Homologs in group_1490

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_09620 FBDBKF_09620 91.6 Morganella morganii S1 bioB biotin synthase BioB
EHELCC_04420 EHELCC_04420 91.6 Morganella morganii S2 bioB biotin synthase BioB
NLDBIP_04420 NLDBIP_04420 91.6 Morganella morganii S4 bioB biotin synthase BioB
LHKJJB_14210 LHKJJB_14210 91.6 Morganella morganii S3 bioB biotin synthase BioB
HKOGLL_12325 HKOGLL_12325 91.6 Morganella morganii S5 bioB biotin synthase BioB
PMI_RS02970 PMI_RS02970 78.6 Proteus mirabilis HI4320 bioB biotin synthase BioB

Distribution of the homologs in the orthogroup group_1490

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1490

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4ESU3 0.0 592 78 0 345 3 bioB Biotin synthase Proteus mirabilis (strain HI4320)
Q7N6Q7 0.0 587 77 0 345 3 bioB Biotin synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P36569 0.0 564 75 0 344 3 bioB Biotin synthase Serratia marcescens
Q47862 0.0 558 74 0 344 3 bioB Biotin synthase Pseudescherichia vulneris
Q3Z409 0.0 557 74 0 344 3 bioB Biotin synthase Shigella sonnei (strain Ss046)
B1LM66 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli (strain SMS-3-5 / SECEC)
B7NA74 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P12996 0.0 557 74 0 344 1 bioB Biotin synthase Escherichia coli (strain K12)
B1IXJ3 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZY31 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli O9:H4 (strain HS)
B1X7A5 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli (strain K12 / DH10B)
B7M747 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli O8 (strain IAI1)
B7NNK5 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LC57 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli (strain 55989 / EAEC)
B7ULX2 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJI4 0.0 557 74 0 344 3 bioB Biotin synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
B1JSS4 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66D67 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TNQ6 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pestis (strain Pestoides F)
Q1CFQ3 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R3C8 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pestis bv. Antiqua (strain Angola)
Q7CH65 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pestis
B2K8T0 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C947 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FKM9 0.0 556 73 0 345 3 bioB Biotin synthase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B6I7S9 0.0 556 73 0 344 3 bioB Biotin synthase Escherichia coli (strain SE11)
Q32I44 0.0 555 73 0 344 3 bioB Biotin synthase Shigella dysenteriae serotype 1 (strain Sd197)
A6T6L5 0.0 555 74 0 344 3 bioB Biotin synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q1REF5 0.0 555 73 0 344 3 bioB Biotin synthase Escherichia coli (strain UTI89 / UPEC)
Q8FJQ3 0.0 555 73 0 344 3 bioB Biotin synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A1A917 0.0 555 73 0 344 3 bioB Biotin synthase Escherichia coli O1:K1 / APEC
B7MQM8 0.0 555 73 0 344 3 bioB Biotin synthase Escherichia coli O81 (strain ED1a)
B7MGN3 0.0 555 73 0 344 3 bioB Biotin synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
Q83S46 0.0 555 73 0 344 3 bioB Biotin synthase Shigella flexneri
Q0T6I5 0.0 555 73 0 344 3 bioB Biotin synthase Shigella flexneri serotype 5b (strain 8401)
B7LJY8 0.0 555 73 0 344 3 bioB Biotin synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A7MJ03 0.0 555 74 0 344 3 bioB Biotin synthase Cronobacter sakazakii (strain ATCC BAA-894)
B5XZ75 0.0 555 74 0 344 3 bioB Biotin synthase Klebsiella pneumoniae (strain 342)
B5YRL4 0.0 554 73 0 344 3 bioB Biotin synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X825 0.0 554 73 0 344 3 bioB Biotin synthase Escherichia coli O157:H7
Q324B7 0.0 553 73 0 344 3 bioB Biotin synthase Shigella boydii serotype 4 (strain Sb227)
B2TVF5 0.0 553 73 0 344 3 bioB Biotin synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q6D3B9 0.0 553 73 0 345 3 bioB Biotin synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8AJ12 0.0 553 73 0 344 3 bioB Biotin synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A1JS69 0.0 553 73 1 349 3 bioB Biotin synthase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0TJS3 0.0 552 73 0 344 3 bioB Biotin synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8Z893 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella typhi
B4TQT9 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella schwarzengrund (strain CVM19633)
B5BC31 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella paratyphi A (strain AKU_12601)
Q5PG48 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TC48 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella heidelberg (strain SL476)
B5QX65 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella enteritidis PT4 (strain P125109)
B5FP61 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella dublin (strain CT_02021853)
B5F072 0.0 550 73 0 344 3 bioB Biotin synthase Salmonella agona (strain SL483)
A8GBC5 0.0 550 73 0 345 3 bioB Biotin synthase Serratia proteamaculans (strain 568)
P12678 0.0 549 73 0 344 3 bioB Biotin synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PWY2 0.0 549 73 0 344 3 bioB Biotin synthase Salmonella paratyphi C (strain RKS4594)
