Homologs in group_1478

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09540 FBDBKF_09540 60.3 Morganella morganii S1 cecR transcriptional regulator CecR
EHELCC_04340 EHELCC_04340 60.3 Morganella morganii S2 cecR transcriptional regulator CecR
NLDBIP_04340 NLDBIP_04340 60.3 Morganella morganii S4 cecR transcriptional regulator CecR
LHKJJB_14290 LHKJJB_14290 60.3 Morganella morganii S3 cecR transcriptional regulator CecR
HKOGLL_12245 HKOGLL_12245 60.3 Morganella morganii S5 cecR transcriptional regulator CecR
F4V73_RS00825 F4V73_RS00825 59.8 Morganella psychrotolerans cecR transcriptional regulator CecR

Distribution of the homologs in the orthogroup group_1478

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1478

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACU1 8.31e-59 188 44 2 215 3 cecR HTH-type transcriptional dual regulator CecR Shigella flexneri
P0ACU0 8.31e-59 188 44 2 215 1 cecR HTH-type transcriptional dual regulator CecR Escherichia coli (strain K12)
Q88FX7 1.89e-06 50 31 4 123 2 nicS HTH-type transcriptional repressor NicS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8X4Z7 8.16e-05 45 31 2 122 3 rutR HTH-type transcriptional regulator RutR Escherichia coli O157:H7
P0ACU4 8.64e-05 45 31 2 122 3 rutR HTH-type transcriptional regulator RutR Shigella flexneri
P0ACU2 8.64e-05 45 31 2 122 1 rutR HTH-type transcriptional regulator RutR Escherichia coli (strain K12)
P0ACU3 8.64e-05 45 31 2 122 3 rutR HTH-type transcriptional regulator RutR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8NQ97 8.67e-05 45 35 0 56 1 acnR HTH-type transcriptional repressor AcnR Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8FTA6 0.000125 45 35 0 56 3 acnR HTH-type transcriptional repressor AcnR Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS03050
Feature type CDS
Gene cecR
Product transcriptional regulator CecR
Location 672125 - 672823 (strand: -1)
Length 699 (nucleotides) / 232 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1478
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF09209 HTH-type transcriptional dual regulator CecR, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1309 Transcription (K) K DNA-binding protein, AcrR family, includes nucleoid occlusion protein SlmA

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K23777 TetR/AcrR family transcriptional regulator, regulator of cefoperazone and chloramphenicol sensitivity - -

Protein Sequence

MPDTHQKKTRGELAKRQLLEAACEIFGKNGPDSATTRQIAQAAKQNIAAIAYYFGSKEGLYLAVAQYIADLIRIDFEPTVAQLDDFLEKPNPTEHLPLLQKLIIDSFLQYARLVLDKSNVHISRIMAREQLVPTEAYSLIHQQALSPLLTRVNRLLALYIGLDPTLPKTMLHTHAILGEVLSFRLVRETILRQTGWDRIGKQEYEIISNTLKVHITLLLDGLREIYTHNNHA

Flanking regions ( +/- flanking 50bp)

CTATTTTAATGTTATTTCTTTGTTACATTTTACTTAAGTAAGGTATCCTTATGCCAGACACACACCAAAAGAAAACTCGAGGGGAACTTGCAAAACGACAGTTATTAGAAGCTGCCTGTGAAATCTTTGGTAAAAATGGGCCTGATAGCGCCACAACTCGCCAGATTGCGCAAGCTGCGAAGCAAAATATCGCGGCTATTGCTTACTATTTTGGCTCTAAAGAAGGGTTATATCTCGCTGTTGCACAGTATATTGCCGATTTAATTCGAATTGATTTTGAACCCACCGTTGCACAACTTGATGATTTTCTTGAAAAACCTAATCCAACAGAGCACTTACCCCTATTACAAAAACTGATCATTGACAGTTTTTTGCAATATGCCCGACTCGTACTTGATAAAAGCAATGTACATATCAGTCGCATTATGGCAAGAGAACAACTTGTTCCCACAGAAGCCTATTCCCTTATCCACCAGCAAGCGTTATCTCCGCTATTAACTCGTGTAAATCGTTTATTAGCACTTTATATTGGCTTAGATCCAACTTTACCAAAAACCATGCTACATACTCACGCTATTTTGGGAGAGGTGCTATCATTTCGATTAGTACGAGAAACCATTTTACGCCAAACTGGATGGGATAGAATTGGTAAACAGGAATATGAAATTATTTCTAATACCTTAAAAGTACATATTACTTTACTACTTGATGGACTAAGAGAGATCTATACTCATAACAACCATGCATAAATATAAATAGAGTTATTATGAAAACGAAAAAAATCAGTGTCTTTATTATC