Homologs in group_1477

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09535 FBDBKF_09535 69.0 Morganella morganii S1 rhlE ATP-dependent RNA helicase RhlE
EHELCC_04335 EHELCC_04335 69.0 Morganella morganii S2 rhlE ATP-dependent RNA helicase RhlE
NLDBIP_04335 NLDBIP_04335 69.0 Morganella morganii S4 rhlE ATP-dependent RNA helicase RhlE
LHKJJB_14295 LHKJJB_14295 69.0 Morganella morganii S3 rhlE ATP-dependent RNA helicase RhlE
HKOGLL_12240 HKOGLL_12240 69.0 Morganella morganii S5 rhlE ATP-dependent RNA helicase RhlE
F4V73_RS00830 F4V73_RS00830 67.8 Morganella psychrotolerans rhlE ATP-dependent RNA helicase RhlE

Distribution of the homologs in the orthogroup group_1477

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1477

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P25888 0.0 605 75 0 386 1 rhlE ATP-dependent RNA helicase RhlE Escherichia coli (strain K12)
Q9HXE5 2.54e-98 303 43 3 372 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02S21 2.54e-98 303 43 3 372 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UUT0 2.54e-98 303 43 3 372 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas aeruginosa (strain LESB58)
Q88NB7 1.45e-96 299 43 3 372 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6HPE6 1.06e-95 301 41 2 383 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VG0 1.06e-95 301 41 2 383 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus anthracis
A0R8U6 1.06e-95 301 41 2 383 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus thuringiensis (strain Al Hakam)
Q73EU1 1.14e-95 301 41 2 383 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63GX5 1.26e-95 301 41 2 383 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ZK / E33L)
Q81IT9 1.76e-95 301 41 2 383 2 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
P0A4D8 6.49e-95 299 43 2 369 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4D7 6.49e-95 299 43 2 369 3 cshA DEAD-box ATP-dependent RNA helicase CshA Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5L3G9 1.43e-94 296 42 2 383 3 cshA DEAD-box ATP-dependent RNA helicase CshA Geobacillus kaustophilus (strain HTA426)
Q55804 3.19e-94 296 43 2 369 1 crhR RNA helicase CrhR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q887N8 2.25e-93 291 41 4 374 3 rhlB ATP-dependent RNA helicase RhlB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
O25029 1.91e-91 289 41 1 366 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain ATCC 700392 / 26695)
B9XXL6 2.53e-91 288 41 1 366 1 rhpA DEAD-box ATP-dependent RNA helicase RhpA Helicobacter pylori (strain B128)
Q8DDN6 1.84e-90 285 38 9 434 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain CMCP6)
P44586 1.89e-90 290 41 3 378 3 deaD ATP-dependent RNA helicase DeaD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MGP7 1.92e-90 285 38 9 434 3 rhlB ATP-dependent RNA helicase RhlB Vibrio vulnificus (strain YJ016)
A7MXT4 1.29e-89 282 39 8 408 3 rhlB ATP-dependent RNA helicase RhlB Vibrio campbellii (strain ATCC BAA-1116)
Q0DB53 1.78e-89 287 41 8 394 2 Os06g0602400 DEAD-box ATP-dependent RNA helicase 52A Oryza sativa subsp. japonica
Q8Y8N0 3.56e-89 284 39 1 378 2 cshA ATP-dependent RNA helicase CshA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P96614 3.63e-89 283 39 2 380 1 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus subtilis (strain 168)
P57453 4.43e-89 286 40 3 374 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9Z6C9 6.45e-89 283 40 2 368 3 cshA ATP-dependent RNA helicase CshA Limosilactobacillus reuteri
Q6CLR3 5.65e-88 284 40 5 388 3 DED1 ATP-dependent RNA helicase DED1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q65N62 5.94e-88 280 40 1 369 3 cshA DEAD-box ATP-dependent RNA helicase CshA Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q49Z29 6.31e-88 280 36 4 428 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A1SZG4 7.37e-88 277 39 6 419 3 rhlB ATP-dependent RNA helicase RhlB Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q81DF9 9.03e-88 278 39 3 385 2 cshE DEAD-box ATP-dependent RNA helicase CshE Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8K9H6 1.61e-87 282 39 3 374 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q9M2F9 1.67e-87 283 42 8 391 1 RH52 DEAD-box ATP-dependent RNA helicase 52 Arabidopsis thaliana
P9WH05 3.08e-87 280 40 4 368 1 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WH04 3.08e-87 280 40 4 368 3 deaD ATP-dependent RNA helicase DeaD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
B8CHZ1 4.56e-87 276 37 12 433 3 rhlB ATP-dependent RNA helicase RhlB Shewanella piezotolerans (strain WP3 / JCM 13877)
C4K8M8 4.73e-87 275 40 5 376 3 rhlB ATP-dependent RNA helicase RhlB Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
Q87KH5 4.92e-87 276 38 8 408 3 rhlB ATP-dependent RNA helicase RhlB Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P0A9P8 5.22e-87 281 40 2 374 3 deaD ATP-dependent RNA helicase DeaD Shigella flexneri
P0A9P6 5.22e-87 281 40 2 374 1 deaD ATP-dependent RNA helicase DeaD Escherichia coli (strain K12)
P0A9P7 5.22e-87 281 40 2 374 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q088J2 5.24e-87 276 38 10 415 3 rhlB ATP-dependent RNA helicase RhlB Shewanella frigidimarina (strain NCIMB 400)
Q8XA87 5.33e-87 281 40 2 374 3 deaD ATP-dependent RNA helicase DeaD Escherichia coli O157:H7
Q5VQL1 1.17e-86 283 40 5 369 2 Os01g0172200 DEAD-box ATP-dependent RNA helicase 14 Oryza sativa subsp. japonica
Q4L7W0 1.29e-86 277 38 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus haemolyticus (strain JCSC1435)
Q8EJQ5 1.31e-86 275 37 10 434 3 rhlB ATP-dependent RNA helicase RhlB Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8W4R3 1.37e-86 279 39 3 368 1 RH30 DEAD-box ATP-dependent RNA helicase 30 Arabidopsis thaliana
Q6LLL5 1.5e-86 275 38 8 428 3 rhlB ATP-dependent RNA helicase RhlB Photobacterium profundum (strain SS9)
Q5N7W4 1.83e-86 281 39 3 365 2 Os01g0911100 DEAD-box ATP-dependent RNA helicase 30 Oryza sativa subsp. japonica
C3LQR1 1.98e-86 274 37 7 414 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain M66-2)
Q9KV52 1.98e-86 274 37 7 414 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F3R4 1.98e-86 274 37 7 414 3 rhlB ATP-dependent RNA helicase RhlB Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P33906 2.78e-86 280 40 3 374 3 deaD ATP-dependent RNA helicase DeaD Klebsiella pneumoniae
Q59LU0 4.27e-86 277 38 4 370 3 DBP2 ATP-dependent RNA helicase DBP2 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5QYF8 5.97e-86 273 42 3 378 3 rhlB ATP-dependent RNA helicase RhlB Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A1SAL1 6.41e-86 273 38 9 404 3 rhlB ATP-dependent RNA helicase RhlB Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0HQL1 7.22e-86 273 37 10 434 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-7)
