Homologs in group_1537

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09620 FBDBKF_09620 78.8 Morganella morganii S1 bioB biotin synthase BioB
EHELCC_04420 EHELCC_04420 78.8 Morganella morganii S2 bioB biotin synthase BioB
NLDBIP_04420 NLDBIP_04420 78.8 Morganella morganii S4 bioB biotin synthase BioB
LHKJJB_14210 LHKJJB_14210 78.8 Morganella morganii S3 bioB biotin synthase BioB
HKOGLL_12325 HKOGLL_12325 78.8 Morganella morganii S5 bioB biotin synthase BioB
F4V73_RS00720 F4V73_RS00720 78.6 Morganella psychrotolerans bioB biotin synthase BioB

Distribution of the homologs in the orthogroup group_1537

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1537

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ESU3 0.0 723 100 0 345 3 bioB Biotin synthase Proteus mirabilis (strain HI4320)
Q7N6Q7 0.0 593 80 0 341 3 bioB Biotin synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P36569 0.0 588 78 0 344 3 bioB Biotin synthase Serratia marcescens
Q3Z409 0.0 585 78 0 344 3 bioB Biotin synthase Shigella sonnei (strain Ss046)
B1LM66 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli (strain SMS-3-5 / SECEC)
B7NA74 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P12996 0.0 585 78 0 344 1 bioB Biotin synthase Escherichia coli (strain K12)
B1IXJ3 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY31 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli O9:H4 (strain HS)
B1X7A5 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli (strain K12 / DH10B)
B7M747 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli O8 (strain IAI1)
B7NNK5 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LC57 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli (strain 55989 / EAEC)
B7ULX2 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJI4 0.0 585 78 0 344 3 bioB Biotin synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q1REF5 0.0 584 78 0 344 3 bioB Biotin synthase Escherichia coli (strain UTI89 / UPEC)
Q8FJQ3 0.0 584 78 0 344 3 bioB Biotin synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A917 0.0 584 78 0 344 3 bioB Biotin synthase Escherichia coli O1:K1 / APEC
B7MQM8 0.0 584 78 0 344 3 bioB Biotin synthase Escherichia coli O81 (strain ED1a)
B7MGN3 0.0 584 78 0 344 3 bioB Biotin synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7LJY8 0.0 584 78 0 344 3 bioB Biotin synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q32I44 0.0 583 78 0 344 3 bioB Biotin synthase Shigella dysenteriae serotype 1 (strain Sd197)
Q83S46 0.0 583 78 0 344 3 bioB Biotin synthase Shigella flexneri
Q0T6I5 0.0 583 78 0 344 3 bioB Biotin synthase Shigella flexneri serotype 5b (strain 8401)
B6I7S9 0.0 583 78 0 344 3 bioB Biotin synthase Escherichia coli (strain SE11)
A7MJ03 0.0 583 78 0 344 3 bioB Biotin synthase Cronobacter sakazakii (strain ATCC BAA-894)
A6T6L5 0.0 582 77 0 344 3 bioB Biotin synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A8AJ12 0.0 582 78 0 344 3 bioB Biotin synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B5YRL4 0.0 582 78 0 344 3 bioB Biotin synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X825 0.0 582 78 0 344 3 bioB Biotin synthase Escherichia coli O157:H7
Q47862 0.0 581 77 0 344 3 bioB Biotin synthase Pseudescherichia vulneris
Q0TJS3 0.0 581 78 0 344 3 bioB Biotin synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B5XZ75 0.0 580 77 0 344 3 bioB Biotin synthase Klebsiella pneumoniae (strain 342)
Q6D3B9 0.0 580 78 0 339 3 bioB Biotin synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B1JSS4 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66D67 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNQ6 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pestis (strain Pestoides F)
Q1CFQ3 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3C8 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pestis bv. Antiqua (strain Angola)
Q7CH65 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pestis
B2K8T0 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C947 0.0 580 77 0 345 3 bioB Biotin synthase Yersinia pestis bv. Antiqua (strain Antiqua)
Q324B7 0.0 580 78 0 344 3 bioB Biotin synthase Shigella boydii serotype 4 (strain Sb227)
B2TVF5 0.0 580 78 0 344 3 bioB Biotin synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A7FKM9 0.0 577 77 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JS69 0.0 575 76 1 349 3 bioB Biotin synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P12678 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TQT9 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella schwarzengrund (strain CVM19633)
B5BC31 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella paratyphi A (strain AKU_12601)
C0PWY2 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella paratyphi C (strain RKS4594)
A9MTI8 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PG48 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4SZJ7 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella newport (strain SL254)
B4TC48 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella heidelberg (strain SL476)
B5QX65 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella enteritidis PT4 (strain P125109)
B5FP61 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella dublin (strain CT_02021853)
A9MJE6 0.0 573 77 0 344 3 bioB Biotin synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q2NUJ7 0.0 572 76 0 344 3 bioB Biotin synthase Sodalis glossinidius (strain morsitans)
Q8Z893 0.0 572 76 0 344 3 bioB Biotin synthase Salmonella typhi
Q57RG3 0.0 572 77 0 344 3 bioB Biotin synthase Salmonella choleraesuis (strain SC-B67)
B5F072 0.0 572 76 0 344 3 bioB Biotin synthase Salmonella agona (strain SL483)
B2VBT9 0.0 572 78 0 339 3 bioB Biotin synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5R761 0.0 571 76 0 344 3 bioB Biotin synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A8GBC5 0.0 570 77 0 345 3 bioB Biotin synthase Serratia proteamaculans (strain 568)
A4W8B7 0.0 565 76 0 344 3 bioB Biotin synthase Enterobacter sp. (strain 638)
A0KIC6 0.0 511 70 2 339 3 bioB Biotin synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4XZR9 1.25e-180 506 67 0 344 3 bioB Biotin synthase Pseudomonas mendocina (strain ymp)
