 5.28e-05 48 32 2 97 3 crtQ 4,4'-diaponeurosporenoate glycosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
A0A0H2UR96 5.96e-05 47 30 2 110 1 glyG Glycosyltransferase GlyG Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
D4GZ42 6.54e-05 47 26 7 178 3 HVO_1613 Dolichyl-phosphate hexose transferase HVO_1613 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P11290 7.92e-05 47 33 4 121 3 yibD Uncharacterized glycosyltransferase YibD Escherichia coli (strain K12)
D4GU74 8.42e-05 47 23 6 289 3 agl6 Low-salt glycan biosynthesis hexosyltransferase Agl6 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P04677 0.000177 44 31 4 100 3 nodC N-acetylglucosaminyltransferase (Fragment) Bradyrhizobium sp. (strain ANU 289)
P39614 0.000178 46 30 3 110 3 ywdF Uncharacterized glycosyltransferase YwdF Bacillus subtilis (strain 168)
P26024 0.000771 44 26 3 128 3 nodC N-acetylglucosaminyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_09045
Feature type CDS
Gene arnC
Product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
Location 221180 - 222169 (strand: 1)
Length 990 (nucleotides) / 329 (amino acids)
In genomic island -

Contig

Accession ZDB_523
Length 257158 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1838
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00535 Glycosyl transferase family 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0463 Cell wall/membrane/envelope biogenesis (M) M Glycosyltransferase involved in cell wall bisynthesis

Kegg Ortholog Annotation(s)

Protein Sequence

MSFNEIKKVSVVIPVYNEEESLPQLLERTIKACQSLKQAYEIVLVDDGSRDRSAEMLTQAAEIPENHVVAVLLNRNYGQHSAIMAGFRQAGGDLVITMDADLQNPPEEIPRLVEKAEEGYDVVGTRRANRQDSWFRKTASKMINKMIIAATGSAMGDYGCMLRAYRRHIIDAMLQCHERSTFIPILANTFARKTIEIDVKHAEREFGDSKYSFLKLINLMYDLLTCLTTAPLRLLSIVGSIIAASGFLLALLLIILRVAFGALWAAEGVFTLFAILFMFIGAQFVAMGLLGEYIGRIYNDVRARPRYFIQKVVGAQAKETSETETQEKN

Flanking regions ( +/- flanking 50bp)

TGACCCGTGTGACAGACGCAATCAGAGCTATTCTTGCGGAGCAGAAATAAGTGTCATTTAACGAAATTAAGAAAGTCTCAGTGGTAATTCCGGTTTACAACGAGGAAGAGAGTCTCCCTCAGTTGCTGGAACGTACAATCAAAGCCTGTCAGTCGCTGAAGCAGGCGTATGAAATTGTGCTGGTGGATGACGGCAGCCGTGACCGTTCAGCAGAAATGCTGACGCAGGCGGCAGAGATCCCTGAAAACCATGTGGTTGCTGTCCTGCTGAACCGTAACTACGGCCAGCATTCCGCAATTATGGCGGGTTTCAGACAGGCCGGTGGTGATCTGGTGATCACCATGGATGCGGATTTACAGAATCCGCCGGAAGAGATCCCGCGTCTGGTTGAAAAAGCAGAAGAGGGCTATGACGTGGTCGGCACACGCCGCGCAAACCGTCAGGACTCCTGGTTCCGCAAAACCGCCTCAAAAATGATCAACAAAATGATCATCGCCGCAACCGGCAGCGCTATGGGTGACTACGGCTGTATGCTGCGTGCGTACCGCCGTCATATCATCGATGCGATGTTACAGTGTCATGAGCGCAGCACCTTTATTCCTATTCTGGCAAATACCTTTGCCCGTAAAACGATTGAGATTGATGTTAAACACGCAGAACGTGAGTTCGGGGACTCAAAATACAGTTTCCTCAAACTGATCAATCTGATGTATGACCTGCTGACCTGCCTGACTACCGCGCCGCTGCGCCTGTTAAGCATTGTCGGCAGTATCATCGCGGCGTCCGGTTTCCTGCTGGCGCTGTTACTGATTATTCTGCGCGTGGCTTTCGGCGCGCTGTGGGCGGCAGAGGGAGTGTTTACCCTGTTCGCCATCTTATTTATGTTTATCGGCGCACAATTCGTGGCAATGGGTCTGCTCGGGGAATATATCGGGCGGATTTATAACGATGTTCGTGCACGTCCCCGGTATTTTATTCAAAAAGTGGTCGGCGCTCAGGCGAAAGAGACCAGTGAAACTGAAACTCAGGAAAAAAACTAATGAAAGCAATCGTATTTGCCTACCATGATATTGGTTGTGTCGGATTGAAG