Q0HN76 7.22e-86 273 37 10 434 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain MR-4)
Q6BY27 7.46e-86 276 39 4 370 3 DBP2 ATP-dependent RNA helicase DBP2 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q84W89 8.48e-86 278 42 8 385 2 RH37 DEAD-box ATP-dependent RNA helicase 37 Arabidopsis thaliana
Q89AF9 9.69e-86 277 40 4 376 3 deaD ATP-dependent RNA helicase DeaD Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A7MQI2 1.07e-85 272 39 10 424 3 rhlB ATP-dependent RNA helicase RhlB Cronobacter sakazakii (strain ATCC BAA-894)
Q6FS54 1.19e-85 275 44 6 352 3 DBP3 ATP-dependent RNA helicase DBP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
A0KS84 1.23e-85 272 37 9 433 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain ANA-3)
A8G828 1.27e-85 272 39 10 428 3 rhlB ATP-dependent RNA helicase RhlB Serratia proteamaculans (strain 568)
Q5QMN3 1.28e-85 274 38 3 366 3 Os01g0197200 DEAD-box ATP-dependent RNA helicase 20 Oryza sativa subsp. japonica
Q755N4 1.34e-85 276 40 5 375 3 DBP2 ATP-dependent RNA helicase DBP2 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q5E8U5 1.36e-85 272 37 9 434 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8TFK8 1.77e-85 277 40 4 386 3 DED1 ATP-dependent RNA helicase DED1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B5FF87 1.98e-85 271 37 8 430 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio fischeri (strain MJ11)
Q2R1M8 2.45e-85 277 40 6 391 3 Os11g0599500 DEAD-box ATP-dependent RNA helicase 52C Oryza sativa subsp. japonica
Q7MYL2 2.93e-85 271 38 10 428 3 rhlB ATP-dependent RNA helicase RhlB Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q2NQB2 3.7e-85 270 40 8 394 3 rhlB ATP-dependent RNA helicase RhlB Sodalis glossinidius (strain morsitans)
B1JQ11 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G19 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRC8 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis (strain Pestoides F)
Q1CNK3 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZAD8 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis
B2K046 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBQ4 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD47 4.22e-85 270 37 10 444 3 rhlB ATP-dependent RNA helicase RhlB Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A8GZJ0 5.08e-85 271 37 9 414 3 rhlB ATP-dependent RNA helicase RhlB Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q1DP69 5.83e-85 274 40 6 378 3 DBP2 ATP-dependent RNA helicase DBP2 Coccidioides immitis (strain RS)
B1KQF6 6.67e-85 270 37 10 428 3 rhlB ATP-dependent RNA helicase RhlB Shewanella woodyi (strain ATCC 51908 / MS32)
Q5HME0 7.28e-85 272 36 3 400 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P0CQ76 8.46e-85 273 40 6 377 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ77 8.46e-85 273 40 6 377 3 DBP2 ATP-dependent RNA helicase DBP2-A Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q9C718 9.2e-85 272 38 3 351 2 RH20 DEAD-box ATP-dependent RNA helicase 20 Arabidopsis thaliana
P42305 1e-84 271 40 3 372 1 dbpA ATP-dependent RNA helicase DbpA Bacillus subtilis (strain 168)
B0TJ29 1.15e-84 270 37 9 414 3 rhlB ATP-dependent RNA helicase RhlB Shewanella halifaxensis (strain HAW-EB4)
Q8CRP6 1.23e-84 272 36 3 400 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q6GEZ3 1.95e-84 271 37 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MRSA252)
A5E1W4 2.23e-84 272 41 6 366 3 DBP3 ATP-dependent RNA helicase DBP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q7A0D2 2.29e-84 271 37 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MW2)
Q6G7M9 2.29e-84 271 37 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain MSSA476)
Q7A4G0 2.29e-84 271 37 2 363 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain N315)
Q99SH6 2.29e-84 271 37 2 363 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HEB9 2.29e-84 271 37 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain COL)
Q2FWH5 2.29e-84 271 37 2 363 1 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FF45 2.29e-84 271 37 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain USA300)
Q329V8 2.56e-84 268 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Shigella dysenteriae serotype 1 (strain Sd197)
A1C6C4 3.02e-84 272 40 6 378 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
B6EPA4 3.34e-84 268 37 7 429 3 rhlB ATP-dependent RNA helicase RhlB Aliivibrio salmonicida (strain LFI1238)
A4WG30 3.77e-84 268 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Enterobacter sp. (strain 638)
Q8Y7M8 3.94e-84 269 40 5 365 2 dbpA ATP-dependent RNA helicase DbpA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5B0J9 4.4e-84 272 40 6 378 3 dbp2 ATP-dependent RNA helicase dbp2 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P24784 4.4e-84 273 40 5 388 1 DBP1 ATP-dependent RNA helicase DBP1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5RF43 4.53e-84 275 40 12 433 2 DDX3Y ATP-dependent RNA helicase DDX3Y Pongo abelii
B7VME9 4.94e-84 268 38 6 389 3 rhlB ATP-dependent RNA helicase RhlB Vibrio atlanticus (strain LGP32)
Q6FLF3 5.1e-84 271 39 6 388 3 DBP2 ATP-dependent RNA helicase DBP2 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
B7NTG2 5.37e-84 267 39 10 424 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q2U070 5.97e-84 271 40 6 378 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q4PHU9 6.59e-84 271 41 6 378 3 DBP2 ATP-dependent RNA helicase DBP2 Ustilago maydis (strain 521 / FGSC 9021)
A6ZWD3 6.66e-84 273 40 5 388 3 DBP1 ATP-dependent RNA helicase DBP1 Saccharomyces cerevisiae (strain YJM789)
A8G0U0 6.83e-84 268 37 8 422 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sediminis (strain HAW-EB3)
Q1DJF0 6.96e-84 274 40 7 391 3 DED1 ATP-dependent RNA helicase DED1 Coccidioides immitis (strain RS)
B1LLV3 8.42e-84 267 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SMS-3-5 / SECEC)
B7NF85 9.08e-84 267 39 10 424 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0UWA6 9.3e-84 275 40 5 390 3 DED1 ATP-dependent RNA helicase DED1 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A2QC74 9.63e-84 271 41 7 378 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A6VKC3 9.72e-84 266 39 6 399 3 rhlB ATP-dependent RNA helicase RhlB Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B7LU75 1e-83 267 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B4F1V3 1.02e-83 267 37 8 423 3 rhlB ATP-dependent RNA helicase RhlB Proteus mirabilis (strain HI4320)
A7TKR8 1.04e-83 273 41 5 386 3 DED1 ATP-dependent RNA helicase DED1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
C6DHF5 1.24e-83 267 38 7 401 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium carotovorum subsp. carotovorum (strain PC1)