A4SPR7 1.38e-180 507 69 2 339 3 bioB Biotin synthase Aeromonas salmonicida (strain A449)
B1JE55 1.82e-180 506 67 0 343 3 bioB Biotin synthase Pseudomonas putida (strain W619)
B0KJ53 4.92e-180 505 68 0 343 3 bioB Biotin synthase Pseudomonas putida (strain GB-1)
Q88QX2 8.14e-180 504 67 0 343 3 bioB Biotin synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A4VR88 1.1e-179 504 67 0 343 3 bioB Biotin synthase Stutzerimonas stutzeri (strain A1501)
Q9I618 5.41e-179 502 67 0 344 3 bioB Biotin synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V485 5.41e-179 502 67 0 344 3 bioB Biotin synthase Pseudomonas aeruginosa (strain LESB58)
A5VXF1 9.45e-179 502 67 0 343 3 bioB Biotin synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q8K9P1 1.19e-178 501 64 1 341 3 bioB Biotin synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q1I3N6 3.92e-178 500 67 0 343 3 bioB Biotin synthase Pseudomonas entomophila (strain L48)
A6UYW0 4.94e-178 500 67 0 344 3 bioB Biotin synthase Pseudomonas aeruginosa (strain PA7)
Q02TR6 8.73e-178 499 67 0 344 3 bioB Biotin synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
B6ESC7 8.27e-177 497 66 2 351 3 bioB Biotin synthase Aliivibrio salmonicida (strain LFI1238)
B5EUQ0 9.54e-177 496 68 1 335 3 bioB Biotin synthase Aliivibrio fischeri (strain MJ11)
B1WN69 1.05e-176 496 68 1 335 3 bioB Biotin synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q15SR5 1.82e-176 496 68 2 341 3 bioB Biotin synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B4S0P9 2.16e-176 496 71 1 322 3 bioB Biotin synthase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q9KSZ4 3.21e-176 495 66 2 351 3 bioB Biotin synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2H3 3.21e-176 495 66 2 351 3 bioB Biotin synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q7MLV0 4.72e-176 495 66 2 350 3 bioB Biotin synthase Vibrio vulnificus (strain YJ016)
Q8D8M9 4.72e-176 495 66 2 350 3 bioB Biotin synthase Vibrio vulnificus (strain CMCP6)
Q4K4T2 8.54e-176 494 66 1 345 3 bioB Biotin synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3K5P1 1.21e-175 494 66 1 345 3 bioB Biotin synthase Pseudomonas fluorescens (strain Pf0-1)
B8D983 2.6e-175 493 64 1 341 3 bioB Biotin synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
A1SW31 5.26e-175 492 66 2 340 3 bioB Biotin synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q87QN6 5.91e-175 492 66 2 351 3 bioB Biotin synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P57378 6.82e-175 491 64 1 341 3 bioB Biotin synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D7I5 7.52e-175 491 64 2 342 3 bioB Biotin synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A7MX36 1.6e-174 491 66 2 351 3 bioB Biotin synthase Vibrio campbellii (strain ATCC BAA-1116)
Q4ZMA8 8.32e-174 489 66 3 345 3 bioB Biotin synthase Pseudomonas syringae pv. syringae (strain B728a)
Q48CS1 2.46e-173 488 67 2 339 3 bioB Biotin synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B3PI87 2.85e-173 488 67 1 339 3 bioB Biotin synthase Cellvibrio japonicus (strain Ueda107)
B7VH16 4.27e-173 487 64 2 351 3 bioB Biotin synthase Vibrio atlanticus (strain LGP32)
A1U4B2 2.85e-172 485 69 0 313 3 bioB Biotin synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q481G0 1.53e-171 483 66 2 340 3 bioB Biotin synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q88A98 1.54e-171 483 66 3 345 3 bioB Biotin synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q21FY3 1.93e-171 483 65 1 339 3 bioB Biotin synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A1RIK5 1.38e-170 481 66 2 340 3 bioB Biotin synthase Shewanella sp. (strain W3-18-1)
A4Y7Y3 1.38e-170 481 66 2 340 3 bioB Biotin synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q1LTL8 5.13e-170 479 65 1 338 3 bioB Biotin synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
A8FX10 2.04e-169 478 63 1 343 3 bioB Biotin synthase Shewanella sediminis (strain HAW-EB3)
Q8EDK6 2.25e-169 478 65 2 340 3 bioB Biotin synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8D2A1 2.53e-169 477 62 2 341 3 bioB Biotin synthase Wigglesworthia glossinidia brevipalpis
A1S5I9 5.29e-169 477 65 2 344 3 bioB Biotin synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A8H3I7 9.65e-169 476 65 2 340 3 bioB Biotin synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TJN8 1.12e-168 476 65 2 340 3 bioB Biotin synthase Shewanella halifaxensis (strain HAW-EB4)
B8CQY2 1.3e-168 476 64 2 340 3 bioB Biotin synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q89AK5 1.66e-168 475 61 0 338 3 bioB Biotin synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
B1KPJ7 2.27e-168 476 63 1 343 3 bioB Biotin synthase Shewanella woodyi (strain ATCC 51908 / MS32)
Q0HTY9 3.87e-168 475 64 2 340 3 bioB Biotin synthase Shewanella sp. (strain MR-7)
Q0HHN7 3.87e-168 475 64 2 340 3 bioB Biotin synthase Shewanella sp. (strain MR-4)
A0KY79 3.87e-168 475 64 2 340 3 bioB Biotin synthase Shewanella sp. (strain ANA-3)
A3QDN8 4.62e-168 474 65 2 341 3 bioB Biotin synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A9KY60 7.23e-168 474 64 2 340 3 bioB Biotin synthase Shewanella baltica (strain OS195)
A6WM55 7.23e-168 474 64 2 340 3 bioB Biotin synthase Shewanella baltica (strain OS185)
A3D3F2 7.23e-168 474 64 2 340 3 bioB Biotin synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAJ2 7.23e-168 474 64 2 340 3 bioB Biotin synthase Shewanella baltica (strain OS223)
Q6LPR2 3.17e-167 473 64 2 351 3 bioB Biotin synthase Photobacterium profundum (strain SS9)
Q5QZ16 4.06e-167 472 64 2 339 3 bioB Biotin synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q2SBD4 2.62e-166 470 66 1 342 3 bioB Biotin synthase Hahella chejuensis (strain KCTC 2396)
Q0VMD0 1.35e-165 469 61 1 346 3 bioB Biotin synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A6W0Y1 2.08e-163 463 63 0 339 3 bioB Biotin synthase Marinomonas sp. (strain MWYL1)
Q3IGS6 9.59e-163 461 63 2 338 3 bioB Biotin synthase Pseudoalteromonas translucida (strain TAC 125)
Q12NN4 6.41e-162 459 63 2 346 3 bioB Biotin synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q084I8 5.8e-161 456 64 2 340 3 bioB Biotin synthase Shewanella frigidimarina (strain NCIMB 400)
