Homologs in group_1802

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13375 FBDBKF_13375 96.0 Morganella morganii S1 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
EHELCC_08720 EHELCC_08720 96.0 Morganella morganii S2 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
NLDBIP_09045 NLDBIP_09045 96.0 Morganella morganii S4 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
LHKJJB_05220 LHKJJB_05220 96.0 Morganella morganii S3 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
HKOGLL_05695 HKOGLL_05695 96.0 Morganella morganii S5 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
PMI_RS05075 PMI_RS05075 82.8 Proteus mirabilis HI4320 arnC undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase

Distribution of the homologs in the orthogroup group_1802

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1802

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ETL6 0.0 573 82 0 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Proteus mirabilis (strain HI4320)
Q7N3Q6 0.0 553 81 1 328 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GDR6 0.0 527 78 0 319 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Serratia proteamaculans (strain 568)
B1JJ29 0.0 523 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q93PD9 0.0 523 75 1 323 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIM3 0.0 523 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis (strain Pestoides F)
B2K5L4 0.0 523 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CIH6 0.0 521 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R094 0.0 521 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZDX7 0.0 521 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis
Q1C741 0.0 521 75 1 323 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia pestis bv. Antiqua (strain Antiqua)
B7LM77 0.0 518 74 0 315 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A1JPP5 0.0 516 78 0 318 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A4WAM4 0.0 515 74 0 321 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Enterobacter sp. (strain 638)
B7N5L9 0.0 511 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B1LLK8 0.0 510 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain SMS-3-5 / SECEC)
Q3YZV2 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella sonnei (strain Ss046)
Q31YK3 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella boydii serotype 4 (strain Sb227)
B6I7J7 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain SE11)
P77757 0.0 510 73 0 316 1 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12)
B1IXT3 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A2C1 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O9:H4 (strain HS)
B1X8W7 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12 / DH10B)
C4ZU96 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7LAR9 0.0 510 73 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain 55989 / EAEC)
B7NNT3 0.0 509 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q7UC63 0.0 509 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella flexneri
Q32DT4 0.0 509 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R9G1 0.0 508 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli (strain UTI89 / UPEC)
Q8FFM2 0.0 508 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TFI8 0.0 508 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ADA6 0.0 508 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O1:K1 / APEC
B7M5T6 0.0 508 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O8 (strain IAI1)
B7MXT5 0.0 508 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O81 (strain ED1a)
B7MG21 0.0 508 72 0 317 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZP72 0.0 508 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T2M9 0.0 508 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shigella flexneri serotype 5b (strain 8401)
B5YX45 0.0 507 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XDZ5 0.0 507 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O157:H7
B7UFR6 0.0 506 72 0 316 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B5XTK8 7.57e-180 503 74 1 328 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Klebsiella pneumoniae (strain 342)
A6TF99 1.2e-179 502 74 1 328 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
C0Q070 5.88e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi C (strain RKS4594)
Q57M56 9.31e-175 490 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella choleraesuis (strain SC-B67)
Q8Z541 2.78e-174 489 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella typhi
A9N5B3 2.78e-174 489 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SYX0 2.78e-174 489 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella newport (strain SL254)
O52324 3.28e-174 488 72 0 308 2 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TPI1 3.28e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella schwarzengrund (strain CVM19633)
B4TBG5 3.28e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella heidelberg (strain SL476)
B5EZH7 3.28e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella agona (strain SL483)
B5BCP7 3.5e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi A (strain AKU_12601)
Q5PNA5 3.5e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B5RCC3 4.66e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R271 4.66e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella enteritidis PT4 (strain P125109)
B5FNT8 4.66e-174 488 72 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Salmonella dublin (strain CT_02021853)
C5BDQ5 7.91e-174 488 71 1 326 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Edwardsiella ictaluri (strain 93-146)