P24782 1.36e-83 270 40 4 359 2 dbp2 ATP-dependent RNA helicase dbp2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A1DGZ7 1.44e-83 270 40 6 379 3 dbp2 ATP-dependent RNA helicase dbp2 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A5DL80 1.48e-83 270 38 4 370 3 DBP2 ATP-dependent RNA helicase DBP2 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
P09052 1.53e-83 273 40 6 368 1 vas ATP-dependent RNA helicase vasa Drosophila melanogaster
Q3YVI4 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Shigella sonnei (strain Ss046)
P0A8K0 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri
Q1R4F9 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain UTI89 / UPEC)
B6I4B6 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain SE11)
P0A8J8 1.64e-83 266 40 8 390 1 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12)
B1IWC0 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A8J9 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAU3 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AHV0 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O1:K1 / APEC
A8A6N4 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O9:H4 (strain HS)
B1X9Z4 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / DH10B)
C4ZZ48 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5C7 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O8 (strain IAI1)
B7MR01 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O81 (strain ED1a)
B7L8B6 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli (strain 55989 / EAEC)
B7MGJ1 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMN5 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZTY2 1.64e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O139:H28 (strain E24377A / ETEC)
A9MJ29 1.67e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
O15523 1.7e-83 273 40 12 435 1 DDX3Y ATP-dependent RNA helicase DDX3Y Homo sapiens
B5YY28 1.97e-83 266 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0A2P0 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P1 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella typhi
B4TNT3 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella schwarzengrund (strain CVM19633)
C0Q2V9 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi C (strain RKS4594)
A9MXF3 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZ26 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella newport (strain SL254)
B4TB13 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella heidelberg (strain SL476)
B5RFS3 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QVH2 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella enteritidis PT4 (strain P125109)
Q57HT6 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella choleraesuis (strain SC-B67)
B5EZ40 2.24e-83 266 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella agona (strain SL483)
Q6CIV2 2.82e-83 270 39 6 382 3 DBP2 ATP-dependent RNA helicase DBP2 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q6CZD9 2.83e-83 266 38 7 401 3 rhlB ATP-dependent RNA helicase RhlB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4X195 2.96e-83 269 40 7 379 3 dbp2 ATP-dependent RNA helicase dbp2 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
B5BIS9 3.08e-83 265 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella paratyphi A (strain AKU_12601)
B2VG58 3.33e-83 266 39 11 432 3 rhlB ATP-dependent RNA helicase RhlB Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
Q8LA13 3.4e-83 271 40 6 383 1 RH11 DEAD-box ATP-dependent RNA helicase 11 Arabidopsis thaliana
Q2YUH3 3.84e-83 268 37 2 363 3 cshA DEAD-box ATP-dependent RNA helicase CshA Staphylococcus aureus (strain bovine RF122 / ET3-1)
A6SEH9 3.97e-83 273 39 5 388 3 ded1 ATP-dependent RNA helicase ded1 Botryotinia fuckeliana (strain B05.10)
Q8XAT4 4.3e-83 265 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Escherichia coli O157:H7
Q12S35 4.51e-83 265 36 7 410 3 rhlB ATP-dependent RNA helicase RhlB Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A9L5D5 4.96e-83 265 38 10 406 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS195)
A6WTD3 4.96e-83 265 38 10 406 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS185)
A7EJY3 5.55e-83 272 39 5 386 3 ded1 ATP-dependent RNA helicase ded1 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q7SBC6 5.93e-83 269 40 6 380 3 drh-1 ATP-dependent RNA helicase dbp2 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q31UK5 6.06e-83 265 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 4 (strain Sb227)
B2TU12 6.06e-83 265 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A3D9I5 6.14e-83 265 38 10 406 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E670 6.14e-83 265 38 10 406 3 rhlB ATP-dependent RNA helicase RhlB Shewanella baltica (strain OS223)
A6ZRX0 8.37e-83 268 39 4 377 3 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain YJM789)
P24783 9.31e-83 268 39 4 377 1 DBP2 ATP-dependent RNA helicase DBP2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A1RFB3 1e-82 265 37 10 432 3 rhlB ATP-dependent RNA helicase RhlB Shewanella sp. (strain W3-18-1)
A4YB09 1e-82 265 37 10 432 3 rhlB ATP-dependent RNA helicase RhlB Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q4IF76 1.96e-82 267 39 7 380 3 DBP2 ATP-dependent RNA helicase DBP2 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
B5XYY9 1.97e-82 263 39 7 389 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae (strain 342)
C4LB49 2.03e-82 263 40 5 380 3 rhlB ATP-dependent RNA helicase RhlB Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q54IV3 2.07e-82 276 41 2 353 3 ddx42 Probable ATP-dependent RNA helicase ddx42 Dictyostelium discoideum
A8ACT3 2.08e-82 263 39 8 390 3 rhlB ATP-dependent RNA helicase RhlB Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A6TGG9 2.22e-82 263 39 7 389 3 rhlB ATP-dependent RNA helicase RhlB Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q0SYX0 2.42e-82 263 40 8 390 3 rhlB ATP-dependent RNA helicase RhlB Shigella flexneri serotype 5b (strain 8401)
P44701 2.6e-82 264 38 3 381 3 srmB ATP-dependent RNA helicase SrmB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4I7K4 2.75e-82 270 40 8 391 3 DED1 ATP-dependent RNA helicase DED1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q6GVM6 3.16e-82 270 39 11 432 2 DDX3Y ATP-dependent RNA helicase DDX3Y Pan troglodytes
A3Q9R3 3.72e-82 263 37 9 410 3 rhlB ATP-dependent RNA helicase RhlB Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q75HJ0 3.81e-82 269 40 7 392 2 PL10A DEAD-box ATP-dependent RNA helicase 37 Oryza sativa subsp. japonica
Q0INC5 3.99e-82 273 40 3 362 2 Os12g0481100 DEAD-box ATP-dependent RNA helicase 28 Oryza sativa subsp. japonica
B5FN74 4.17e-82 263 38 10 424 3 rhlB ATP-dependent RNA helicase RhlB Salmonella dublin (strain CT_02021853)
P06634 4.48e-82 268 37 7 423 1 DED1 ATP-dependent RNA helicase DED1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZP47 4.53e-82 268 37 7 423 3 DED1 ATP-dependent RNA helicase DED1 Saccharomyces cerevisiae (strain YJM789)
