Homologs in group_1478

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09540 FBDBKF_09540 100.0 Morganella morganii S1 cecR transcriptional regulator CecR
EHELCC_04340 EHELCC_04340 100.0 Morganella morganii S2 cecR transcriptional regulator CecR
NLDBIP_04340 NLDBIP_04340 100.0 Morganella morganii S4 cecR transcriptional regulator CecR
LHKJJB_14290 LHKJJB_14290 100.0 Morganella morganii S3 cecR transcriptional regulator CecR
F4V73_RS00825 F4V73_RS00825 86.0 Morganella psychrotolerans cecR transcriptional regulator CecR
PMI_RS03050 PMI_RS03050 60.3 Proteus mirabilis HI4320 cecR transcriptional regulator CecR

Distribution of the homologs in the orthogroup group_1478

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1478

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACU1 3.95e-56 181 45 2 221 3 cecR HTH-type transcriptional dual regulator CecR Shigella flexneri
P0ACU0 3.95e-56 181 45 2 221 1 cecR HTH-type transcriptional dual regulator CecR Escherichia coli (strain K12)
Q8X4Z7 7.68e-06 48 34 3 111 3 rutR HTH-type transcriptional regulator RutR Escherichia coli O157:H7
P0ACU4 8.21e-06 48 34 3 111 3 rutR HTH-type transcriptional regulator RutR Shigella flexneri
P0ACU2 8.21e-06 48 34 3 111 1 rutR HTH-type transcriptional regulator RutR Escherichia coli (strain K12)
P0ACU3 8.21e-06 48 34 3 111 3 rutR HTH-type transcriptional regulator RutR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
O34970 0.000163 44 26 4 129 1 yttP Probable HTH-type transcriptional regulator YttP Bacillus subtilis (strain 168)
Q88FX7 0.00049 43 39 0 51 2 nicS HTH-type transcriptional repressor NicS Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P9WMC3 0.000502 43 33 1 69 1 Rv3405c HTH-type transcriptional repressor Rv3405c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WMC2 0.000502 43 33 1 69 3 MT3513 HTH-type transcriptional regulator MT3513 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P67443 0.000502 43 33 1 69 3 BQ2027_MB3439C HTH-type transcriptional regulator Mb3439c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_12245
Feature type CDS
Gene cecR
Product transcriptional regulator CecR
Location 7143 - 7829 (strand: 1)
Length 687 (nucleotides) / 228 (amino acids)

Contig

Accession ZDB_690
Length 144397 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1478
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00440 Bacterial regulatory proteins, tetR family
PF09209 HTH-type transcriptional dual regulator CecR, C-terminal domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3226 Transcription (K) K DNA-binding transcriptional regulator YbjK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K23777 TetR/AcrR family transcriptional regulator, regulator of cefoperazone and chloramphenicol sensitivity - -

Protein Sequence

MSVNTTNTPRGEQAKLALLEAAIEIFGLNGPNSATTRQIAQRADQNIAAIAYYFGSKDGLYLAVAQHIADIIRDEFRPVIEEIDLFLENGADERDESRCLQLIELSFLAYNELVLKKSNINISRIMSREQLIPTKAYTLIHEQALSAIFTRQARLVARYTGLPDGHINTLIHTHALMGEILSFRLARENLLRQTGWDNIGPKEYDMINDVLREHIRLLLSGLKQHYRN

Flanking regions ( +/- flanking 50bp)

CATATGATTGATCTCTCGTTTATGCCGACACACCCATAAGGATATACGCCATGTCAGTCAATACGACTAATACGCCGCGAGGCGAACAAGCCAAACTCGCTTTACTGGAAGCCGCTATTGAGATTTTCGGACTGAACGGCCCAAATAGTGCCACTACTCGCCAGATTGCACAACGTGCGGATCAAAATATCGCAGCTATTGCTTATTATTTCGGCTCAAAAGACGGGTTGTATCTGGCCGTTGCACAGCATATTGCCGACATTATCCGTGATGAATTCCGTCCTGTCATTGAAGAAATTGATCTGTTTCTGGAAAACGGCGCTGACGAACGGGATGAAAGCCGCTGTCTGCAACTGATTGAACTGAGTTTTCTTGCCTACAATGAGCTGGTACTGAAGAAAAGTAATATTAATATCAGCCGGATTATGTCGCGCGAGCAGTTAATTCCGACCAAAGCTTACACGCTTATCCACGAACAGGCGCTATCCGCGATTTTTACCCGCCAGGCCAGATTAGTTGCCCGTTATACCGGGCTGCCGGACGGACATATCAATACGCTGATCCATACACACGCTCTGATGGGGGAGATTTTATCTTTCCGTCTGGCACGGGAAAACCTGCTGCGCCAGACCGGCTGGGATAATATCGGCCCGAAAGAGTATGACATGATCAACGATGTGCTGCGGGAACATATCCGGCTGCTGCTCAGCGGTTTAAAACAGCATTACCGCAACTGATACACCACTGTCTCTGATAACTCACCAGGAATCAATTCATGAAGCCAATG