Q6D2F0 1.18e-173 487 77 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
C6DAW6 1.73e-172 484 76 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q2NRV6 1.42e-169 477 73 1 322 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Sodalis glossinidius (strain morsitans)
B2VBJ0 1.39e-168 474 72 0 325 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A4SQW8 9.96e-167 469 66 0 324 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Aeromonas salmonicida (strain A449)
A0KGY7 2.1e-162 459 66 0 326 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q3KCC2 1.23e-155 442 67 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain Pf0-1)
Q4KC83 1.67e-155 442 68 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4ZSZ3 2.86e-154 438 66 0 312 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas syringae pv. syringae (strain B728a)
Q48HZ2 5.22e-154 438 67 0 306 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
C3KAD3 8.04e-153 435 66 0 308 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas fluorescens (strain SBW25)
A8FRR3 6.17e-149 425 63 2 331 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Shewanella sediminis (strain HAW-EB3)
A6V1P1 1.27e-142 409 66 0 311 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain PA7)
Q9HY64 3.84e-142 408 66 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7VBN3 3.84e-142 408 66 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain LESB58)
Q02R24 4.01e-142 408 66 0 310 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8D342 9.44e-95 287 57 0 222 3 arnC Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase Wigglesworthia glossinidia brevipalpis
O34319 2.17e-55 186 33 5 314 3 ykcC Uncharacterized glycosyltransferase YkcC Bacillus subtilis (strain 168)
P57022 4.3e-55 185 34 7 314 3 gtrB Bactoprenol glucosyl transferase Salmonella phage P22
P77293 4.82e-55 184 33 8 316 1 yfdH Prophage bactoprenol glucosyl transferase homolog Escherichia coli (strain K12)
P68667 7.3e-55 184 35 7 310 3 gtrB SfII prophage-derived bactoprenol glucosyl transferase Shigella flexneri
P68668 7.3e-55 184 35 7 310 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfII
Q55487 3.92e-54 182 32 3 308 1 sll0501 Uncharacterized glycosyltransferase sll0501 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9T1D6 1.53e-53 181 34 7 309 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfX
O22007 2.5e-53 180 34 7 309 3 gtrB Bactoprenol glucosyl transferase Shigella phage SfV
P74505 4.98e-46 162 33 8 311 3 slr1943 Uncharacterized glycosyltransferase slr1943 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q45539 1.4e-40 147 30 2 303 2 csbB Putative glycosyltransferase CsbB Bacillus subtilis (strain 168)
Q1MJ95 1.94e-40 147 32 8 318 1 rgtE Dodecaprenyl-phosphate galacturonate synthase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8U4M3 5.67e-27 112 35 9 213 1 PF0058 Dolichol-phosphate mannosyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P9WMX5 6.69e-26 108 26 5 311 1 pimF Putative glycosyltransferases Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMX4 6.69e-26 108 26 5 311 3 pimF Putative glycosyltransferases Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O34755 7.98e-22 97 26 10 320 1 ykoT Uncharacterized glycosyltransferase YkoT Bacillus subtilis (strain 168)
O70152 1.52e-21 95 29 8 236 1 Dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Mus musculus
Q9WU83 1.27e-20 92 28 8 237 2 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Cricetulus griseus
O60762 5.43e-20 90 27 8 237 1 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Homo sapiens
A5GFZ5 8.14e-20 90 27 8 242 3 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Sus scrofa
Q1JQ93 1.2e-19 90 28 10 237 2 DPM1 Dolichol-phosphate mannosyltransferase subunit 1 Bos taurus
A0QZ12 1.17e-17 84 28 6 231 1 ppm1 Polyprenol monophosphomannose synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9VIU7 1.45e-17 84 26 8 235 3 Dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Drosophila melanogaster
A2E3C6 4.47e-17 84 30 9 254 1 ALG5D Dolichyl-phosphate beta-glucosyltransferase ALG5D Trichomonas vaginalis (strain ATCC PRA-98 / G3)
C5CBV8 1.31e-16 81 30 9 228 1 Mlut_12000 Undecaprenyl-phosphate mannosyltransferase Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q54LP3 3.56e-16 80 25 5 230 3 dpm1 Dolichol-phosphate mannosyltransferase subunit 1 Dictyostelium discoideum
O14466 1.01e-15 78 26 9 236 2 dpm1 Dolichol-phosphate mannosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O53493 4.72e-15 79 27 6 222 1 ppm1 Bifunctional apolipoprotein N-acyltransferase/polyprenol monophosphomannose synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A0A0H3M5A8 4.72e-15 79 27 6 222 1 lnt Bifunctional apolipoprotein N-acyltransferase/polyprenol monophosphomannose synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q9LM93 1.23e-14 75 25 7 235 1 DPMS1 Dolichol-phosphate mannosyltransferase subunit 1 Arabidopsis thaliana
P14020 3.29e-14 74 35 2 120 1 DPM1 Dolichol-phosphate mannosyltransferase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A2DSR8 1.91e-13 73 28 10 238 1 ALG5E Dolichyl-phosphate beta-glucosyltransferase ALG5E Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2DZE8 1e-12 71 30 7 176 1 ALG5A Dolichyl-phosphate beta-glucosyltransferase ALG5A Trichomonas vaginalis (strain ATCC PRA-98 / G3)
A2ELE6 2.07e-12 70 27 8 238 1 ALG5C Dolichyl-phosphate beta-glucosyltransferase ALG5C Trichomonas vaginalis (strain ATCC PRA-98 / G3)