Q6CB69 7.91e-82 268 40 5 386 3 DED1 ATP-dependent RNA helicase DED1 Yarrowia lipolytica (strain CLIB 122 / E 150)
P19109 9.59e-82 270 39 5 378 1 Rm62 ATP-dependent RNA helicase p62 Drosophila melanogaster
Q15N18 9.84e-82 261 38 6 404 3 rhlB ATP-dependent RNA helicase RhlB Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q5A4E2 1.04e-81 269 38 6 401 3 DED1 ATP-dependent RNA helicase DED1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q54CE0 1.09e-81 271 40 4 375 3 ddx17 Probable ATP-dependent RNA helicase ddx17 Dictyostelium discoideum
Q6CT46 1.13e-81 264 42 6 371 3 DBP3 ATP-dependent RNA helicase DBP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
P16381 1.6e-81 268 39 9 428 1 D1Pas1 Putative ATP-dependent RNA helicase Pl10 Mus musculus
Q2H720 1.67e-81 265 39 6 380 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A6RGE3 1.8e-81 265 39 5 379 3 DBP2 ATP-dependent RNA helicase DBP2 Ajellomyces capsulatus (strain NAm1 / WU24)
Q6FNK8 1.94e-81 263 40 3 370 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q2HBE7 2.06e-81 268 39 5 384 3 DED1 ATP-dependent RNA helicase DED1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q6FP38 2.17e-81 266 36 8 477 3 DBP1 ATP-dependent RNA helicase DBP1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P20447 2.2e-81 264 41 6 373 1 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9P6U9 2.24e-81 268 39 6 386 3 drh-9 ATP-dependent RNA helicase ded1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A6ZUA1 2.72e-81 263 41 6 373 3 DBP3 ATP-dependent RNA helicase DBP3 Saccharomyces cerevisiae (strain YJM789)
O00571 3.02e-81 267 41 7 388 1 DDX3X ATP-dependent RNA helicase DDX3X Homo sapiens
A7TJ36 3.22e-81 263 42 4 352 3 DBP3 ATP-dependent RNA helicase DBP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q54TJ4 3.42e-81 270 40 4 365 3 ddx27 Probable ATP-dependent RNA helicase ddx27 Dictyostelium discoideum
O13370 3.61e-81 266 38 5 394 1 ded1 ATP-dependent RNA helicase ded1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6CT85 3.85e-81 262 39 4 378 3 RRP3 ATP-dependent rRNA helicase RRP3 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q9P7C7 4.38e-81 273 39 3 373 1 prp11 Pre-mRNA-processing ATP-dependent RNA helicase prp11 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q879Y6 4.71e-81 263 41 4 377 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9UJV9 4.81e-81 266 40 7 381 1 DDX41 Probable ATP-dependent RNA helicase DDX41 Homo sapiens
Q6C4D4 5.59e-81 263 38 5 370 3 DBP2 ATP-dependent RNA helicase DBP2 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q6BU54 9.27e-81 265 39 4 386 3 DED1 ATP-dependent RNA helicase DED1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A1A4H6 9.56e-81 268 41 4 363 2 DDX27 Probable ATP-dependent RNA helicase DDX27 Bos taurus
Q91VN6 9.97e-81 265 40 7 381 1 Ddx41 Probable ATP-dependent RNA helicase DDX41 Mus musculus
Q6BQ61 1.1e-80 261 38 3 380 3 RRP3 ATP-dependent rRNA helicase RRP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q62167 1.21e-80 266 41 7 388 1 Ddx3x ATP-dependent RNA helicase DDX3X Mus musculus
Q6Z4K6 1.41e-80 265 39 7 392 2 PL10B DEAD-box ATP-dependent RNA helicase 52B Oryza sativa subsp. japonica
Q96GQ7 1.64e-80 268 41 4 363 1 DDX27 Probable ATP-dependent RNA helicase DDX27 Homo sapiens
Q8SRB2 1.73e-80 261 39 4 380 3 DBP2 ATP-dependent RNA helicase DBP2 Encephalitozoon cuniculi (strain GB-M1)
Q75EW9 1.74e-80 260 39 3 373 3 RRP3 ATP-dependent rRNA helicase RRP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q5JKF2 1.96e-80 268 39 5 377 2 Os01g0549400 DEAD-box ATP-dependent RNA helicase 40 Oryza sativa subsp. japonica
A4QSS5 2.68e-80 262 39 6 380 3 DBP2 ATP-dependent RNA helicase DBP2 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A6ZSX1 2.97e-80 260 40 3 370 3 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain YJM789)
Q4P3U9 2.99e-80 262 39 2 364 3 RRP3 ATP-dependent rRNA helicase RRP3 Ustilago maydis (strain 521 / FGSC 9021)
Q755A5 3.44e-80 261 41 7 373 3 DBP3 ATP-dependent RNA helicase DBP3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75B50 3.51e-80 263 39 5 387 3 DED1 ATP-dependent RNA helicase DED1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A7E449 3.7e-80 262 39 6 378 3 dbp2 ATP-dependent RNA helicase dbp2 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q61496 3.79e-80 265 38 6 399 1 Ddx4 ATP-dependent RNA helicase DDX4 Mus musculus
Q54QS3 4.17e-80 265 40 4 386 3 ddx3 Probable ATP-dependent RNA helicase ddx3 Dictyostelium discoideum
A5DQF1 4.34e-80 259 37 3 379 3 RRP3 ATP-dependent rRNA helicase RRP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q814I2 5.26e-80 259 34 2 399 2 dbpA ATP-dependent RNA helicase DbpA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A5DZE6 6.55e-80 264 39 5 387 3 DED1 ATP-dependent RNA helicase DED1 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q5ACU6 6.63e-80 260 39 2 369 3 RRP3 ATP-dependent rRNA helicase RRP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
A6SFW7 7.09e-80 261 39 6 378 3 dbp2 ATP-dependent RNA helicase dbp2 Botryotinia fuckeliana (strain B05.10)
Q9LUW5 7.75e-80 262 38 8 379 1 RH53 DEAD-box ATP-dependent RNA helicase 53, mitochondrial Arabidopsis thaliana
Q9PA24 8.48e-80 260 41 4 377 3 rhlB ATP-dependent RNA helicase RhlB Xylella fastidiosa (strain 9a5c)
Q2UGK3 8.52e-80 264 39 7 391 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q3MSQ8 9.59e-80 265 40 4 355 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Pelophylax lessonae
P38712 9.7e-80 259 40 3 370 1 RRP3 ATP-dependent rRNA helicase RRP3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0I1X0 1.02e-79 256 36 5 400 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 129Pt)
A3LQ01 1.42e-79 262 39 5 386 3 DED1 ATP-dependent RNA helicase DED1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q4P733 1.43e-79 263 40 7 392 3 DED1 ATP-dependent RNA helicase DED1 Ustilago maydis (strain 521 / FGSC 9021)
Q8PFZ3 1.43e-79 260 40 6 400 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas axonopodis pv. citri (strain 306)
P24346 1.63e-79 263 40 6 387 2 an3 Putative ATP-dependent RNA helicase an3 Xenopus laevis
Q9VHP0 1.76e-79 266 39 5 395 1 bel ATP-dependent RNA helicase bel Drosophila melanogaster
B0UUZ9 1.84e-79 256 36 5 400 3 rhlB ATP-dependent RNA helicase RhlB Histophilus somni (strain 2336)
Q8GY84 1.91e-79 257 37 7 435 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Arabidopsis thaliana
P27639 2e-79 255 36 3 371 2 inf-1 Eukaryotic initiation factor 4A Caenorhabditis elegans
Q5B5E7 2.34e-79 257 36 3 416 3 rrp3 ATP-dependent rRNA helicase rrp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q64060 2.35e-79 263 39 9 399 1 Ddx4 Probable ATP-dependent RNA helicase DDX4 Rattus norvegicus