A9MTI8 0.0 549 73 0 344 3 bioB Biotin synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4SZJ7 0.0 549 73 0 344 3 bioB Biotin synthase Salmonella newport (strain SL254)
Q2NUJ7 0.0 548 74 0 344 3 bioB Biotin synthase Sodalis glossinidius (strain morsitans)
B5R761 0.0 548 73 0 344 3 bioB Biotin synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57RG3 0.0 546 73 0 344 3 bioB Biotin synthase Salmonella choleraesuis (strain SC-B67)
A9MJE6 0.0 545 72 0 344 3 bioB Biotin synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A4W8B7 0.0 539 72 0 344 3 bioB Biotin synthase Enterobacter sp. (strain 638)
B2VBT9 0.0 536 73 0 339 3 bioB Biotin synthase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
A0KIC6 0.0 516 70 2 342 3 bioB Biotin synthase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SPR7 0.0 512 69 2 342 3 bioB Biotin synthase Aeromonas salmonicida (strain A449)
Q15SR5 1.84e-178 501 68 2 344 3 bioB Biotin synthase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B5EUQ0 4e-176 495 66 1 333 3 bioB Biotin synthase Aliivibrio fischeri (strain MJ11)
B1WN69 5.44e-176 494 66 1 333 3 bioB Biotin synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87QN6 5.24e-175 492 65 2 351 3 bioB Biotin synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A1U4B2 7.99e-175 492 71 0 310 3 bioB Biotin synthase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
B6ESC7 1.65e-174 491 66 1 333 3 bioB Biotin synthase Aliivibrio salmonicida (strain LFI1238)
A1SW31 1.73e-174 491 68 0 321 3 bioB Biotin synthase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9KSZ4 2.51e-174 490 66 2 351 3 bioB Biotin synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F2H3 2.51e-174 490 66 2 351 3 bioB Biotin synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B7VH16 2.68e-174 490 64 2 351 3 bioB Biotin synthase Vibrio atlanticus (strain LGP32)
A7MX36 4.63e-174 490 65 2 351 3 bioB Biotin synthase Vibrio campbellii (strain ATCC BAA-1116)
Q7MLV0 1.38e-173 488 65 2 351 3 bioB Biotin synthase Vibrio vulnificus (strain YJ016)
Q8D8M9 1.38e-173 488 65 2 351 3 bioB Biotin synthase Vibrio vulnificus (strain CMCP6)
B4S0P9 2.43e-173 489 70 0 310 3 bioB Biotin synthase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
A4XZR9 3.23e-173 488 65 2 345 3 bioB Biotin synthase Pseudomonas mendocina (strain ymp)
Q8K9P1 3.35e-173 487 63 2 346 3 bioB Biotin synthase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B3PI87 4.05e-173 488 66 1 342 3 bioB Biotin synthase Cellvibrio japonicus (strain Ueda107)
A4VR88 4.61e-172 485 65 2 343 3 bioB Biotin synthase Stutzerimonas stutzeri (strain A1501)
Q8D2A1 1.02e-171 483 63 2 346 3 bioB Biotin synthase Wigglesworthia glossinidia brevipalpis
B0KJ53 1.25e-171 484 65 2 342 3 bioB Biotin synthase Pseudomonas putida (strain GB-1)
Q88QX2 1.76e-171 483 65 2 342 3 bioB Biotin synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4K4T2 1.93e-171 483 65 2 343 3 bioB Biotin synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q9I618 2.02e-171 483 66 2 342 3 bioB Biotin synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V485 2.02e-171 483 66 2 342 3 bioB Biotin synthase Pseudomonas aeruginosa (strain LESB58)
B1JE55 5.36e-171 482 65 2 342 3 bioB Biotin synthase Pseudomonas putida (strain W619)
Q3K5P1 1.18e-170 481 65 2 343 3 bioB Biotin synthase Pseudomonas fluorescens (strain Pf0-1)
Q5QZ16 1.19e-170 481 64 2 342 3 bioB Biotin synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
B1KPJ7 1.46e-170 481 65 1 346 3 bioB Biotin synthase Shewanella woodyi (strain ATCC 51908 / MS32)
A5VXF1 1.67e-170 481 65 2 342 3 bioB Biotin synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q02TR6 1.77e-170 481 65 2 342 3 bioB Biotin synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6UYW0 3.8e-170 480 65 2 342 3 bioB Biotin synthase Pseudomonas aeruginosa (strain PA7)
Q1I3N6 4.79e-170 479 65 2 342 3 bioB Biotin synthase Pseudomonas entomophila (strain L48)
A8FX10 1.02e-169 479 64 3 351 3 bioB Biotin synthase Shewanella sediminis (strain HAW-EB3)
Q21FY3 1.07e-169 479 64 2 349 3 bioB Biotin synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q481G0 1.45e-169 478 65 2 343 3 bioB Biotin synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
B8D983 3.81e-169 477 61 1 342 3 bioB Biotin synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8CQY2 8.28e-169 476 64 3 347 3 bioB Biotin synthase Shewanella piezotolerans (strain WP3 / JCM 13877)
Q48CS1 8.61e-169 476 64 0 341 3 bioB Biotin synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B8D7I5 1.16e-168 476 61 1 342 3 bioB Biotin synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
P57378 1.4e-168 476 61 1 342 3 bioB Biotin synthase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
A1RIK5 2.76e-168 475 65 2 343 3 bioB Biotin synthase Shewanella sp. (strain W3-18-1)
A4Y7Y3 2.76e-168 475 65 2 343 3 bioB Biotin synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q4ZMA8 3e-168 475 64 0 341 3 bioB Biotin synthase Pseudomonas syringae pv. syringae (strain B728a)
A8H3I7 6e-168 474 64 3 347 3 bioB Biotin synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3QDN8 8.71e-168 474 66 3 350 3 bioB Biotin synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A1S5I9 1.2e-167 474 64 2 347 3 bioB Biotin synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B0TJN8 1.49e-167 473 64 3 347 3 bioB Biotin synthase Shewanella halifaxensis (strain HAW-EB4)