P0A598 3.88e-12 68 27 5 211 3 BQ2027_MB0553 Uncharacterized glycosyltransferase Mb0553 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WMY1 3.88e-12 68 27 5 211 1 Rv0539 Uncharacterized glycosyltransferase Rv0539 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMY0 3.88e-12 68 27 5 211 3 MT0564 Uncharacterized glycosyltransferase MT0564 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A2EK20 8.42e-12 68 27 8 238 1 ALG5B Dolichyl-phosphate beta-glucosyltransferase ALG5B Trichomonas vaginalis (strain ATCC PRA-98 / G3)
P54856 2.87e-11 66 28 10 218 3 DPM1 Dolichol-phosphate mannosyltransferase Ustilago maydis (strain 521 / FGSC 9021)
Q54J42 1.31e-10 65 32 4 130 2 alg5 Dolichyl-phosphate beta-glucosyltransferase Dictyostelium discoideum
P04340 3.75e-10 64 28 4 142 3 nodC N-acetylglucosaminyltransferase Rhizobium leguminosarum bv. viciae
Q9DB25 4.53e-10 63 32 4 119 1 Alg5 Dolichyl-phosphate beta-glucosyltransferase Mus musculus
Q9Y673 4.83e-09 60 31 4 119 1 ALG5 Dolichyl-phosphate beta-glucosyltransferase Homo sapiens
Q58619 6.3e-09 59 27 10 224 4 MJ1222 Uncharacterized protein MJ1222 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q07755 8.82e-09 59 28 8 191 3 nodC N-acetylglucosaminyltransferase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P96587 1.22e-08 59 32 3 107 3 ydaM Uncharacterized glycosyltransferase YdaM Bacillus subtilis (strain 168)
O60061 1.53e-08 58 25 9 242 3 alg5 Dolichyl-phosphate beta-glucosyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D4GUA0 4.13e-08 58 25 6 176 1 aglD Glycosyltransferase AglD Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P04678 5.24e-08 55 26 2 137 3 nodC N-acetylglucosaminyltransferase (Fragment) Rhizobium leguminosarum bv. trifolii
Q47536 6.29e-08 57 30 3 118 3 yaiP Uncharacterized glycosyltransferase YaiP Escherichia coli (strain K12)
Q57964 4.28e-07 53 26 5 173 4 MJ0544 Uncharacterized protein MJ0544 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P17862 5.54e-07 54 28 3 136 3 nodC N-acetylglucosaminyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q6GDD8 6.43e-07 54 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MRSA252)
Q7A351 6.43e-07 54 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain N315)
Q99QX3 6.43e-07 54 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCN1 6.43e-07 54 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain COL)
Q9RQP9 6.43e-07 54 31 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
B3VA58 7.76e-07 53 25 6 143 1 aglK UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminyltransferase Methanococcus voltae
P04341 8.17e-07 53 28 2 135 3 nodC N-acetylglucosaminyltransferase Rhizobium meliloti (strain 1021)
P50357 9.82e-07 53 25 3 140 3 nodC N-acetylglucosaminyltransferase Sinorhizobium fredii (strain NBRC 101917 / NGR234)
A0A0H2URH7 1.18e-06 53 35 3 97 3 glyA Glycosyltransferase GlyA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q0P9C6 1.49e-06 52 29 4 116 1 pglI GalNAc(5)-diNAcBac-PP-undecaprenol beta-1,3-glucosyltransferase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q8NUI7 1.72e-06 52 30 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MW2)
Q6G608 1.72e-06 52 30 3 99 3 icaA Poly-beta-1,6-N-acetyl-D-glucosamine synthase Staphylococcus aureus (strain MSSA476)
P22639 1.91e-06 52 38 4 118 3 alr2836 Uncharacterized glycosyltransferase alr2836 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q57022 2.36e-06 51 34 4 96 3 HI_0868 Uncharacterized glycosyltransferase HI_0868 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
D4GYG7 2.42e-06 52 30 4 118 1 aglE Glycosyltransferase AglE Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P72334 4.89e-06 51 28 3 134 3 nodC N-acetylglucosaminyltransferase Rhizobium sp. (strain N33)
P50356 6.19e-06 51 27 4 132 3 nodC N-acetylglucosaminyltransferase Neorhizobium galegae
P53417 6.23e-06 49 25 5 139 3 nodC N-acetylglucosaminyltransferase (Fragment) Bradyrhizobium elkanii
P24151 1.31e-05 50 29 2 119 3 nodC N-acetylglucosaminyltransferase Rhizobium leguminosarum bv. phaseoli
D4GZ42 1.49e-05 48 25 4 173 3 HVO_1613 Dolichyl-phosphate hexose transferase HVO_1613 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P71059 1.75e-05 49 32 4 120 2 epsJ Uncharacterized glycosyltransferase EpsJ Bacillus subtilis (strain 168)
Q9VLQ1 2.28e-05 49 30 2 100 1 wol Dolichyl-phosphate beta-glucosyltransferase Drosophila melanogaster
O51519 3.75e-05 48 31 3 94 1 BB_0572 Cholesterol galactosyltransferase Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
A0A0H2UR96 4.27e-05 48 30 2 110 1 glyG Glycosyltransferase GlyG Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
E0U4V7 4.35e-05 48 31 1 94 1 tarQ Poly(ribitol-phosphate) beta-glucosyltransferase Bacillus spizizenii (strain ATCC 23059 / NRRL B-14472 / W23)
Q4L977 4.96e-05 48 33 2 100 3 crtQ 4,4'-diaponeurosporenoate glycosyltransferase Staphylococcus haemolyticus (strain JCSC1435)
D4GU74 8.2e-05 47 24 9 293 3 agl6 Low-salt glycan biosynthesis hexosyltransferase Agl6 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
P39614 0.000138 46 31 3 110 3 ywdF Uncharacterized glycosyltransferase YwdF Bacillus subtilis (strain 168)
P11290 0.000174 46 33 5 121 3 yibD Uncharacterized glycosyltransferase YibD Escherichia coli (strain K12)
P71054 0.000661 44 28 3 127 2 epsE Putative glycosyltransferase EpsE Bacillus subtilis (strain 168)
Q5HLM5 0.00074 45 26 2 96 1 tagF Teichoic acid poly(glycerol phosphate) polymerase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03385
Feature type CDS
Gene arnC
Product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
Location 721800 - 722789 (strand: 1)
Length 990 (nucleotides) / 329 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1802
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00535 Glycosyl transferase family 2