Q6FAP9 3.68e-158 449 66 0 319 3 bioB Biotin synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1K9C8 1.47e-157 447 66 0 306 3 bioB Biotin synthase Azoarcus sp. (strain BH72)
B0VCA8 3.14e-157 446 65 0 321 3 bioB Biotin synthase Acinetobacter baumannii (strain AYE)
A3M4U4 3.14e-157 446 65 0 321 3 bioB Biotin synthase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HYX9 3.14e-157 446 65 0 321 3 bioB Biotin synthase Acinetobacter baumannii (strain ACICU)
B7I4I4 3.14e-157 446 65 0 321 3 bioB Biotin synthase Acinetobacter baumannii (strain AB0057)
B7H3S4 3.14e-157 446 65 0 321 3 bioB Biotin synthase Acinetobacter baumannii (strain AB307-0294)
B0VR41 1.45e-156 444 65 0 321 3 bioB Biotin synthase Acinetobacter baumannii (strain SDF)
Q93GG2 5.93e-155 441 65 0 314 3 bioB Biotin synthase Acinetobacter calcoaceticus
Q1QYD5 6.48e-155 442 63 2 343 3 bioB Biotin synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A9CFX5 2.96e-153 437 65 0 311 3 bioB Biotin synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q609V2 4.06e-153 436 64 0 304 3 bioB Biotin synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q3J9D5 1.02e-152 436 64 0 304 3 bioB Biotin synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q8FWG3 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella suis biovar 1 (strain 1330)
A9WYH2 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YBW1 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RL26 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella melitensis biotype 2 (strain ATCC 23457)
A9MBD6 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q577P8 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella abortus biovar 1 (strain 9-941)
Q2YKB8 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella abortus (strain 2308)
B2SBF0 9.63e-152 432 61 0 311 3 bioB Biotin synthase Brucella abortus (strain S19)
A5VUG1 9.95e-152 432 61 0 311 3 bioB Biotin synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B8GTH4 1.6e-151 432 63 1 313 3 bioB Biotin synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
B2UDA1 4.4e-150 429 63 0 308 3 bioB Biotin synthase Ralstonia pickettii (strain 12J)
A9AE44 2.76e-149 426 64 0 306 3 bioB Biotin synthase Burkholderia multivorans (strain ATCC 17616 / 249)
Q5P7M6 5.88e-149 425 64 0 307 3 bioB Biotin synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q4UM45 8.17e-149 424 61 0 307 3 bioB Biotin synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
A1VUJ4 1.54e-148 425 63 0 306 3 bioB Biotin synthase Polaromonas naphthalenivorans (strain CJ2)
A7HP26 2.08e-148 424 63 0 304 3 bioB Biotin synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q2W3L4 6.17e-148 422 64 0 306 3 bioB Biotin synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q8Y2R9 8.94e-148 424 63 0 308 3 bioB Biotin synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q1GZA6 1.48e-147 422 60 0 308 3 bioB Biotin synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
A4JIB7 3.35e-147 421 63 0 308 3 bioB Biotin synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2JKH4 4.05e-147 421 61 0 308 3 bioB Biotin synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0BBD4 8.4e-147 420 63 0 306 3 bioB Biotin synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q12D73 1.36e-146 420 62 0 305 3 bioB2 Biotin synthase 2 Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q1BT34 1.5e-146 419 63 0 306 3 bioB Biotin synthase Burkholderia orbicola (strain AU 1054)
B1JZE1 1.5e-146 419 63 0 306 3 bioB Biotin synthase Burkholderia orbicola (strain MC0-3)
A0KB05 1.5e-146 419 63 0 306 3 bioB Biotin synthase Burkholderia cenocepacia (strain HI2424)
B1YNS2 1.64e-146 419 63 0 306 3 bioB Biotin synthase Burkholderia ambifaria (strain MC40-6)
B4E9L4 1.67e-146 419 63 0 306 3 bioB Biotin synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39CE4 1.91e-146 419 63 0 306 3 bioB Biotin synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q0A5W1 3.81e-146 418 64 0 307 3 bioB Biotin synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q146K5 5.21e-146 419 60 0 310 3 bioB Biotin synthase Paraburkholderia xenovorans (strain LB400)
Q2KWF1 9.9e-146 417 61 0 311 3 bioB Biotin synthase Bordetella avium (strain 197N)
B2SWS5 2.14e-145 417 60 0 310 3 bioB Biotin synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q47IF6 2.29e-145 416 63 0 306 3 bioB Biotin synthase Dechloromonas aromatica (strain RCB)
Q3JWR8 4.22e-145 416 60 0 305 3 bioB Biotin synthase Burkholderia pseudomallei (strain 1710b)
A3N520 1.05e-144 415 59 0 311 3 bioB Biotin synthase Burkholderia pseudomallei (strain 668)
A1V817 1.05e-144 415 59 0 311 3 bioB Biotin synthase Burkholderia mallei (strain SAVP1)
Q62MW9 1.05e-144 415 59 0 311 3 bioB Biotin synthase Burkholderia mallei (strain ATCC 23344)
A2S7R3 1.05e-144 415 59 0 311 3 bioB Biotin synthase Burkholderia mallei (strain NCTC 10229)
A3MNG1 1.05e-144 415 59 0 311 3 bioB Biotin synthase Burkholderia mallei (strain NCTC 10247)
Q2T1Q4 1.44e-144 414 60 0 306 3 bioB Biotin synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63Y25 2.3e-144 414 60 0 305 3 bioB Biotin synthase Burkholderia pseudomallei (strain K96243)
A3NQS1 2.3e-144 414 60 0 305 3 bioB Biotin synthase Burkholderia pseudomallei (strain 1106a)
Q82SL7 3.94e-144 413 60 0 306 3 bioB Biotin synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A5FZN9 1.09e-143 412 64 0 287 3 bioB Biotin synthase Acidiphilium cryptum (strain JF-5)
Q31E55 1.34e-143 412 57 2 334 3 bioB Biotin synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9CNP8 1.7e-143 412 60 0 311 3 bioB Biotin synthase Pasteurella multocida (strain Pm70)
A6X2S8 2.97e-143 411 61 0 309 3 bioB Biotin synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8PDF0 9.3e-143 410 57 1 326 3 bioB Biotin synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RMR2 9.3e-143 410 57 1 326 3 bioB Biotin synthase Xanthomonas campestris pv. campestris (strain B100)
Q4UZN8 9.3e-143 410 57 1 326 3 bioB Biotin synthase Xanthomonas campestris pv. campestris (strain 8004)