Q9NQI0 2.46e-79 263 40 4 364 1 DDX4 Probable ATP-dependent RNA helicase DDX4 Homo sapiens
Q7SH33 2.76e-79 270 38 3 371 3 prp-5 Pre-mRNA-processing ATP-dependent RNA helicase prp-5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
C8V8H4 3.21e-79 262 39 6 388 3 ded1 ATP-dependent RNA helicase ded1 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q10MH8 3.37e-79 264 40 3 354 2 Os03g0308500 DEAD-box ATP-dependent RNA helicase 24 Oryza sativa subsp. japonica
Q4R5S7 4.06e-79 263 40 4 364 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Macaca fascicularis
Q91372 4.15e-79 262 39 8 400 2 ddx4 Probable ATP-dependent RNA helicase DDX4 Xenopus laevis
Q5GUR8 4.25e-79 259 41 5 377 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q62095 4.88e-79 261 38 9 431 1 Ddx3y ATP-dependent RNA helicase DDX3Y Mus musculus
Q8P4D4 5.02e-79 259 41 5 377 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RWT6 5.02e-79 259 41 5 377 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain B100)
Q4UPY5 5.02e-79 259 41 5 377 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas campestris pv. campestris (strain 8004)
Q9P6N8 5.43e-79 256 39 2 348 3 rrp3 ATP-dependent rRNA helicase rrp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q4WP13 5.71e-79 261 39 7 391 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7RY59 6.24e-79 257 38 5 408 3 rrp-3 ATP-dependent rRNA helicase rrp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q4IP34 6.87e-79 269 37 3 371 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A1CXK7 6.9e-79 261 39 7 391 3 ded1 ATP-dependent RNA helicase ded1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
A2QI25 6.96e-79 261 39 7 390 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
A5DQS0 8.62e-79 260 39 5 387 3 DED1 ATP-dependent RNA helicase DED1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A4RHF1 9.07e-79 261 39 8 389 3 DED1 ATP-dependent RNA helicase DED1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
G0SFM2 1.02e-78 258 38 4 369 3 DBP2 ATP-dependent RNA helicase DBP2 Chaetomium thermophilum (strain DSM 1495 / CBS 144.50 / IMI 039719)
Q0D1K3 1.08e-78 269 39 4 373 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9VIF6 1.17e-78 256 38 2 373 1 pths ATP-dependent RNA helicase DDX47 Drosophila melanogaster
A1CH78 1.39e-78 261 39 8 393 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q5W5U4 1.76e-78 261 37 5 398 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Bos taurus
A3LS22 1.8e-78 255 36 3 382 3 RRP3 ATP-dependent rRNA helicase RRP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
O22907 1.87e-78 262 40 3 351 1 RH24 DEAD-box ATP-dependent RNA helicase 24 Arabidopsis thaliana
Q2U2J6 2.02e-78 268 40 6 376 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9SQV1 2.19e-78 267 39 4 366 2 RH40 DEAD-box ATP-dependent RNA helicase 40 Arabidopsis thaliana
Q9H0S4 2.31e-78 254 37 2 368 1 DDX47 Probable ATP-dependent RNA helicase DDX47 Homo sapiens
Q9CJS1 2.84e-78 253 40 4 370 3 rhlB ATP-dependent RNA helicase RhlB Pasteurella multocida (strain Pm70)
Q2UMH8 3.25e-78 255 41 7 363 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q5APT8 3.83e-78 256 40 7 378 3 DBP3 ATP-dependent RNA helicase DBP3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q921N6 4.09e-78 261 41 3 362 1 Ddx27 Probable ATP-dependent RNA helicase DDX27 Mus musculus
Q6GWX0 4.38e-78 260 40 4 364 2 DDX4 Probable ATP-dependent RNA helicase DDX4 Sus scrofa
Q0CIQ3 6.68e-78 252 37 8 432 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q9CWX9 7.39e-78 253 37 2 368 2 Ddx47 Probable ATP-dependent RNA helicase DDX47 Mus musculus
Q4PFD9 7.49e-78 266 38 4 374 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Ustilago maydis (strain 521 / FGSC 9021)
P0CQ92 7.59e-78 261 41 4 353 3 DRS1 ATP-dependent RNA helicase DRS1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ93 7.61e-78 261 41 4 353 3 DRS1 ATP-dependent RNA helicase DRS1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q9ZRZ8 8.55e-78 261 39 3 359 2 RH28 DEAD-box ATP-dependent RNA helicase 28 Arabidopsis thaliana
Q29S22 1.05e-77 252 37 2 368 2 DDX47 Probable ATP-dependent RNA helicase DDX47 Bos taurus
Q8H136 1.37e-77 256 37 4 369 1 RH14 DEAD-box ATP-dependent RNA helicase 14 Arabidopsis thaliana
Q65RG7 1.61e-77 251 39 8 407 3 rhlB ATP-dependent RNA helicase RhlB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q58083 2.04e-77 249 38 6 373 1 MJ0669 Probable ATP-dependent RNA helicase MJ0669 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9LUW6 2.07e-77 256 38 8 377 1 RH9 DEAD-box ATP-dependent RNA helicase 9, mitochondrial Arabidopsis thaliana
Q2HAD8 2.63e-77 264 37 3 371 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
Q7L014 2.79e-77 263 38 3 367 1 DDX46 Probable ATP-dependent RNA helicase DDX46 Homo sapiens
Q62780 3.21e-77 263 38 3 367 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Rattus norvegicus
Q569Z5 3.21e-77 263 38 3 367 1 Ddx46 Probable ATP-dependent RNA helicase DDX46 Mus musculus
P46942 3.42e-77 255 37 5 371 2 None ATP-dependent RNA helicase-like protein DB10 Nicotiana sylvestris
Q0UK12 3.67e-77 253 39 4 370 3 RRP3 ATP-dependent rRNA helicase RRP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A5UI36 3.74e-77 249 37 3 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittGG)
Q9V3C0 3.98e-77 255 37 7 382 1 abs ATP-dependent RNA helicase abstrakt Drosophila melanogaster
Q2H1Q8 4.17e-77 252 37 6 435 3 RRP3 ATP-dependent rRNA helicase RRP3 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A5DS77 4.86e-77 253 39 6 385 3 DBP2 ATP-dependent RNA helicase DBP2 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
Q7ZY47 5.09e-77 261 39 2 368 2 ddx42 ATP-dependent RNA helicase DDX42 Xenopus laevis
Q6BZ77 5.21e-77 253 41 6 360 3 DBP3 ATP-dependent RNA helicase DBP3 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q0CLJ6 5.91e-77 256 39 7 391 3 ded1 ATP-dependent RNA helicase ded1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q6CH58 6.61e-77 251 36 2 373 3 RRP3 ATP-dependent rRNA helicase RRP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9DBN9 6.81e-77 254 39 5 370 1 Ddx59 Probable ATP-dependent RNA helicase DDX59 Mus musculus
P0CQ74 6.88e-77 255 39 6 396 3 DED1 ATP-dependent RNA helicase ded1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ75 6.88e-77 255 39 6 396 3 DED1 ATP-dependent RNA helicase ded1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A2RB17 6.96e-77 250 40 3 349 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q54E49 7.01e-77 249 37 3 367 3 ddx6 Probable ATP-dependent RNA helicase ddx6 Dictyostelium discoideum
A6R3L3 8.36e-77 256 40 6 364 3 DED1 ATP-dependent RNA helicase DED1 Ajellomyces capsulatus (strain NAm1 / WU24)
Q5R6D8 1.1e-76 261 37 3 367 2 DDX46 Probable ATP-dependent RNA helicase DDX46 Pongo abelii