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0463 Cell wall/membrane/envelope biogenesis (M) M Glycosyltransferase involved in cell wall bisynthesis

Kegg Ortholog Annotation(s)

Protein Sequence

MSFNEIKKVSVVIPVYNEEESLPQLLERTIRACQSLTQSYEIVLVDDGSRDRSAEMLTQAAEIPENHVVAVLLNRNYGQHSAIMAGFNQADGDLVITMDADLQNPPEEIPRLVEKAEEGYDVVGTRRANRQDSWFRKTASKMINKMIISATGSSMGDYGCMLRAYRRHIIDAMLQCHERSTFIPILANTFARKTIEIDVTHAEREFGDSKYSFLKLINLMYDLLTCLTTAPLRLLSIAGSIIAASGFLLALLLIILRVAFGSLWAAEGVFTLFAILFMFIGAQFVAMGMLGEYIGRIYNDVRARPRYFIQKVVGAAAKETRETETQEKN

Flanking regions ( +/- flanking 50bp)

TTACCCGTGTGACAGACGCAATCAGAGAAATTCTTGCGGAGCAGAAATAAGTGTCTTTTAACGAAATTAAAAAAGTGTCAGTGGTCATTCCGGTTTATAACGAGGAAGAAAGCCTGCCTCAGTTACTGGAGCGCACCATCAGGGCGTGTCAGTCACTGACACAGTCGTATGAAATTGTGCTGGTGGATGACGGCAGCCGTGACCGTTCAGCCGAAATGCTGACGCAGGCGGCTGAAATCCCTGAAAATCATGTGGTTGCCGTGTTACTGAACCGGAACTACGGGCAGCATTCCGCGATTATGGCGGGGTTTAATCAGGCAGATGGCGATCTGGTGATCACCATGGATGCGGATTTACAGAACCCGCCGGAAGAGATCCCGCGCCTGGTCGAAAAGGCGGAAGAGGGTTATGACGTGGTCGGTACACGCCGGGCTAACCGTCAGGACTCCTGGTTTCGCAAAACAGCATCCAAAATGATCAATAAAATGATTATTTCTGCGACCGGCAGCTCTATGGGCGACTACGGCTGTATGCTGCGTGCTTACCGCCGCCATATTATTGATGCCATGTTGCAGTGCCATGAGCGCAGCACCTTTATCCCTATTCTTGCAAACACCTTTGCCCGCAAAACGATTGAAATTGATGTCACCCACGCCGAGCGCGAATTTGGTGATTCAAAATACAGTTTTCTGAAACTGATCAATCTGATGTACGACCTGCTGACCTGTCTGACCACCGCACCGCTGCGCTTATTAAGTATTGCGGGCAGTATTATTGCCGCCTCCGGTTTTCTGCTGGCGCTGTTACTGATTATCCTGCGGGTGGCTTTCGGCTCATTGTGGGCGGCAGAAGGGGTCTTTACCCTGTTTGCTATCTTATTTATGTTTATCGGCGCGCAGTTTGTCGCGATGGGAATGCTCGGTGAATACATCGGGCGGATCTATAACGATGTCCGCGCACGTCCCCGGTATTTTATTCAAAAAGTGGTCGGCGCTGCGGCGAAAGAGACCCGTGAAACTGAAACTCAGGAAAAAAACTAATGAAAGCAATCGTATTTGCCTACCATGATATTGGTTGTGCCGGATTGAAA