Q8EDK6 1.66e-167 473 65 2 343 3 bioB Biotin synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q88A98 1.95e-167 473 64 0 341 3 bioB Biotin synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A9KY60 4.7e-167 472 64 3 347 3 bioB Biotin synthase Shewanella baltica (strain OS195)
A6WM55 4.7e-167 472 64 3 347 3 bioB Biotin synthase Shewanella baltica (strain OS185)
A3D3F2 4.7e-167 472 64 3 347 3 bioB Biotin synthase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EAJ2 4.7e-167 472 64 3 347 3 bioB Biotin synthase Shewanella baltica (strain OS223)
Q6LPR2 1.07e-166 471 66 1 334 3 bioB Biotin synthase Photobacterium profundum (strain SS9)
Q0HTY9 1.16e-166 471 64 2 343 3 bioB Biotin synthase Shewanella sp. (strain MR-7)
Q0HHN7 1.16e-166 471 64 2 343 3 bioB Biotin synthase Shewanella sp. (strain MR-4)
A0KY79 1.16e-166 471 64 2 343 3 bioB Biotin synthase Shewanella sp. (strain ANA-3)
Q2SBD4 3.16e-164 465 65 1 345 3 bioB Biotin synthase Hahella chejuensis (strain KCTC 2396)
Q89AK5 1.53e-163 463 60 0 340 3 bioB Biotin synthase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q0VMD0 2.01e-162 461 62 1 346 3 bioB Biotin synthase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q084I8 1.27e-161 458 63 3 347 3 bioB Biotin synthase Shewanella frigidimarina (strain NCIMB 400)
Q1LTL8 8.51e-161 456 66 0 313 3 bioB Biotin synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q3IGS6 2.9e-160 454 61 2 341 3 bioB Biotin synthase Pseudoalteromonas translucida (strain TAC 125)
Q12NN4 6.14e-160 454 63 3 349 3 bioB Biotin synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
A6W0Y1 2.47e-155 442 64 0 310 3 bioB Biotin synthase Marinomonas sp. (strain MWYL1)
B8GTH4 7.02e-151 431 65 0 307 3 bioB Biotin synthase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q609V2 9.73e-151 430 63 0 308 3 bioB Biotin synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1QYD5 2.4e-149 428 62 2 346 3 bioB Biotin synthase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
B0VCA8 9.58e-149 425 62 0 313 3 bioB Biotin synthase Acinetobacter baumannii (strain AYE)
A3M4U4 9.58e-149 425 62 0 313 3 bioB Biotin synthase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2HYX9 9.58e-149 425 62 0 313 3 bioB Biotin synthase Acinetobacter baumannii (strain ACICU)
B7I4I4 9.58e-149 425 62 0 313 3 bioB Biotin synthase Acinetobacter baumannii (strain AB0057)
B7H3S4 9.58e-149 425 62 0 313 3 bioB Biotin synthase Acinetobacter baumannii (strain AB307-0294)
Q3J9D5 1.79e-148 425 60 1 332 3 bioB Biotin synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B0VR41 4.06e-148 423 61 0 313 3 bioB Biotin synthase Acinetobacter baumannii (strain SDF)
A9CFX5 8.46e-148 423 65 0 303 3 bioB Biotin synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q6FAP9 1.54e-147 422 61 0 313 3 bioB Biotin synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
A1K9C8 2.7e-147 421 62 0 308 3 bioB Biotin synthase Azoarcus sp. (strain BH72)
Q93GG2 2.87e-147 421 61 0 313 3 bioB Biotin synthase Acinetobacter calcoaceticus
B2UDA1 1.34e-146 421 62 0 308 3 bioB Biotin synthase Ralstonia pickettii (strain 12J)
Q1GZA6 5.11e-146 418 62 0 306 3 bioB Biotin synthase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
B2JKH4 1.34e-145 417 61 0 309 3 bioB Biotin synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q0A5W1 3.04e-145 416 64 0 320 3 bioB Biotin synthase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A7HP26 8.63e-145 415 60 0 323 3 bioB Biotin synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
Q5P7M6 1.36e-144 414 63 0 308 3 bioB Biotin synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8Y2R9 3.65e-144 414 58 1 329 3 bioB Biotin synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A9AE44 1.4e-143 412 63 0 307 3 bioB Biotin synthase Burkholderia multivorans (strain ATCC 17616 / 249)
Q146K5 4.32e-143 412 60 0 309 3 bioB Biotin synthase Paraburkholderia xenovorans (strain LB400)
Q1BT34 6.56e-143 410 62 0 307 3 bioB Biotin synthase Burkholderia orbicola (strain AU 1054)
B1JZE1 6.56e-143 410 62 0 307 3 bioB Biotin synthase Burkholderia orbicola (strain MC0-3)
A0KB05 6.56e-143 410 62 0 307 3 bioB Biotin synthase Burkholderia cenocepacia (strain HI2424)
B4E9L4 1.06e-142 410 62 0 307 3 bioB Biotin synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
A1VUJ4 1.61e-142 410 61 0 307 3 bioB Biotin synthase Polaromonas naphthalenivorans (strain CJ2)
Q39CE4 2.47e-142 409 62 0 307 3 bioB Biotin synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B2SWS5 3.68e-142 409 60 0 309 3 bioB Biotin synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
B1YNS2 3.94e-142 408 62 0 307 3 bioB Biotin synthase Burkholderia ambifaria (strain MC40-6)
A5VUG1 4.74e-142 408 59 0 308 3 bioB Biotin synthase Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8FWG3 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella suis biovar 1 (strain 1330)
A9WYH2 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella suis (strain ATCC 23445 / NCTC 10510)
Q8YBW1 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RL26 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella melitensis biotype 2 (strain ATCC 23457)
A9MBD6 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q577P8 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella abortus biovar 1 (strain 9-941)
Q2YKB8 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella abortus (strain 2308)
B2SBF0 5e-142 408 59 0 308 3 bioB Biotin synthase Brucella abortus (strain S19)