B1Y502 9.95e-143 410 62 1 314 3 bioB Biotin synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q3BYM9 4.39e-142 409 58 1 326 3 bioB Biotin synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q8PQD7 9.96e-142 407 58 1 326 3 bioB Biotin synthase Xanthomonas axonopodis pv. citri (strain 306)
Q1MRA1 1.02e-141 406 59 0 304 3 bioB Biotin synthase Lawsonia intracellularis (strain PHE/MN1-00)
Q87F85 1.06e-141 407 58 2 331 3 bioB Biotin synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I672 1.06e-141 407 58 2 331 3 bioB Biotin synthase Xylella fastidiosa (strain M23)
Q1LS73 1.16e-141 407 62 0 307 3 bioB Biotin synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A4G1F1 1.41e-141 407 58 0 305 3 bioB Biotin synthase Herminiimonas arsenicoxydans
Q9PH80 1.79e-141 407 58 2 331 3 bioB Biotin synthase Xylella fastidiosa (strain 9a5c)
B0U2A0 2.13e-141 407 58 2 331 3 bioB Biotin synthase Xylella fastidiosa (strain M12)
Q7WB85 3.55e-141 406 60 0 316 3 bioB Biotin synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMQ3 3.55e-141 406 60 0 316 3 bioB Biotin synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9AMS7 3.56e-141 405 59 1 307 3 bioB Biotin synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1B656 6.55e-141 404 61 0 304 3 bioB2 Biotin synthase 2 Paracoccus denitrificans (strain Pd 1222)
Q7VVF1 9.29e-141 405 60 0 316 3 bioB Biotin synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q0I355 9.32e-141 405 59 0 310 3 bioB Biotin synthase Histophilus somni (strain 129Pt)
Q83CU5 1.07e-140 404 58 0 306 3 bioB Biotin synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NCS0 1.07e-140 404 58 0 306 3 bioB Biotin synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KG71 1.07e-140 404 58 0 306 3 bioB Biotin synthase Coxiella burnetii (strain Dugway 5J108-111)
B6J074 1.07e-140 404 58 0 306 3 bioB Biotin synthase Coxiella burnetii (strain CbuG_Q212)
B6J725 1.07e-140 404 58 0 306 3 bioB Biotin synthase Coxiella burnetii (strain CbuK_Q154)
B0UUK6 2.1e-140 404 59 0 310 3 bioB Biotin synthase Histophilus somni (strain 2336)
A6SU66 2.4e-140 404 57 0 305 3 bioB Biotin synthase Janthinobacterium sp. (strain Marseille)
A3MYI9 2.63e-140 404 60 0 310 3 bioB Biotin synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q138Z3 2.75e-140 404 61 1 307 3 bioB Biotin synthase Rhodopseudomonas palustris (strain BisB5)
Q2IUT3 3.69e-140 404 60 1 307 3 bioB Biotin synthase Rhodopseudomonas palustris (strain HaA2)
Q5H5R1 3.91e-140 404 57 1 326 3 bioB Biotin synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SS67 3.91e-140 404 57 1 326 3 bioB Biotin synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P8F3 3.91e-140 404 57 1 326 3 bioB Biotin synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
A5CWW0 4.04e-140 402 60 0 305 3 bioB Biotin synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
P44987 4.51e-140 403 59 0 311 3 bioB Biotin synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UD65 4.51e-140 403 59 0 311 3 bioB Biotin synthase Haemophilus influenzae (strain PittEE)
Q4QLQ0 4.51e-140 403 59 0 311 3 bioB Biotin synthase Haemophilus influenzae (strain 86-028NP)
B0BS22 4.54e-140 403 60 0 310 3 bioB Biotin synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZV8 4.54e-140 403 60 0 310 3 bioB Biotin synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A1AWE7 4.92e-140 402 59 0 310 3 bioB Biotin synthase Ruthia magnifica subsp. Calyptogena magnifica
A6VNF1 5.61e-140 403 60 0 307 3 bioB Biotin synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B2AGA0 1.02e-139 402 61 0 308 3 bioB Biotin synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
B4SM81 1.53e-139 402 60 0 311 3 bioB Biotin synthase Stenotrophomonas maltophilia (strain R551-3)
B3QCX3 2.26e-139 401 62 1 307 3 bioB Biotin synthase Rhodopseudomonas palustris (strain TIE-1)
Q6N859 2.26e-139 401 62 1 307 3 bioB Biotin synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q5FPC9 2.72e-139 401 60 0 306 3 bioB Biotin synthase Gluconobacter oxydans (strain 621H)
Q477A1 2.91e-139 401 62 0 308 3 bioB Biotin synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
B2FLM4 2.97e-139 401 60 0 311 3 bioB Biotin synthase Stenotrophomonas maltophilia (strain K279a)
Q0KF86 3.33e-139 401 61 0 307 3 bioB Biotin synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q21W43 5.04e-139 401 60 0 295 3 bioB Biotin synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q9JRW7 5.16e-139 401 60 0 310 3 bioB1 Biotin synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0AE72 6.49e-139 400 58 0 307 3 bioB Biotin synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q7VMH0 8.18e-139 400 59 0 310 3 bioB Biotin synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
B8F6C9 1.23e-138 399 59 0 310 3 bioB Biotin synthase Glaesserella parasuis serovar 5 (strain SH0165)
Q2Y9Y9 1.52e-138 399 60 0 308 3 bioB Biotin synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q65SD0 2.08e-138 399 59 0 310 3 bioB Biotin synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q1QRH1 2.12e-138 399 60 1 305 3 bioB Biotin synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
A1KU01 3.68e-138 399 60 0 310 3 bioB Biotin synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A1IRY3 3.72e-138 399 59 0 310 3 bioB Biotin synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B4RLI6 4.74e-138 399 59 0 310 3 bioB Biotin synthase Neisseria gonorrhoeae (strain NCCP11945)
Q5F8G2 4.74e-138 399 59 0 310 3 bioB Biotin synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q12F39 9.72e-138 397 59 0 306 3 bioB1 Biotin synthase 1 Polaromonas sp. (strain JS666 / ATCC BAA-500)
B5ELR8 1.4e-137 396 59 0 304 3 bioB Biotin synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J403 1.4e-137 396 59 0 304 3 bioB Biotin synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
B8H640 2.37e-137 396 59 1 311 3 bioB Biotin synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A2N5 2.37e-137 396 59 1 311 3 bioB Biotin synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A9LZ69 2.93e-137 396 60 0 310 3 bioB Biotin synthase Neisseria meningitidis serogroup C (strain 053442)