Q5BDW4 1.18e-76 263 38 8 415 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9LYJ9 1.24e-76 254 37 4 369 2 RH46 DEAD-box ATP-dependent RNA helicase 46 Arabidopsis thaliana
Q9C551 1.41e-76 251 39 6 371 1 RH5 DEAD-box ATP-dependent RNA helicase 5 Arabidopsis thaliana
Q5AWA6 1.49e-76 250 40 7 366 3 dbp3 ATP-dependent RNA helicase dbp3 Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q4TVV3 1.73e-76 261 36 3 367 2 ddx46 Probable ATP-dependent RNA helicase DDX46 Danio rerio
Q5T1V6 2.24e-76 253 39 5 370 1 DDX59 Probable ATP-dependent RNA helicase DDX59 Homo sapiens
A7TS37 2.32e-76 250 38 3 370 3 RRP3 ATP-dependent rRNA helicase RRP3 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
A2QFL3 2.59e-76 250 38 9 384 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
Q2UNB7 2.67e-76 249 39 3 374 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
A3LQW7 2.81e-76 251 39 5 377 3 DBP2 ATP-dependent RNA helicase DBP2 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q6FJG1 4.17e-76 246 35 4 370 3 FAL1 ATP-dependent RNA helicase FAL1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q12099 4.35e-76 246 35 4 370 1 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A6ZXY5 4.35e-76 246 35 4 370 3 FAL1 ATP-dependent RNA helicase FAL1 Saccharomyces cerevisiae (strain YJM789)
P0CR00 5.84e-76 248 39 2 360 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CR01 5.84e-76 248 39 2 360 3 RRP3 ATP-dependent rRNA helicase RRP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
A1C5V3 6.08e-76 249 39 7 364 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q1E1N5 6.13e-76 248 38 3 374 3 RRP3 ATP-dependent rRNA helicase RRP3 Coccidioides immitis (strain RS)
P0CQ98 6.58e-76 260 37 3 374 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ99 6.58e-76 260 37 3 374 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q0UY62 6.78e-76 251 40 6 362 3 DBP3 ATP-dependent RNA helicase DBP3 Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
Q1DHB2 9.38e-76 261 38 4 373 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Coccidioides immitis (strain RS)
A5UDI1 9.42e-76 246 37 3 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain PittEE)
Q4P184 9.68e-76 245 35 2 372 3 FAL1 ATP-dependent RNA helicase FAL1 Ustilago maydis (strain 521 / FGSC 9021)
A6RW56 1.01e-75 248 35 6 434 3 rrp3 ATP-dependent rRNA helicase rrp3 Botryotinia fuckeliana (strain B05.10)
A2QQA8 1.18e-75 260 39 4 373 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus niger (strain ATCC MYA-4892 / CBS 513.88 / FGSC A1513)
P0C2N8 1.19e-75 256 41 5 356 3 drh-11 ATP-dependent RNA helicase drs1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
A1CQA9 1.2e-75 260 35 5 435 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q755W0 1.7e-75 244 37 3 363 3 FAL1 ATP-dependent RNA helicase FAL1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A3LWX3 1.74e-75 248 37 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q09719 3e-75 255 37 5 403 1 dbp10 ATP-dependent RNA helicase dbp10 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q6C9P3 3.01e-75 248 40 7 359 3 DBP3 ATP-dependent RNA helicase DBP3 Yarrowia lipolytica (strain CLIB 122 / E 150)
A4R715 3.04e-75 248 36 2 367 3 DHH1 ATP-dependent RNA helicase DHH1 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
A6QRQ7 3.15e-75 247 35 6 434 3 RRP3 ATP-dependent rRNA helicase RRP3 Ajellomyces capsulatus (strain NAm1 / WU24)
Q810A7 3.16e-75 256 37 2 367 1 Ddx42 ATP-dependent RNA helicase DDX42 Mus musculus
Q4WJE9 3.44e-75 246 38 3 374 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q0E3X4 4.06e-75 250 38 7 391 2 Os02g0150100 DEAD-box ATP-dependent RNA helicase 35A Oryza sativa subsp. japonica
A7EYW0 4.31e-75 249 39 7 363 3 dbp3 ATP-dependent RNA helicase dbp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A1D405 4.4e-75 246 38 3 374 3 rrp3 ATP-dependent rRNA helicase rrp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q86XP3 4.49e-75 256 37 2 367 1 DDX42 ATP-dependent RNA helicase DDX42 Homo sapiens
A7EML8 6.07e-75 246 35 6 434 3 rrp3 ATP-dependent rRNA helicase rrp3 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
Q3BNH8 6.56e-75 248 36 8 469 3 rhlB ATP-dependent RNA helicase RhlB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q61656 6.83e-75 249 37 3 368 1 Ddx5 Probable ATP-dependent RNA helicase DDX5 Mus musculus
Q5R4I9 6.97e-75 249 37 3 368 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pongo abelii
P17844 7.74e-75 249 37 3 368 1 DDX5 Probable ATP-dependent RNA helicase DDX5 Homo sapiens
Q4R6M5 8.25e-75 249 37 3 368 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Macaca fascicularis
Q4IJH1 8.66e-75 248 39 8 369 3 DBP3 ATP-dependent RNA helicase DBP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
Q9LU46 8.78e-75 248 37 7 393 2 RH35 DEAD-box ATP-dependent RNA helicase 35 Arabidopsis thaliana
P21693 9.25e-75 244 41 5 363 1 dbpA ATP-dependent RNA helicase DbpA Escherichia coli (strain K12)
A7ENE0 9.56e-75 257 37 4 377 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1)
A0KEG9 1.07e-74 244 35 9 448 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9Y6V7 1.2e-74 245 38 8 387 1 DDX49 Probable ATP-dependent RNA helicase DDX49 Homo sapiens
A6RW79 1.38e-74 257 38 4 377 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Botryotinia fuckeliana (strain B05.10)
Q4WT99 1.4e-74 257 38 3 373 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q5R7D1 1.48e-74 254 37 2 367 2 DDX42 ATP-dependent RNA helicase DDX42 Pongo abelii
Q95YF3 1.66e-74 243 35 2 368 1 cgh-1 ATP-dependent RNA helicase cgh-1 Caenorhabditis elegans
Q4IFI0 1.73e-74 245 37 3 368 3 RRP3 ATP-dependent rRNA helicase RRP3 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A6SCT6 2.13e-74 248 38 8 386 3 dbp3 ATP-dependent RNA helicase dbp3 Botryotinia fuckeliana (strain B05.10)
Q4FZF3 2.23e-74 244 38 8 387 2 Ddx49 Probable ATP-dependent RNA helicase DDX49 Mus musculus
Q9BUQ8 2.34e-74 252 36 4 385 1 DDX23 Probable ATP-dependent RNA helicase DDX23 Homo sapiens
A4STJ7 2.64e-74 243 34 7 446 3 rhlB ATP-dependent RNA helicase RhlB Aeromonas salmonicida (strain A449)
Q54KG1 2.95e-74 249 38 5 362 1 ddx41 Probable ATP-dependent RNA helicase ddx41 Dictyostelium discoideum
Q26696 3.52e-74 246 38 7 387 3 HEL64 Putative DEAD-box RNA helicase HEL64 Trypanosoma brucei brucei
Q0ILZ4 3.54e-74 248 37 7 379 2 Os12g0611200 DEAD-box ATP-dependent RNA helicase 9 Oryza sativa subsp. japonica
A5DDF4 3.88e-74 252 37 8 378 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q9NXZ2 3.99e-74 248 38 3 357 1 DDX43 Probable ATP-dependent RNA helicase DDX43 Homo sapiens
A5DIP0 4.29e-74 245 36 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
A4RN46 4.47e-74 254 38 4 377 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
Q2GQ93 5.04e-74 244 36 2 367 3 DHH1 ATP-dependent RNA helicase DHH1 Chaetomium globosum (strain ATCC 6205 / CBS 148.51 / DSM 1962 / NBRC 6347 / NRRL 1970)