A4JIB7 6.3e-142 408 62 0 307 3 bioB Biotin synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0BBD4 8.01e-142 407 62 0 307 3 bioB Biotin synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A3N520 2.08e-141 406 60 0 306 3 bioB Biotin synthase Burkholderia pseudomallei (strain 668)
A1V817 2.08e-141 406 60 0 306 3 bioB Biotin synthase Burkholderia mallei (strain SAVP1)
Q62MW9 2.08e-141 406 60 0 306 3 bioB Biotin synthase Burkholderia mallei (strain ATCC 23344)
A2S7R3 2.08e-141 406 60 0 306 3 bioB Biotin synthase Burkholderia mallei (strain NCTC 10229)
A3MNG1 2.08e-141 406 60 0 306 3 bioB Biotin synthase Burkholderia mallei (strain NCTC 10247)
Q8PDF0 2.44e-141 407 56 0 325 3 bioB Biotin synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RMR2 2.44e-141 407 56 0 325 3 bioB Biotin synthase Xanthomonas campestris pv. campestris (strain B100)
Q4UZN8 2.44e-141 407 56 0 325 3 bioB Biotin synthase Xanthomonas campestris pv. campestris (strain 8004)
Q2T1Q4 2.48e-141 406 60 0 306 3 bioB Biotin synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2W3L4 3.64e-141 405 61 0 308 3 bioB Biotin synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q63Y25 4.15e-141 405 60 0 305 3 bioB Biotin synthase Burkholderia pseudomallei (strain K96243)
A3NQS1 4.15e-141 405 60 0 305 3 bioB Biotin synthase Burkholderia pseudomallei (strain 1106a)
Q2KWF1 4.26e-141 405 60 0 310 3 bioB Biotin synthase Bordetella avium (strain 197N)
Q4UM45 1.06e-140 404 59 0 306 3 bioB Biotin synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q47IF6 1.17e-140 404 61 0 307 3 bioB Biotin synthase Dechloromonas aromatica (strain RCB)
Q3BYM9 2.1e-140 404 56 0 332 3 bioB Biotin synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q3JWR8 2.54e-140 404 60 0 305 3 bioB Biotin synthase Burkholderia pseudomallei (strain 1710b)
Q12D73 2.88e-140 404 60 0 309 3 bioB2 Biotin synthase 2 Polaromonas sp. (strain JS666 / ATCC BAA-500)
B4SM81 3.23e-140 404 57 1 335 3 bioB Biotin synthase Stenotrophomonas maltophilia (strain R551-3)
Q8PQD7 4.56e-140 403 56 0 332 3 bioB Biotin synthase Xanthomonas axonopodis pv. citri (strain 306)
B2FLM4 5.46e-140 403 57 1 335 3 bioB Biotin synthase Stenotrophomonas maltophilia (strain K279a)
A5FZN9 6.23e-140 402 64 0 288 3 bioB Biotin synthase Acidiphilium cryptum (strain JF-5)
Q5H5R1 2.37e-139 402 56 0 332 3 bioB Biotin synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SS67 2.37e-139 402 56 0 332 3 bioB Biotin synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P8F3 2.37e-139 402 56 0 332 3 bioB Biotin synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q31E55 3.84e-139 401 58 1 309 3 bioB Biotin synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q82SL7 3.96e-139 400 59 0 305 3 bioB Biotin synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
A4G1F1 4.24e-139 400 57 0 312 3 bioB Biotin synthase Herminiimonas arsenicoxydans
A5CWW0 6.78e-139 399 59 0 311 3 bioB Biotin synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q5FPC9 7.45e-139 400 62 0 308 3 bioB Biotin synthase Gluconobacter oxydans (strain 621H)
A1AWE7 1.46e-138 399 59 0 313 3 bioB Biotin synthase Ruthia magnifica subsp. Calyptogena magnifica
A6X2S8 2.62e-138 399 58 0 314 3 bioB Biotin synthase Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B1Y502 2.97e-138 399 63 0 297 3 bioB Biotin synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q9AMS7 6.63e-138 397 60 1 308 3 bioB Biotin synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
B0U2A0 7.62e-138 397 57 0 321 3 bioB Biotin synthase Xylella fastidiosa (strain M12)
Q87F85 9.9e-138 397 59 0 308 3 bioB Biotin synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I672 9.9e-138 397 59 0 308 3 bioB Biotin synthase Xylella fastidiosa (strain M23)
Q9PH80 1.22e-137 397 57 0 321 3 bioB Biotin synthase Xylella fastidiosa (strain 9a5c)
A6SU66 1.88e-137 397 56 0 312 3 bioB Biotin synthase Janthinobacterium sp. (strain Marseille)
Q83CU5 2.36e-137 395 57 0 307 3 bioB Biotin synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NCS0 2.36e-137 395 57 0 307 3 bioB Biotin synthase Coxiella burnetii (strain RSA 331 / Henzerling II)
A9KG71 2.36e-137 395 57 0 307 3 bioB Biotin synthase Coxiella burnetii (strain Dugway 5J108-111)
B6J074 2.36e-137 395 57 0 307 3 bioB Biotin synthase Coxiella burnetii (strain CbuG_Q212)
B6J725 2.36e-137 395 57 0 307 3 bioB Biotin synthase Coxiella burnetii (strain CbuK_Q154)
B5ELR8 3.69e-137 395 59 0 301 3 bioB Biotin synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J403 3.69e-137 395 59 0 301 3 bioB Biotin synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q1LS73 5.73e-137 395 61 0 308 3 bioB Biotin synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7WB85 6.07e-137 395 59 0 315 3 bioB Biotin synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WMQ3 6.07e-137 395 59 0 315 3 bioB Biotin synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A1B656 9.85e-137 394 57 1 318 3 bioB2 Biotin synthase 2 Paracoccus denitrificans (strain Pd 1222)
Q1MRA1 1.15e-136 394 56 0 309 3 bioB Biotin synthase Lawsonia intracellularis (strain PHE/MN1-00)
Q1QRH1 1.77e-136 394 59 1 309 3 bioB Biotin synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q7VVF1 2.28e-136 394 59 0 315 3 bioB Biotin synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