A9I023 8.79e-137 395 60 0 307 3 bioB Biotin synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A5IBW2 9.86e-137 394 57 0 306 3 bioB Biotin synthase Legionella pneumophila (strain Corby)
Q5WW97 1.3e-136 394 57 0 306 3 bioB Biotin synthase Legionella pneumophila (strain Lens)
Q5ZVG8 1.4e-136 393 57 0 306 3 bioB Biotin synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X592 1.4e-136 393 57 0 306 3 bioB Biotin synthase Legionella pneumophila (strain Paris)
A5EFG5 1.54e-136 395 60 1 306 3 bioB Biotin synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q5PA14 2.23e-136 393 57 0 317 3 bioB Biotin synthase Anaplasma marginale (strain St. Maries)
B9KGM2 2.23e-136 393 57 0 317 3 bioB Biotin synthase Anaplasma marginale (strain Florida)
Q3SLY0 3.19e-136 392 59 0 308 3 bioB Biotin synthase Thiobacillus denitrificans (strain ATCC 25259)
Q07PI4 3.95e-136 393 62 1 306 3 bioB Biotin synthase Rhodopseudomonas palustris (strain BisA53)
A9HRF2 6.69e-136 392 60 1 306 3 bioB Biotin synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
A2SGQ6 7.26e-136 392 59 0 307 3 bioB Biotin synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A7IEC3 9.08e-136 392 59 1 305 3 bioB Biotin synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q2GAF7 2.78e-135 392 60 1 312 3 bioB Biotin synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q1GTT5 3.2e-135 390 60 1 312 3 bioB Biotin synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A4YQS3 3.57e-135 390 60 1 305 3 bioB Biotin synthase Bradyrhizobium sp. (strain ORS 278)
Q0BUV5 5.91e-135 389 63 0 304 3 bioB Biotin synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B6JDD7 1.31e-134 390 59 1 305 3 bioB Biotin synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q2NB65 4.96e-134 388 59 1 311 3 bioB Biotin synthase Erythrobacter litoralis (strain HTCC2594)
A5UIF3 6.86e-134 387 58 0 311 3 bioB Biotin synthase Haemophilus influenzae (strain PittGG)
B0T1Y4 1.34e-133 387 57 1 310 3 bioB Biotin synthase Caulobacter sp. (strain K31)
Q7NPW1 2.69e-133 385 58 0 306 3 bioB Biotin synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A1WVM7 3.77e-133 385 59 0 288 3 bioB Biotin synthase Halorhodospira halophila (strain DSM 244 / SL1)
A9C2R2 5.71e-133 385 58 0 311 3 bioB Biotin synthase Delftia acidovorans (strain DSM 14801 / SPH-1)
A1B1Z0 7.31e-133 384 57 1 306 3 bioB1 Biotin synthase 1 Paracoccus denitrificans (strain Pd 1222)
Q3SW30 9.07e-133 385 57 1 314 3 bioB Biotin synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q0ATN3 3.11e-132 383 57 0 310 3 bioB Biotin synthase Maricaulis maris (strain MCS10)
B4RBP5 1.11e-131 382 58 0 306 3 bioB Biotin synthase Phenylobacterium zucineum (strain HLK1)
Q2GDF4 1.43e-131 381 57 0 297 3 bioB Biotin synthase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
A5WHI6 2.3e-131 382 57 3 305 3 bioB Biotin synthase Psychrobacter sp. (strain PRwf-1)
A4SV63 1.05e-130 380 59 0 304 3 bioB Biotin synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
Q212A8 1.22e-130 380 61 1 307 3 bioB Biotin synthase Rhodopseudomonas palustris (strain BisB18)
Q4FQJ9 3.27e-130 380 55 2 315 3 bioB Biotin synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A1W7J6 4.74e-130 378 57 0 304 3 bioB Biotin synthase Acidovorax sp. (strain JS42)
B9MJH4 1.85e-129 377 56 0 304 3 bioB Biotin synthase Acidovorax ebreus (strain TPSY)
A5VAC6 3.83e-129 375 58 1 312 3 bioB Biotin synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q1Q8S6 4.28e-129 377 55 2 311 3 bioB Biotin synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
A1TQ53 1.88e-128 374 56 0 305 3 bioB Biotin synthase Paracidovorax citrulli (strain AAC00-1)
P94966 4.62e-128 372 57 3 308 3 bioB Biotin synthase Methylobacillus sp. (strain KT1)
Q1DCV9 7.79e-127 370 58 2 309 3 bioB Biotin synthase Myxococcus xanthus (strain DK1622)
B8IU36 4.58e-126 367 59 3 308 3 bioB Biotin synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
B0U811 1.05e-125 366 58 2 306 3 bioB Biotin synthase Methylobacterium sp. (strain 4-46)
Q2GLB4 1.17e-125 366 55 0 304 3 bioB Biotin synthase Anaplasma phagocytophilum (strain HZ)
B9KM96 2.42e-125 365 57 1 306 3 bioB Biotin synthase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
Q3J561 4e-125 365 57 1 306 3 bioB Biotin synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q2GHB1 1.02e-124 363 53 0 304 3 bioB Biotin synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q5HAN0 2.76e-124 362 53 0 304 3 bioB Biotin synthase Ehrlichia ruminantium (strain Welgevonden)
A3PH74 4.04e-124 362 56 1 306 3 bioB Biotin synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q5FFY2 4.57e-124 362 53 0 304 3 bioB Biotin synthase Ehrlichia ruminantium (strain Gardel)
A9EXH2 1.52e-123 362 56 2 309 3 bioB Biotin synthase Sorangium cellulosum (strain So ce56)
B1ZFX7 1.59e-123 361 58 3 308 3 bioB Biotin synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
A9W8M8 1.6e-123 361 58 2 306 3 bioB Biotin synthase Methylorubrum extorquens (strain PA1)
B7KN34 1.6e-123 361 58 2 306 3 bioB Biotin synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q11S94 2.32e-123 361 55 2 316 3 bioB Biotin synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q3YRG6 2.51e-123 360 53 0 307 3 bioB Biotin synthase Ehrlichia canis (strain Jake)
A0M7A9 9.5e-123 360 54 1 309 3 bioB Biotin synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q0C661 2.95e-122 357 52 0 305 3 bioB Biotin synthase Hyphomonas neptunium (strain ATCC 15444)
P54967 9.57e-122 358 54 1 322 1 BIO2 Biotin synthase, mitochondrial Arabidopsis thaliana
B1LV19 2.01e-121 356 60 3 293 3 bioB Biotin synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
A6GW77 6.39e-121 355 52 3 318 3 bioB Biotin synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A8IJU8 1.24e-120 353 58 1 301 3 bioB Biotin synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q5N332 5.73e-120 351 54 1 304 3 bioB Biotin synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31R68 5.73e-120 351 54 1 304 3 bioB Biotin synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A5FLT1 1.43e-119 352 52 1 311 3 bioB Biotin synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
B2J914 2.3e-119 350 53 5 334 3 bioB Biotin synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