A1D373 5.29e-74 256 38 3 373 3 prp5 Pre-mRNA-processing ATP-dependent RNA helicase prp5 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q7Y183 5.3e-74 243 38 3 372 2 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. japonica
A2XKG2 5.3e-74 243 38 3 372 1 RH10 DEAD-box ATP-dependent RNA helicase 10 Oryza sativa subsp. indica
A5A6J2 5.31e-74 247 37 3 368 2 DDX5 Probable ATP-dependent RNA helicase DDX5 Pan troglodytes
A1DG51 5.48e-74 244 39 7 363 3 dbp3 ATP-dependent RNA helicase dbp3 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q0D8N0 5.61e-74 246 39 6 352 2 Os07g0143700 DEAD-box ATP-dependent RNA helicase 53 Oryza sativa subsp. japonica
P21507 5.93e-74 242 39 3 371 1 srmB ATP-dependent RNA helicase SrmB Escherichia coli (strain K12)
D0PV95 7e-74 249 38 8 389 1 laf-1 ATP-dependent RNA helicase laf-1 Caenorhabditis elegans
Q9SA27 7.5e-74 243 40 6 367 2 RH36 DEAD-box ATP-dependent RNA helicase 36 Arabidopsis thaliana
Q8TDD1 7.63e-74 252 39 2 368 1 DDX54 ATP-dependent RNA helicase DDX54 Homo sapiens
Q9SZB4 8.25e-74 244 37 7 387 3 RH43 Putative DEAD-box ATP-dependent RNA helicase 43 Arabidopsis thaliana
A1CR32 8.86e-74 243 37 3 374 3 rrp3 ATP-dependent rRNA helicase rrp3 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)
Q5ZM36 8.92e-74 241 35 2 372 2 EIF4A3 Eukaryotic initiation factor 4A-III Gallus gallus
Q8H0U8 8.99e-74 255 35 4 365 1 RH42 DEAD-box ATP-dependent RNA helicase 42 Arabidopsis thaliana
P38919 9.65e-74 241 35 2 372 1 EIF4A3 Eukaryotic initiation factor 4A-III Homo sapiens
B5FZY7 1.04e-73 240 35 2 372 2 EIF4A3 Eukaryotic initiation factor 4A-III Taeniopygia guttata
Q553B1 1.05e-73 254 36 4 373 2 helB1 ATP-dependent RNA helicase ddx46 Dictyostelium discoideum
Q3B8Q2 1.15e-73 240 35 2 372 1 Eif4a3 Eukaryotic initiation factor 4A-III Rattus norvegicus
A6M931 1.15e-73 240 35 2 372 2 EIF4A3 Eukaryotic initiation factor 4A-III Sus scrofa
Q2NL22 1.15e-73 240 35 2 372 2 EIF4A3 Eukaryotic initiation factor 4A-III Bos taurus
P0CQ79 1.21e-73 246 39 9 377 3 DBP3 ATP-dependent RNA helicase DBP3 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q6YS30 1.21e-73 243 37 5 372 2 Os07g0301200 DEAD-box ATP-dependent RNA helicase 5 Oryza sativa subsp. japonica
P0CQ78 1.25e-73 246 39 9 377 3 DBP3 ATP-dependent RNA helicase DBP3 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q91VC3 1.72e-73 240 35 2 372 1 Eif4a3 Eukaryotic initiation factor 4A-III Mus musculus
Q4HW67 1.76e-73 243 35 2 367 3 DHH1 ATP-dependent RNA helicase DHH1 Gibberella zeae (strain ATCC MYA-4620 / CBS 123657 / FGSC 9075 / NRRL 31084 / PH-1)
A7TGU7 1.98e-73 242 36 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q8K4L0 1.99e-73 251 38 2 368 1 Ddx54 ATP-dependent RNA helicase DDX54 Mus musculus
Q84UQ1 2e-73 253 36 4 369 2 Os08g0159900 DEAD-box ATP-dependent RNA helicase 42 Oryza sativa subsp. japonica
Q7ZVA6 2.1e-73 239 35 2 372 2 eif4a3 Eukaryotic initiation factor 4A-III Danio rerio
A3LRW2 2.23e-73 243 40 6 360 3 DBP3 ATP-dependent RNA helicase DBP3 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5RC67 2.54e-73 249 36 4 385 2 DDX23 Probable ATP-dependent RNA helicase DDX23 Pongo abelii
Q5U526 2.56e-73 239 35 2 372 2 eif4a3-a Eukaryotic initiation factor 4A-III-A Xenopus laevis
P23128 2.82e-73 241 36 2 367 1 me31B ATP-dependent RNA helicase me31b Drosophila melanogaster
Q53RK8 3.38e-73 248 36 5 386 2 Os03g0708600 DEAD-box ATP-dependent RNA helicase 21 Oryza sativa subsp. japonica
Q501J6 3.45e-73 246 37 3 351 1 Ddx17 Probable ATP-dependent RNA helicase DDX17 Mus musculus
A7TEF4 3.85e-73 239 34 4 370 3 FAL1 ATP-dependent RNA helicase FAL1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q10I26 4.25e-73 239 35 2 375 1 EIF4A3B Eukaryotic initiation factor 4A-III homolog B Oryza sativa subsp. japonica
Q7S5R1 4.34e-73 244 39 8 382 3 dbp-3 ATP-dependent RNA helicase dbp-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q10202 4.64e-73 243 40 10 387 3 dbp3 ATP-dependent RNA helicase dbp3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q94A52 5.34e-73 238 34 2 375 1 EIF4A3 Eukaryotic initiation factor 4A-III homolog Arabidopsis thaliana
B7ZTW1 5.4e-73 239 35 2 372 2 eif4a3 Eukaryotic initiation factor 4A-III Xenopus tropicalis
A5DAC8 6.09e-73 242 39 4 348 3 DBP3 ATP-dependent RNA helicase DBP3 Meyerozyma guilliermondii (strain ATCC 6260 / CBS 566 / DSM 6381 / JCM 1539 / NBRC 10279 / NRRL Y-324)
Q09903 6.62e-73 247 38 3 352 3 drs1 ATP-dependent RNA helicase drs1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A4RGD1 7.06e-73 242 34 9 451 3 RRP3 ATP-dependent rRNA helicase RRP3 Pyricularia oryzae (strain 70-15 / ATCC MYA-4617 / FGSC 8958)
B5DG42 7.9e-73 238 35 2 372 2 eif4a3 Eukaryotic initiation factor 4A-III Salmo salar
A7TJM9 8.55e-73 247 39 8 358 3 DRS1 ATP-dependent RNA helicase DRS1 Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
P44922 9.5e-73 238 37 3 370 3 rhlB ATP-dependent RNA helicase RhlB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8RXK6 9.77e-73 241 35 2 370 2 RH8 DEAD-box ATP-dependent RNA helicase 8 Arabidopsis thaliana
Q86TM3 1.09e-72 244 37 4 359 1 DDX53 Probable ATP-dependent RNA helicase DDX53 Homo sapiens
Q6CSZ7 1.2e-72 241 36 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A0A1D6LAB7 1.27e-72 246 39 6 363 2 RH3B DEAD-box ATP-dependent RNA helicase 3B, chloroplastic Zea mays
P41380 1.39e-72 237 34 2 375 2 None Eukaryotic initiation factor 4A-3 Nicotiana plumbaginifolia
Q5ZKB9 1.43e-72 239 34 4 391 2 DDX6 Probable ATP-dependent RNA helicase DDX6 Gallus gallus
Q6FQU5 1.44e-72 240 36 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
P26196 1.46e-72 239 34 4 391 1 DDX6 Probable ATP-dependent RNA helicase DDX6 Homo sapiens
Q5F485 1.53e-72 249 37 2 367 2 DDX42 ATP-dependent RNA helicase DDX42 Gallus gallus
A6RY31 1.83e-72 241 35 4 397 3 dhh1 ATP-dependent RNA helicase dhh1 Botryotinia fuckeliana (strain B05.10)
Q9VHS8 1.95e-72 237 35 2 372 1 CG7483 Eukaryotic initiation factor 4A-III Drosophila melanogaster
Q94BV4 1.98e-72 241 36 2 367 2 RH6 DEAD-box ATP-dependent RNA helicase 6 Arabidopsis thaliana
Q6CCZ1 2.09e-72 249 32 10 498 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Yarrowia lipolytica (strain CLIB 122 / E 150)
A5E6W6 2.2e-72 240 39 8 371 3 RRP3 ATP-dependent rRNA helicase RRP3 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
P54823 2.34e-72 239 34 4 391 1 Ddx6 Probable ATP-dependent RNA helicase DDX6 Mus musculus
Q4JG17 2.44e-72 244 38 5 357 2 vasa Probable ATP-dependent RNA helicase vasa-like Penaeus vannamei
Q4R3Q1 2.53e-72 237 35 2 372 2 EIF4A3 Eukaryotic initiation factor 4A-III Macaca fascicularis