B2AGA0 1.08e-135 392 61 0 309 3 bioB Biotin synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q12F39 1.88e-135 391 59 0 312 3 bioB1 Biotin synthase 1 Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q21W43 2.64e-135 391 60 0 295 3 bioB Biotin synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q0KF86 5.49e-135 390 61 0 308 3 bioB Biotin synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2IUT3 6.57e-135 390 59 2 317 3 bioB Biotin synthase Rhodopseudomonas palustris (strain HaA2)
A9HRF2 7.9e-135 389 61 1 308 3 bioB Biotin synthase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q138Z3 9.15e-135 390 60 1 308 3 bioB Biotin synthase Rhodopseudomonas palustris (strain BisB5)
Q2Y9Y9 1.16e-134 389 60 0 306 3 bioB Biotin synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q477A1 1.37e-134 389 60 0 309 3 bioB Biotin synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q0AE72 1.85e-134 389 57 0 305 3 bioB Biotin synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
B8H640 2.58e-134 389 58 1 315 3 bioB Biotin synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A2N5 2.58e-134 389 58 1 315 3 bioB Biotin synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A4YQS3 4.75e-134 388 59 1 308 3 bioB Biotin synthase Bradyrhizobium sp. (strain ORS 278)
A5EFG5 5.87e-134 388 58 1 308 3 bioB Biotin synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
B3QCX3 1.47e-133 387 61 1 308 3 bioB Biotin synthase Rhodopseudomonas palustris (strain TIE-1)
Q6N859 1.47e-133 387 61 1 308 3 bioB Biotin synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A7IEC3 3.73e-133 386 58 1 312 3 bioB Biotin synthase Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
A9I023 4.31e-133 385 59 0 308 3 bioB Biotin synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A3MYI9 1.08e-132 384 58 0 304 3 bioB Biotin synthase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q0BUV5 1.47e-132 383 62 0 311 3 bioB Biotin synthase Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B0BS22 1.87e-132 384 58 0 304 3 bioB Biotin synthase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZV8 1.87e-132 384 58 0 304 3 bioB Biotin synthase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q5ZVG8 2.05e-132 383 56 0 307 3 bioB Biotin synthase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X592 2.05e-132 383 56 0 307 3 bioB Biotin synthase Legionella pneumophila (strain Paris)
A5IBW2 2.5e-132 382 56 0 310 3 bioB Biotin synthase Legionella pneumophila (strain Corby)
B0T1Y4 3.43e-132 383 57 1 312 3 bioB Biotin synthase Caulobacter sp. (strain K31)
Q2NB65 5.74e-132 383 57 1 313 3 bioB Biotin synthase Erythrobacter litoralis (strain HTCC2594)
A6VNF1 1.17e-131 382 57 0 307 3 bioB Biotin synthase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q5WW97 1.27e-131 381 56 0 307 3 bioB Biotin synthase Legionella pneumophila (strain Lens)
Q7NPW1 1.3e-131 381 58 0 308 3 bioB Biotin synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
P44987 1.67e-131 381 56 0 307 3 bioB Biotin synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A5UD65 1.67e-131 381 56 0 307 3 bioB Biotin synthase Haemophilus influenzae (strain PittEE)
Q4QLQ0 1.67e-131 381 56 0 307 3 bioB Biotin synthase Haemophilus influenzae (strain 86-028NP)
Q9CNP8 1.75e-131 381 55 0 307 3 bioB Biotin synthase Pasteurella multocida (strain Pm70)
Q0I355 1.94e-131 381 56 0 307 3 bioB Biotin synthase Histophilus somni (strain 129Pt)
B0UUK6 2.59e-131 380 55 0 307 3 bioB Biotin synthase Histophilus somni (strain 2336)
Q07PI4 4.65e-131 380 59 2 319 3 bioB Biotin synthase Rhodopseudomonas palustris (strain BisA53)
Q65SD0 1.7e-130 379 55 0 307 3 bioB Biotin synthase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B4RBP5 2.42e-130 378 58 0 312 3 bioB Biotin synthase Phenylobacterium zucineum (strain HLK1)
B6JDD7 3.87e-130 378 57 1 308 3 bioB Biotin synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q7VMH0 7.73e-130 377 56 0 304 3 bioB Biotin synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q3SW30 1.03e-129 377 57 1 308 3 bioB Biotin synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2GAF7 1.93e-129 377 58 1 314 3 bioB Biotin synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q3SLY0 2.58e-129 375 58 0 302 3 bioB Biotin synthase Thiobacillus denitrificans (strain ATCC 25259)
A2SGQ6 3.14e-129 375 58 0 305 3 bioB Biotin synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1B1Z0 3.51e-129 375 56 1 308 3 bioB1 Biotin synthase 1 Paracoccus denitrificans (strain Pd 1222)
B8F6C9 3.69e-129 375 56 0 304 3 bioB Biotin synthase Glaesserella parasuis serovar 5 (strain SH0165)
A9C2R2 9.99e-129 375 55 0 313 3 bioB Biotin synthase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q1GTT5 2.39e-128 373 58 1 314 3 bioB Biotin synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
Q0ATN3 3e-128 373 56 0 308 3 bioB Biotin synthase Maricaulis maris (strain MCS10)
A1W7J6 7.91e-128 372 56 0 305 3 bioB Biotin synthase Acidovorax sp. (strain JS42)
Q1DCV9 9.17e-128 372 60 2 311 3 bioB Biotin synthase Myxococcus xanthus (strain DK1622)
Q5PA14 1.01e-127 371 56 0 307 3 bioB Biotin synthase Anaplasma marginale (strain St. Maries)
B9KGM2 1.01e-127 371 56 0 307 3 bioB Biotin synthase Anaplasma marginale (strain Florida)
B9MJH4 1.12e-127 372 56 0 305 3 bioB Biotin synthase Acidovorax ebreus (strain TPSY)
Q1Q8S6 1.27e-127 373 57 2 305 3 bioB Biotin synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q212A8 3.08e-127 371 59 1 309 3 bioB Biotin synthase Rhodopseudomonas palustris (strain BisB18)