O59778 2.86e-118 348 52 2 308 1 bio2 Biotin synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q3M4U9 1.79e-117 345 54 3 309 3 bioB Biotin synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8YVQ3 1.18e-116 343 54 3 309 3 bioB Biotin synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B9JYY6 1.44e-115 340 51 2 309 3 bioB Biotin synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
Q5NRD6 3.14e-115 340 53 1 308 3 bioB Biotin synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A9BB12 1.73e-114 338 52 2 306 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9211)
B9J9I5 2.03e-114 338 53 3 315 3 bioB Biotin synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A5GLZ1 2.07e-114 337 52 2 307 3 bioB Biotin synthase Synechococcus sp. (strain WH7803)
A2BRS2 2.96e-114 337 51 2 306 3 bioB Biotin synthase Prochlorococcus marinus (strain AS9601)
Q31AD2 3.1e-114 337 51 2 306 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9312)
Q7NDA8 3.55e-114 337 53 2 309 3 bioB Biotin synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q46K32 6.54e-114 337 50 1 305 3 bioB Biotin synthase Prochlorococcus marinus (strain NATL2A)
Q5LN74 2.27e-113 335 56 2 305 3 bioB Biotin synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A2C3I4 2.44e-113 335 50 1 305 3 bioB Biotin synthase Prochlorococcus marinus (strain NATL1A)
A8G5G3 1.6e-112 333 50 2 306 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9215)
Q7V6T8 2.45e-112 333 52 3 310 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9313)
A2C8D5 2.7e-112 332 52 3 310 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9303)
A3PDJ8 4.81e-112 332 51 2 306 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9301)
Q5AYI7 8.33e-112 333 51 1 310 2 bioB Biotin synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q5NGB2 9.71e-112 330 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HR4 9.71e-112 330 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. tularensis (strain FSC 198)
A4IXP5 1.85e-111 330 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
A0Q638 1.85e-111 330 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. novicida (strain U112)
B2SGE3 4.67e-111 328 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q0BLD5 8.97e-111 328 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A2V9 8.97e-111 328 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NCW7 8.97e-111 328 50 2 306 3 bioB Biotin synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B0U0S3 4.41e-110 326 50 2 306 3 bioB Biotin synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
B2IEZ6 4e-109 324 51 3 306 3 bioB Biotin synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q0IBC8 5.28e-109 324 52 2 314 3 bioB Biotin synthase Synechococcus sp. (strain CC9311)
P32451 2.78e-108 324 50 4 315 1 BIO2 Biotin synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B8EMZ5 5.94e-108 321 52 2 308 3 bioB Biotin synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
Q7VBJ0 2.64e-107 320 51 1 306 3 bioB Biotin synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q2JRI4 1.58e-106 317 53 1 305 3 bioB Biotin synthase Synechococcus sp. (strain JA-3-3Ab)
Q9Z6L5 1.81e-105 315 49 2 309 3 bioB Biotin synthase Chlamydia pneumoniae
Q7U7P8 7.42e-105 313 51 3 307 3 bioB Biotin synthase Parasynechococcus marenigrum (strain WH8102)
A2BX80 9.66e-105 313 50 2 305 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9515)
Q3AX82 1.92e-104 312 50 3 314 3 bioB Biotin synthase Synechococcus sp. (strain CC9902)
A5GS37 3.02e-104 311 52 5 304 3 bioB Biotin synthase Synechococcus sp. (strain RCC307)
Q7V101 6.63e-104 311 50 2 305 3 bioB Biotin synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q5L5F9 1.41e-102 308 48 3 316 3 bioB Biotin synthase Chlamydia abortus (strain DSM 27085 / S26/3)
Q3AJ51 1.43e-102 308 49 3 314 3 bioB Biotin synthase Synechococcus sp. (strain CC9605)
Q255G8 6.89e-100 301 47 2 309 3 bioB Biotin synthase Chlamydia felis (strain Fe/C-56)
B3DV36 8.26e-85 261 42 2 301 3 bioB Biotin synthase Methylacidiphilum infernorum (isolate V4)
P46396 7.9e-62 203 37 5 298 3 bioB Biotin synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QA10 9.08e-62 203 37 5 298 3 bioB Biotin synthase Corynebacterium glutamicum (strain R)
Q72L21 1.47e-61 202 38 5 286 3 bioB Biotin synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A9A5K6 2.39e-61 202 36 5 307 3 bioB Biotin synthase Nitrosopumilus maritimus (strain SCM1)
Q8FUD1 7.68e-61 201 37 6 286 3 bioB Biotin synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q899M1 9.79e-61 200 33 5 307 3 bioB Biotin synthase Clostridium tetani (strain Massachusetts / E88)
Q5SKN6 2.42e-60 199 38 5 286 3 bioB Biotin synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q7UF84 2.74e-59 197 35 6 308 3 bioB Biotin synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
A7GSD8 5.24e-59 196 33 6 317 3 bioB Biotin synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q9KC26 6.4e-59 196 34 5 314 3 bioB Biotin synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
B0TE53 2.34e-58 194 35 5 288 3 bioB Biotin synthase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B9E2A2 7.89e-58 193 36 4 280 3 bioB Biotin synthase Clostridium kluyveri (strain NBRC 12016)
Q818X3 9.87e-58 192 33 5 302 3 bioB Biotin synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2S4I8 9.93e-58 194 36 4 269 3 bioB Biotin synthase Salinibacter ruber (strain DSM 13855 / M31)
Q3ADP5 1.21e-57 192 35 4 285 3 bioB Biotin synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q6HE51 1.38e-57 192 33 4 295 3 bioB Biotin synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q635G7 1.38e-57 192 33 4 295 3 bioB Biotin synthase Bacillus cereus (strain ZK / E33L)
B7JLW9 1.38e-57 192 33 4 295 3 bioB Biotin synthase Bacillus cereus (strain AH820)
Q81MB3 1.38e-57 192 33 4 295 3 bioB Biotin synthase Bacillus anthracis
Q30XZ5 2.01e-57 192 34 5 307 3 bioB Biotin synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B9IWX7 2.91e-57 191 33 5 302 3 bioB Biotin synthase Bacillus cereus (strain Q1)
B7HNN1 2.91e-57 191 33 5 302 3 bioB Biotin synthase Bacillus cereus (strain AH187)