P0CQ72 2.58e-72 236 34 2 372 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CQ73 2.58e-72 236 34 2 372 3 FAL1 ATP-dependent RNA helicase FAL1 Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q4WH83 3.08e-72 239 39 7 363 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q6BJX6 3.21e-72 239 35 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q92841 3.72e-72 244 37 3 351 1 DDX17 Probable ATP-dependent RNA helicase DDX17 Homo sapiens
Q1DZK8 3.79e-72 239 39 6 361 3 DBP3 ATP-dependent RNA helicase DBP3 Coccidioides immitis (strain RS)
Q0DM51 4.6e-72 245 39 6 363 2 Os03g0827700 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Oryza sativa subsp. japonica
Q6BML1 5.28e-72 247 37 6 380 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
A5E058 6.47e-72 248 39 7 360 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Lodderomyces elongisporus (strain ATCC 11503 / CBS 2605 / JCM 1781 / NBRC 1676 / NRRL YB-4239)
A0A1D6GDY8 6.82e-72 244 39 6 363 3 RH3A DEAD-box ATP-dependent RNA helicase 3A, chloroplastic Zea mays
Q5VNM3 6.87e-72 236 35 2 375 1 EIF4A3A Eukaryotic initiation factor 4A-III homolog A Oryza sativa subsp. japonica
Q40468 6.96e-72 236 36 2 370 2 None Eukaryotic initiation factor 4A-15 Nicotiana tabacum
Q9WTM2 7.17e-72 238 34 4 391 2 DDX6 Probable ATP-dependent RNA helicase DDX6 (Fragment) Cavia porcellus
Q6C0X2 7.22e-72 239 36 2 368 3 DHH1 ATP-dependent RNA helicase DHH1 Yarrowia lipolytica (strain CLIB 122 / E 150)
O42226 7.31e-72 236 35 2 372 2 eif4a3-b Eukaryotic initiation factor 4A-III-B Xenopus laevis
Q9M2E0 7.85e-72 238 35 2 367 2 RH12 DEAD-box ATP-dependent RNA helicase 12 Arabidopsis thaliana
Q40470 1.44e-71 235 35 2 370 2 None Eukaryotic initiation factor 4A-7 Nicotiana tabacum
Q8SQK9 1.6e-71 237 37 2 373 3 DHH1 ATP-dependent RNA helicase DHH1 Encephalitozoon cuniculi (strain GB-M1)
Q6CJV1 2.15e-71 243 38 6 354 3 DRS1 ATP-dependent RNA helicase DRS1 Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
Q8L7S8 2.26e-71 243 40 6 351 1 RH3 DEAD-box ATP-dependent RNA helicase 3, chloroplastic Arabidopsis thaliana
A3LQ55 2.42e-71 245 36 7 395 3 PRP5 Pre-mRNA-processing ATP-dependent RNA helicase PRP5 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q5AAW3 2.65e-71 238 36 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q5RFQ5 2.88e-71 236 34 4 391 2 DDX6 Probable ATP-dependent RNA helicase DDX6 Pongo abelii
Q6BT27 2.96e-71 234 34 3 371 3 FAL1 ATP-dependent RNA helicase FAL1 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
Q8SR63 2.98e-71 234 34 3 373 3 RRP3 ATP-dependent rRNA helicase RRP3 Encephalitozoon cuniculi (strain GB-M1)
A3GFV3 3.33e-71 234 34 3 371 3 FAL1 ATP-dependent RNA helicase FAL1 Scheffersomyces stipitis (strain ATCC 58785 / CBS 6054 / NBRC 10063 / NRRL Y-11545)
Q75BS4 3.9e-71 236 36 2 366 3 DHH1 ATP-dependent RNA helicase DHH1 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q55D61 4.24e-71 233 34 3 370 3 tifA Eukaryotic initiation factor 4A Dictyostelium discoideum
A1D8G1 4.89e-71 236 35 2 367 3 dhh1 ATP-dependent RNA helicase dhh1 Neosartorya fischeri (strain ATCC 1020 / DSM 3700 / CBS 544.65 / FGSC A1164 / JCM 1740 / NRRL 181 / WB 181)
Q4WWD3 4.94e-71 236 35 2 367 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus fumigatus (strain ATCC MYA-4609 / CBS 101355 / FGSC A1100 / Af293)
Q7S5D9 5.19e-71 238 36 2 357 3 drh-10 ATP-dependent RNA helicase dhh1 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P93008 5.55e-71 241 34 5 386 2 RH21 DEAD-box ATP-dependent RNA helicase 21 Arabidopsis thaliana
Q0IHV9 6.83e-71 235 35 3 368 2 ddx6 Probable ATP-dependent RNA helicase ddx6 Xenopus tropicalis
Q2UQI6 7.5e-71 243 38 4 352 3 drs1 ATP-dependent RNA helicase drs1 Aspergillus oryzae (strain ATCC 42149 / RIB 40)
Q9C8J1 8.05e-71 232 35 2 361 2 RH34 DEAD-box ATP-dependent RNA helicase 34 Arabidopsis thaliana
Q0CL13 8.45e-71 235 39 6 362 3 dbp3 ATP-dependent RNA helicase dbp3 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
P41382 8.79e-71 233 35 2 370 2 None Eukaryotic initiation factor 4A-10 Nicotiana tabacum
Q0CBE1 8.8e-71 236 35 2 367 3 dhh1 ATP-dependent RNA helicase dhh1 Aspergillus terreus (strain NIH 2624 / FGSC A1156)
A1CHL3 8.83e-71 242 34 4 392 3 prp28 Pre-mRNA-splicing ATP-dependent RNA helicase prp28 Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1 / QM 1276 / 107)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03055
Feature type CDS
Gene rhlE
Product ATP-dependent RNA helicase RhlE
Location 673134 - 674531 (strand: 1)
Length 1398 (nucleotides) / 465 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1477
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00270 DEAD/DEAH box helicase
PF00271 Helicase conserved C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0513 Replication, recombination and repair (L) L Superfamily II DNA and RNA helicase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K11927 ATP-dependent RNA helicase RhlE [EC:3.6.4.13] RNA degradation -

Protein Sequence

MTDFTSLGLSEALLRAIDEQGYKTPTPIQQQAIEPILAGKDVLASAQTGTGKTAAFTLPILEKLATSAEKTKGRKPVKALILTPTRELAAQIADNVKAYSRYLPIRSLVVFGGVSINPQMMKLRGGVDVLIATPGRLLDLEHQNAVDLSRVEVLVLDEADRMLDMGFIHDIRRVINKLPKKRQNLLFSATFSKEITGLANSLLNNPISIAVAPKNSAAESVDQYVHLVDKKRKTELLSHLIGLENWPQVLIFTRTKHGANKLAEHLNLDGIKSAAIHGNKSQGARTRALADFKDGKLKALVATDIAARGLDIDQLPYVVNFELPQVAEDYVHRIGRTGRAAATGKAISLVCVDEHGLLADIERLLKREIPRLALEGYDPDPSIKAAPLHKKPKNKARNNKEGGHGRADIRGKDNRHTPRNKNSRNQKESETGEIKQNKSKPARRSRKHDDDRDNQNPWSKARKEF

Flanking regions ( +/- flanking 50bp)

TTTAATTTCAATCACCGTGTTATGCGTTCTGGTTGTAGGAGATTTCTGTTTTGACCGATTTTACATCGCTTGGTTTAAGTGAGGCGCTTCTCCGCGCTATTGATGAACAAGGGTATAAAACCCCAACCCCTATTCAACAACAGGCGATTGAGCCGATTTTGGCGGGTAAGGACGTATTAGCAAGTGCACAAACGGGTACGGGAAAAACGGCCGCATTTACATTACCGATACTGGAAAAACTCGCTACATCAGCAGAGAAAACGAAAGGGCGTAAGCCAGTTAAAGCGCTTATTTTAACCCCTACACGTGAATTAGCTGCACAAATTGCCGATAACGTAAAAGCTTATAGTCGTTATTTACCTATTCGTTCATTGGTGGTTTTTGGTGGCGTCAGTATCAATCCTCAAATGATGAAACTACGAGGTGGCGTCGATGTTTTGATTGCAACACCAGGCCGCTTACTTGATCTTGAACATCAAAATGCTGTCGACTTATCTCGCGTTGAAGTATTGGTGTTAGATGAAGCTGATCGTATGTTAGATATGGGATTTATTCATGATATTCGTCGAGTCATCAATAAGTTACCGAAAAAACGACAAAATTTACTCTTTTCAGCGACTTTTTCAAAAGAGATAACAGGGCTTGCTAACTCACTACTCAACAATCCTATAAGTATTGCTGTTGCCCCCAAAAACTCAGCGGCTGAATCTGTTGATCAATATGTCCATTTAGTGGATAAAAAGCGTAAGACAGAGCTGTTATCACACTTAATTGGCCTAGAAAATTGGCCTCAAGTTCTTATTTTTACTCGAACTAAACATGGTGCGAATAAATTAGCTGAACATCTTAATTTAGATGGCATCAAATCAGCGGCGATCCACGGTAATAAAAGCCAAGGAGCTAGAACACGTGCTCTAGCTGATTTTAAAGACGGTAAATTAAAAGCGTTAGTTGCCACTGATATTGCAGCGCGGGGACTTGATATTGACCAACTTCCTTATGTGGTCAACTTTGAATTACCGCAGGTAGCAGAAGATTATGTTCATCGTATTGGTCGAACAGGGCGTGCGGCGGCAACAGGTAAAGCGATATCTTTAGTTTGTGTTGATGAACATGGCTTATTAGCCGATATTGAACGCTTATTAAAACGTGAAATCCCTCGTTTAGCATTAGAAGGTTACGATCCTGATCCCTCAATAAAAGCGGCGCCTTTGCATAAAAAGCCAAAGAATAAAGCACGTAATAATAAAGAAGGCGGACATGGTCGTGCTGATATTCGTGGCAAAGATAATCGCCATACACCACGTAATAAAAATAGTCGTAATCAAAAAGAGAGTGAAACGGGTGAGATAAAACAGAATAAATCTAAACCAGCTAGACGTTCACGCAAACACGATGATGATCGTGATAATCAAAATCCTTGGTCAAAAGCTAGAAAAGAATTTTGAGGCTAAACTGTGCGAGTCCTATTAGCGCCAATGGAGGGGGTGTTAGACCC