A1IRY3 3.16e-127 371 55 0 306 3 bioB Biotin synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1WVM7 3.2e-127 370 59 0 287 3 bioB Biotin synthase Halorhodospira halophila (strain DSM 244 / SL1)
P94966 4.58e-127 370 58 4 311 3 bioB Biotin synthase Methylobacillus sp. (strain KT1)
Q9JRW7 5.83e-127 370 55 0 306 3 bioB1 Biotin synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9LZ69 7.17e-127 370 55 0 306 3 bioB Biotin synthase Neisseria meningitidis serogroup C (strain 053442)
Q4FQJ9 8.13e-127 371 57 2 305 3 bioB Biotin synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A4SV63 1.39e-126 369 56 0 306 3 bioB Biotin synthase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A1KU01 1.75e-126 369 55 0 306 3 bioB Biotin synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B4RLI6 1.89e-126 369 55 0 306 3 bioB Biotin synthase Neisseria gonorrhoeae (strain NCCP11945)
Q5F8G2 1.89e-126 369 55 0 306 3 bioB Biotin synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A1TQ53 1.51e-125 367 54 1 321 3 bioB Biotin synthase Paracidovorax citrulli (strain AAC00-1)
A5UIF3 3.93e-125 365 55 0 307 3 bioB Biotin synthase Haemophilus influenzae (strain PittGG)
A5WHI6 4.36e-125 366 54 2 307 3 bioB Biotin synthase Psychrobacter sp. (strain PRwf-1)
A0M7A9 9.43e-125 365 54 1 311 3 bioB Biotin synthase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q5HAN0 9.59e-125 363 53 0 310 3 bioB Biotin synthase Ehrlichia ruminantium (strain Welgevonden)
Q5FFY2 9.8e-125 363 53 0 310 3 bioB Biotin synthase Ehrlichia ruminantium (strain Gardel)
Q3YRG6 6.02e-124 362 53 0 308 3 bioB Biotin synthase Ehrlichia canis (strain Jake)
B8IU36 6.87e-124 362 56 3 318 3 bioB Biotin synthase Methylobacterium nodulans (strain LMG 21967 / CNCM I-2342 / ORS 2060)
Q2GDF4 8.45e-124 361 54 0 297 3 bioB Biotin synthase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q2GHB1 2.19e-123 360 52 0 308 3 bioB Biotin synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
A5VAC6 7.14e-123 359 56 1 313 3 bioB Biotin synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A5FLT1 1.32e-122 360 53 1 311 3 bioB Biotin synthase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
Q11S94 2.15e-122 358 54 1 309 3 bioB Biotin synthase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
B0U811 2.51e-122 358 56 2 314 3 bioB Biotin synthase Methylobacterium sp. (strain 4-46)
B1ZFX7 4.24e-122 358 57 3 311 3 bioB Biotin synthase Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
Q2GLB4 1.22e-121 356 54 0 307 3 bioB Biotin synthase Anaplasma phagocytophilum (strain HZ)
A9W8M8 2.31e-121 355 56 2 309 3 bioB Biotin synthase Methylorubrum extorquens (strain PA1)
B7KN34 2.31e-121 355 56 2 309 3 bioB Biotin synthase Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q3J561 5.08e-121 354 57 1 308 3 bioB Biotin synthase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
A3PH74 3.14e-120 352 56 1 308 3 bioB Biotin synthase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
A6GW77 4.03e-120 353 52 2 310 3 bioB Biotin synthase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
A9EXH2 1.34e-119 352 55 2 311 3 bioB Biotin synthase Sorangium cellulosum (strain So ce56)
B9KM96 2.03e-119 350 56 1 308 3 bioB Biotin synthase Cereibacter sphaeroides (strain KD131 / KCTC 12085)
B1LV19 6.03e-119 349 58 3 312 3 bioB Biotin synthase Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1)
Q5N332 4.31e-118 347 53 3 317 3 bioB Biotin synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31R68 4.31e-118 347 53 3 317 3 bioB Biotin synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A8IJU8 1.6e-117 345 58 1 300 3 bioB Biotin synthase Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A5GLZ1 5.1e-117 344 54 2 311 3 bioB Biotin synthase Synechococcus sp. (strain WH7803)
Q0C661 4.49e-116 342 51 0 309 3 bioB Biotin synthase Hyphomonas neptunium (strain ATCC 15444)
B9JYY6 6.56e-116 341 53 2 308 3 bioB Biotin synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
A9BB12 1.02e-115 341 53 2 311 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9211)
B2J914 2.05e-115 340 53 4 314 3 bioB Biotin synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q5NRD6 3e-115 340 54 1 311 3 bioB Biotin synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
O59778 5.56e-115 340 51 2 312 1 bio2 Biotin synthase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P54967 7.08e-115 340 50 1 322 1 BIO2 Biotin synthase, mitochondrial Arabidopsis thaliana
Q5LN74 1.44e-114 338 56 2 308 3 bioB Biotin synthase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A2C3I4 2.68e-114 338 52 1 308 3 bioB Biotin synthase Prochlorococcus marinus (strain NATL1A)
Q46K32 3.88e-114 337 52 1 308 3 bioB Biotin synthase Prochlorococcus marinus (strain NATL2A)
B9J9I5 5.35e-113 334 55 2 308 3 bioB Biotin synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
A2C8D5 3.43e-112 332 50 3 313 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9303)
Q7V6T8 3.66e-112 332 50 3 313 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9313)
A8G5G3 4.76e-112 332 50 2 308 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9215)
Q31AD2 1.09e-111 331 50 2 308 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9312)
Q5NGB2 1.16e-111 330 51 2 309 3 bioB Biotin synthase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HR4 1.16e-111 330 51 2 309 3 bioB Biotin synthase Francisella tularensis subsp. tularensis (strain FSC 198)