A0RIB6 3.68e-57 191 33 4 295 3 bioB Biotin synthase Bacillus thuringiensis (strain Al Hakam)
B7IWM8 4.46e-57 191 33 5 302 3 bioB Biotin synthase Bacillus cereus (strain G9842)
Q731I2 4.51e-57 191 33 5 302 3 bioB Biotin synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
B9KBR9 8.33e-57 189 35 5 273 3 bioB Biotin synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q6NKC7 9.05e-57 191 35 5 283 3 bioB1 Biotin synthase 1 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
A5D4Y6 1.19e-56 189 34 6 310 3 bioB Biotin synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B7HAY7 1.53e-56 189 33 5 302 3 bioB Biotin synthase Bacillus cereus (strain B4264)
Q8KZM7 1.6e-56 190 34 6 311 3 bioB Biotin synthase Bacillus subtilis subsp. natto
A4J1M3 1.89e-56 189 34 5 298 3 bioB Biotin synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A4X585 2.05e-56 189 33 6 310 3 bioB Biotin synthase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A7Z5B2 2.14e-56 189 34 5 311 3 bioB Biotin synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q70JZ1 2.14e-56 189 34 5 311 3 bioB Biotin synthase Bacillus amyloliquefaciens
P53557 2.31e-56 189 34 6 311 3 bioB Biotin synthase Bacillus subtilis (strain 168)
A9VG53 2.69e-56 189 33 5 302 3 bioB Biotin synthase Bacillus mycoides (strain KBAB4)
Q65MK9 2.71e-56 189 33 6 312 3 bioB Biotin synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8REU0 3.49e-56 189 35 6 300 3 bioB Biotin synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
B1W5F4 3.89e-56 191 35 6 334 3 bioB Biotin synthase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A0QX70 4.37e-56 189 34 6 300 3 bioB Biotin synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q0RD46 6.77e-56 189 33 5 299 3 bioB Biotin synthase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
A8LUR1 7.64e-56 188 33 6 312 3 bioB Biotin synthase Salinispora arenicola (strain CNS-205)
O67104 7.76e-56 188 33 6 295 3 bioB Biotin synthase Aquifex aeolicus (strain VF5)
Q740Q9 8.82e-56 188 34 5 290 3 bioB Biotin synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QHJ1 1.03e-55 188 34 6 293 3 bioB Biotin synthase Mycobacterium avium (strain 104)
P9WPQ7 1.33e-55 187 33 6 300 1 bioB Biotin synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ6 1.33e-55 187 33 6 300 3 bioB Biotin synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5WMR0 1.33e-55 187 33 6 300 3 bioB Biotin synthase Mycobacterium tuberculosis (strain F11)
A5U2U5 1.33e-55 187 33 6 300 3 bioB Biotin synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KJ05 1.33e-55 187 33 6 300 3 bioB Biotin synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A507 1.33e-55 187 33 6 300 3 bioB Biotin synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P19206 1.37e-55 187 35 4 283 1 bioB Biotin synthase Lysinibacillus sphaericus
Q2J6H8 2.34e-55 187 33 5 306 3 bioB1 Biotin synthase 1 Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B5YK85 4.46e-55 185 32 4 294 3 bioB Biotin synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A0LTP8 8.73e-55 185 35 7 293 3 bioB Biotin synthase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A4T9L9 1.23e-54 185 33 6 300 3 bioB Biotin synthase Mycolicibacterium gilvum (strain PYR-GCK)
B2V8G9 1.4e-54 184 32 6 309 3 bioB Biotin synthase Sulfurihydrogenibium sp. (strain YO3AOP1)
B1MBZ3 1.43e-54 185 33 6 300 3 bioB Biotin synthase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q8DL38 1.57e-54 185 35 7 309 3 bioB Biotin synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q4JWG3 2e-54 185 33 6 302 3 bioB Biotin synthase Corynebacterium jeikeium (strain K411)
A0L3M0 2.74e-54 183 33 6 299 3 bioB Biotin synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q5KZN1 3.54e-54 184 33 5 309 3 bioB Biotin synthase Geobacillus kaustophilus (strain HTA426)
A5IK57 3.56e-54 182 35 5 272 3 bioB Biotin synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
P46715 5.51e-54 183 32 6 300 3 bioB Biotin synthase Mycobacterium leprae (strain TN)
B8ZR86 5.51e-54 183 32 6 300 3 bioB Biotin synthase Mycobacterium leprae (strain Br4923)
A1T8V0 6.3e-54 183 33 5 282 3 bioB Biotin synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B7GKT8 8.41e-54 182 33 5 304 3 bioB Biotin synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
Q5YYR3 9.95e-54 182 34 5 279 3 bioB Biotin synthase Nocardia farcinica (strain IFM 10152)
Q9FCC3 1.09e-53 184 36 6 311 3 bioB Biotin synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B1I4G4 1.16e-53 182 32 5 308 3 bioB Biotin synthase Desulforudis audaxviator (strain MP104C)
B5ECN1 1.55e-53 182 34 5 291 3 bioB Biotin synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B9DKN5 2.28e-53 181 33 8 311 3 bioB Biotin synthase Staphylococcus carnosus (strain TM300)
B0SLQ3 2.6e-53 182 37 5 270 3 bioB Biotin synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDC5 2.6e-53 182 37 5 270 3 bioB Biotin synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B0CC69 2.63e-53 182 35 5 295 3 bioB Biotin synthase Acaryochloris marina (strain MBIC 11017)
A3DBD3 2.74e-53 181 33 4 273 3 bioB Biotin synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
A7I1A0 3.21e-53 181 33 6 310 3 bioB Biotin synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
A4IN84 5.35e-53 181 32 5 307 3 bioB Biotin synthase Geobacillus thermodenitrificans (strain NG80-2)
Q826T2 7.09e-53 182 36 5 302 3 bioB Biotin synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
B9M305 1.14e-52 179 33 4 292 3 bioB Biotin synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q8CQB3 2.53e-52 178 33 8 311 3 bioB Biotin synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A0PYU9 2.62e-52 178 32 5 301 3 bioB Biotin synthase Clostridium novyi (strain NT)
B1HRT3 2.93e-52 178 33 4 283 3 bioB Biotin synthase Lysinibacillus sphaericus (strain C3-41)
Q6NHL3 3.18e-52 178 33 6 304 3 bioB2 Biotin synthase 2 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q0SHW6 3.36e-52 179 32 5 279 3 bioB Biotin synthase Rhodococcus jostii (strain RHA1)
B1WTI3 4.42e-52 179 32 8 321 3 bioB Biotin synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q5HKJ7 4.75e-52 177 33 8 311 3 bioB Biotin synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GE08 4.78e-52 178 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain MRSA252)