A2BRS2 1.38e-111 331 50 2 308 3 bioB Biotin synthase Prochlorococcus marinus (strain AS9601)
A4IXP5 1.79e-111 330 50 2 309 3 bioB Biotin synthase Francisella tularensis subsp. tularensis (strain WY96-3418)
A0Q638 1.79e-111 330 50 2 309 3 bioB Biotin synthase Francisella tularensis subsp. novicida (strain U112)
Q7NDA8 1.92e-111 330 53 2 306 3 bioB Biotin synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q0BLD5 5.15e-111 328 50 2 309 3 bioB Biotin synthase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A2V9 5.15e-111 328 50 2 309 3 bioB Biotin synthase Francisella tularensis subsp. holarctica (strain LVS)
A7NCW7 5.15e-111 328 50 2 309 3 bioB Biotin synthase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
B2SGE3 5.93e-111 328 50 2 309 3 bioB Biotin synthase Francisella tularensis subsp. mediasiatica (strain FSC147)
B8EMZ5 1.71e-110 328 54 2 307 3 bioB Biotin synthase Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)
A3PDJ8 8.89e-110 326 50 2 308 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9301)
B0U0S3 8.95e-110 325 50 2 306 3 bioB Biotin synthase Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q7VBJ0 1.01e-109 326 52 1 308 3 bioB Biotin synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q8YVQ3 3.01e-109 325 49 3 313 3 bioB Biotin synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M4U9 6.74e-109 324 49 3 313 3 bioB Biotin synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5AYI7 1.02e-106 320 46 1 336 2 bioB Biotin synthase, mitochondrial Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q2JRI4 7.48e-106 315 52 1 304 3 bioB Biotin synthase Synechococcus sp. (strain JA-3-3Ab)
B2IEZ6 1.08e-105 315 52 3 309 3 bioB Biotin synthase Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q7U7P8 1.17e-105 315 52 3 311 3 bioB Biotin synthase Parasynechococcus marenigrum (strain WH8102)
Q3AX82 1.23e-105 315 51 3 315 3 bioB Biotin synthase Synechococcus sp. (strain CC9902)
Q3AJ51 1.35e-105 315 52 3 314 3 bioB Biotin synthase Synechococcus sp. (strain CC9605)
A5GS37 1.21e-104 313 54 4 298 3 bioB Biotin synthase Synechococcus sp. (strain RCC307)
Q5L5F9 1.61e-104 313 47 4 330 3 bioB Biotin synthase Chlamydia abortus (strain DSM 27085 / S26/3)
P32451 6.14e-104 313 48 4 314 1 BIO2 Biotin synthase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A2BX80 2.7e-103 310 50 2 308 3 bioB Biotin synthase Prochlorococcus marinus (strain MIT 9515)
Q9Z6L5 6.31e-103 308 46 2 318 3 bioB Biotin synthase Chlamydia pneumoniae
Q7V101 6.38e-103 308 50 2 308 3 bioB Biotin synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0IBC8 1.72e-102 307 50 2 311 3 bioB Biotin synthase Synechococcus sp. (strain CC9311)
Q255G8 1.89e-100 302 46 3 330 3 bioB Biotin synthase Chlamydia felis (strain Fe/C-56)
B3DV36 6.9e-88 270 43 2 301 3 bioB Biotin synthase Methylacidiphilum infernorum (isolate V4)
Q3ADP5 2.08e-63 207 37 3 283 3 bioB Biotin synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A7GSD8 1.41e-62 205 36 4 291 3 bioB Biotin synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q899M1 6.33e-62 203 33 5 306 3 bioB Biotin synthase Clostridium tetani (strain Massachusetts / E88)
Q818X3 2e-61 202 37 7 296 3 bioB Biotin synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6HE51 2.71e-61 202 36 6 293 3 bioB Biotin synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q635G7 2.71e-61 202 36 6 293 3 bioB Biotin synthase Bacillus cereus (strain ZK / E33L)
B7JLW9 2.71e-61 202 36 6 293 3 bioB Biotin synthase Bacillus cereus (strain AH820)
Q81MB3 2.71e-61 202 36 6 293 3 bioB Biotin synthase Bacillus anthracis
B9IWX7 6.19e-61 201 36 7 297 3 bioB Biotin synthase Bacillus cereus (strain Q1)
B7HNN1 6.19e-61 201 36 7 297 3 bioB Biotin synthase Bacillus cereus (strain AH187)
Q731I2 9.01e-61 201 36 7 297 3 bioB Biotin synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
B7IWM8 1e-60 201 36 7 296 3 bioB Biotin synthase Bacillus cereus (strain G9842)
A0RIB6 1.01e-60 200 36 6 293 3 bioB Biotin synthase Bacillus thuringiensis (strain Al Hakam)
A9VG53 1.13e-60 200 37 7 296 3 bioB Biotin synthase Bacillus mycoides (strain KBAB4)
B7HAY7 2.81e-60 199 36 7 296 3 bioB Biotin synthase Bacillus cereus (strain B4264)
Q8FUD1 2.81e-60 199 38 5 273 3 bioB Biotin synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B0TE53 3.01e-60 199 37 3 281 3 bioB Biotin synthase Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
A4QA10 3.92e-60 199 38 5 273 3 bioB Biotin synthase Corynebacterium glutamicum (strain R)
P46396 4.71e-60 199 38 5 273 3 bioB Biotin synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B5YK85 4.81e-60 198 32 4 296 3 bioB Biotin synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A9A5K6 9.61e-59 195 36 3 280 3 bioB Biotin synthase Nitrosopumilus maritimus (strain SCM1)
Q7UF84 1.05e-58 196 37 5 281 3 bioB Biotin synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B9E2A2 2.14e-58 194 36 5 290 3 bioB Biotin synthase Clostridium kluyveri (strain NBRC 12016)
Q8KZM7 4.64e-58 194 35 6 300 3 bioB Biotin synthase Bacillus subtilis subsp. natto
Q9KC26 7.28e-58 193 35 7 322 3 bioB Biotin synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P53557 8.55e-58 193 35 6 300 3 bioB Biotin synthase Bacillus subtilis (strain 168)
B9DKN5 1.29e-57 192 34 8 329 3 bioB Biotin synthase Staphylococcus carnosus (strain TM300)
Q72L21 1.99e-57 192 37 5 286 3 bioB Biotin synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q2S4I8 2.26e-57 192 35 5 294 3 bioB Biotin synthase Salinibacter ruber (strain DSM 13855 / M31)