C0QVM0 5.32e-52 178 30 6 310 3 bioB Biotin synthase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q4L9U7 7.36e-52 177 34 7 306 3 bioB Biotin synthase Staphylococcus haemolyticus (strain JCSC1435)
A8YYH5 7.63e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain USA300 / TCH1516)
A6QJR4 7.63e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain Newman)
Q5HDC9 7.63e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain COL)
Q2FVJ7 7.63e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FE72 7.63e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain USA300)
Q7A018 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain MW2)
Q6G6P6 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain MSSA476)
Q7A3R9 7.97e-52 177 33 7 294 1 bioB Biotin synthase Staphylococcus aureus (strain N315)
Q99RK7 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YVY6 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IVK5 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain JH9)
A6U4F5 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain JH1)
A7X669 7.97e-52 177 33 7 294 3 bioB Biotin synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A0PP05 8.23e-52 178 32 7 303 3 bioB Biotin synthase Mycobacterium ulcerans (strain Agy99)
B2HQ93 1.37e-51 177 32 7 303 3 bioB Biotin synthase Mycobacterium marinum (strain ATCC BAA-535 / M)
P73538 1.63e-51 177 34 7 286 3 bioB Biotin synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q1B7F4 2.27e-51 176 34 5 282 3 bioB Biotin synthase Mycobacterium sp. (strain MCS)
A1UHL9 2.27e-51 176 34 5 282 3 bioB Biotin synthase Mycobacterium sp. (strain KMS)
A3Q142 2.27e-51 176 34 5 282 3 bioB Biotin synthase Mycobacterium sp. (strain JLS)
Q8XK59 3.31e-51 175 32 6 309 3 bioB Biotin synthase Clostridium perfringens (strain 13 / Type A)
A0RW96 3.75e-51 175 33 4 304 3 bioB Biotin synthase Cenarchaeum symbiosum (strain A)
Q2LY09 5.23e-51 175 33 4 289 3 bioB Biotin synthase Syntrophus aciditrophicus (strain SB)
A1SM80 5.44e-51 176 34 4 273 3 bioB Biotin synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
B1XNE1 5.56e-51 176 34 6 279 3 bioB Biotin synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q3INU3 8.39e-51 176 32 7 318 3 bioB Biotin synthase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q6A7V7 9.17e-51 175 33 6 300 3 bioB Biotin synthase Cutibacterium acnes (strain DSM 16379 / KPA171202)
B2UNW0 1.65e-50 174 33 4 290 3 bioB Biotin synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
B1VF77 2.46e-50 174 33 7 312 3 bioB Biotin synthase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
A4FIS6 2.62e-50 174 32 5 296 3 bioB Biotin synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q74CT7 3.43e-50 173 33 4 291 3 bioB Biotin synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q0TQ59 3.49e-50 173 32 6 310 3 bioB Biotin synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q10YQ3 4.21e-50 174 34 7 299 3 bioB Biotin synthase Trichodesmium erythraeum (strain IMS101)
Q8E197 4.55e-50 173 33 4 289 3 bioB Biotin synthase Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K2Q5 4.55e-50 173 33 4 289 3 bioB Biotin synthase Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8E6Q1 4.84e-50 172 33 4 289 3 bioB Biotin synthase Streptococcus agalactiae serotype III (strain NEM316)
B9EA22 4.84e-50 172 32 7 306 3 bioB Biotin synthase Macrococcus caseolyticus (strain JCSC5402)
B7K1U3 5.87e-50 174 35 6 296 3 bioB Biotin synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
B2GLQ7 7.11e-50 176 33 6 304 3 bioB Biotin synthase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
B8HPP0 9.26e-50 173 35 6 298 3 bioB Biotin synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
A1AN77 1.2e-49 172 32 4 295 3 bioB Biotin synthase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q2J5A7 1.4e-49 172 35 4 279 3 bioB2 Biotin synthase 2 Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q6AK48 1.71e-49 171 34 6 293 3 bioB Biotin synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02970
Feature type CDS
Gene bioB
Product biotin synthase BioB
Location 655074 - 656111 (strand: 1)
Length 1038 (nucleotides) / 345 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1537
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04055 Radical SAM superfamily
PF06968 Biotin and Thiamin Synthesis associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0502 Coenzyme transport and metabolism (H) H Biotin synthase or related enzyme

Kegg Ortholog Annotation(s)

Protein Sequence

MSTLKRWTLKEARALFDMPFLDLVFQAQQVHRQHFDPSQIQVSTLLSIKTGACPEDCKYCAQSARYKTGLEKERLMEVQQVIESAKKAKAAGSTRFCMGAAWRNPHERDMPYLEQMVKEVKALGMETCMTLGKLDDSQASRLAQAGLDFYNHNLDTSPEFYGSIITTRTYQDRLDTLDKVRNAGIKVCSGGILGLGEEVKDRAAMLVQLANLPQPPESVPINMLAKIKGTPLADNEDVDPFDFIRTIAVARIMMPRSYVRLSAGREQMSEQTQAFCFMAGANSIFYGCKLLTTTNPTEDKDHQLFRKLGLNPERLSVSMGDQQQEDVLLQAVAEKDTEQFYNAAL

Flanking regions ( +/- flanking 50bp)

ATAACCCTATTATTTAAACTGGCAATCACTTTTGAACAGGAGAATGTATTGTGAGTACGTTAAAACGTTGGACATTAAAAGAAGCTAGGGCACTGTTTGATATGCCATTTTTAGATTTGGTTTTTCAAGCGCAACAAGTGCATCGTCAACATTTTGATCCTTCACAAATTCAAGTCAGCACCTTACTGTCGATAAAAACAGGCGCTTGTCCTGAAGATTGTAAATATTGTGCCCAAAGTGCGCGCTATAAAACAGGGTTAGAAAAAGAGCGCTTAATGGAAGTACAACAAGTGATTGAATCAGCCAAAAAAGCAAAAGCAGCTGGTTCAACCCGTTTTTGTATGGGCGCGGCTTGGCGTAATCCACATGAGCGTGATATGCCTTATCTTGAGCAGATGGTCAAAGAAGTGAAAGCGCTAGGTATGGAAACCTGTATGACATTGGGTAAGCTTGATGATTCACAAGCCTCACGCTTAGCACAAGCCGGACTGGATTTTTATAACCATAATCTTGATACATCACCTGAGTTTTACGGCAGCATTATTACCACCCGGACATATCAAGACCGTTTAGATACCTTAGATAAAGTACGTAATGCTGGCATTAAAGTGTGCTCTGGAGGCATTTTAGGTTTAGGGGAAGAGGTCAAAGATAGAGCCGCTATGTTAGTGCAATTAGCTAACTTACCGCAACCGCCGGAAAGTGTACCTATCAATATGTTAGCCAAAATTAAAGGTACGCCACTGGCTGATAATGAAGATGTCGATCCCTTTGATTTTATTCGGACTATTGCTGTTGCTCGTATTATGATGCCTCGCTCTTATGTGCGACTTTCAGCAGGGCGTGAACAAATGAGTGAACAAACGCAAGCATTCTGTTTTATGGCTGGCGCAAACTCCATTTTTTATGGTTGCAAATTATTAACGACCACGAATCCCACTGAAGATAAAGATCACCAATTATTCCGTAAGCTTGGTTTAAATCCTGAAAGATTATCTGTCTCAATGGGCGATCAGCAACAAGAAGACGTGTTGCTACAAGCTGTTGCTGAAAAAGACACCGAACAATTTTATAACGCGGCACTGTAATGAGTTGGCAAAACTATCTAGATAAGCGACTTAATGAGCGTAGAAATACG