A3DBD3 2.38e-57 191 34 4 275 3 bioB Biotin synthase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
B9KBR9 2.4e-57 190 38 5 254 3 bioB Biotin synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
Q740Q9 2.51e-57 192 36 5 279 3 bioB Biotin synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P19206 2.82e-57 191 36 5 286 1 bioB Biotin synthase Lysinibacillus sphaericus
A0QHJ1 4.5e-57 191 35 5 279 3 bioB Biotin synthase Mycobacterium avium (strain 104)
B7GKT8 9.79e-57 190 35 5 302 3 bioB Biotin synthase Anoxybacillus flavithermus (strain DSM 21510 / WK1)
P9WPQ7 1.34e-56 190 34 6 297 1 bioB Biotin synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ6 1.34e-56 190 34 6 297 3 bioB Biotin synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5WMR0 1.34e-56 190 34 6 297 3 bioB Biotin synthase Mycobacterium tuberculosis (strain F11)
A5U2U5 1.34e-56 190 34 6 297 3 bioB Biotin synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A1KJ05 1.34e-56 190 34 6 297 3 bioB Biotin synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A507 1.34e-56 190 34 6 297 3 bioB Biotin synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q6NKC7 1.72e-56 190 35 6 297 3 bioB1 Biotin synthase 1 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q0RD46 1.88e-56 190 33 6 327 3 bioB Biotin synthase Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q4L9U7 2.39e-56 189 37 8 308 3 bioB Biotin synthase Staphylococcus haemolyticus (strain JCSC1435)
A0QX70 3.24e-56 189 34 6 297 3 bioB Biotin synthase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q8DL38 3.57e-56 189 36 6 309 3 bioB Biotin synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5SKN6 3.89e-56 188 37 5 286 3 bioB Biotin synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A5IK57 5.35e-56 187 36 6 274 3 bioB Biotin synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
P46715 8.14e-56 188 34 6 297 3 bioB Biotin synthase Mycobacterium leprae (strain TN)
B8ZR86 8.14e-56 188 34 6 297 3 bioB Biotin synthase Mycobacterium leprae (strain Br4923)
A7Z5B2 9.77e-56 188 34 5 296 3 bioB Biotin synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q70JZ1 9.77e-56 188 34 5 296 3 bioB Biotin synthase Bacillus amyloliquefaciens
Q5KZN1 1.16e-55 187 34 5 307 3 bioB Biotin synthase Geobacillus kaustophilus (strain HTA426)
A4T9L9 1.32e-55 187 34 6 297 3 bioB Biotin synthase Mycolicibacterium gilvum (strain PYR-GCK)
B1HRT3 1.39e-55 187 36 5 286 3 bioB Biotin synthase Lysinibacillus sphaericus (strain C3-41)
A0LTP8 1.96e-55 187 36 5 286 3 bioB Biotin synthase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
A1T8V0 3.1e-55 186 34 5 279 3 bioB Biotin synthase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q65MK9 3.13e-55 186 33 6 322 3 bioB Biotin synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
B1MBZ3 3.69e-55 186 34 6 297 3 bioB Biotin synthase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
A5D4Y6 5.56e-55 185 34 5 290 3 bioB Biotin synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q8CQB3 6.51e-55 185 35 8 318 3 bioB Biotin synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5YYR3 8.37e-55 185 33 7 311 3 bioB Biotin synthase Nocardia farcinica (strain IFM 10152)
Q2J6H8 1.49e-54 185 33 5 303 3 bioB1 Biotin synthase 1 Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q4JWG3 2e-54 185 35 5 279 3 bioB Biotin synthase Corynebacterium jeikeium (strain K411)
Q5HKJ7 2.46e-54 184 35 8 308 3 bioB Biotin synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B5ECN1 2.75e-54 184 36 5 292 3 bioB Biotin synthase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
A4X585 2.92e-54 184 35 5 286 3 bioB Biotin synthase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
A4IN84 3.67e-54 183 33 5 307 3 bioB Biotin synthase Geobacillus thermodenitrificans (strain NG80-2)
B2V167 4.04e-54 183 32 4 305 3 bioB Biotin synthase Clostridium botulinum (strain Alaska E43 / Type E3)
Q8REU0 4.06e-54 184 36 6 294 3 bioB Biotin synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q30XZ5 4.41e-54 183 34 5 306 3 bioB Biotin synthase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
B9M305 5.85e-54 183 36 4 291 3 bioB Biotin synthase Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
Q6GE08 1.05e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain MRSA252)
Q7A018 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain MW2)
Q6G6P6 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain MSSA476)
Q7A3R9 1.46e-53 182 33 7 311 1 bioB Biotin synthase Staphylococcus aureus (strain N315)
Q99RK7 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YVY6 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IVK5 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain JH9)
A6U4F5 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain JH1)
A7X669 1.46e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain Mu3 / ATCC 700698)
A8YYH5 1.73e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain USA300 / TCH1516)
A6QJR4 1.73e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain Newman)
Q5HDC9 1.73e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain COL)
Q2FVJ7 1.73e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FE72 1.73e-53 182 33 7 311 3 bioB Biotin synthase Staphylococcus aureus (strain USA300)
A8LUR1 2.2e-53 181 35 5 286 3 bioB Biotin synthase Salinispora arenicola (strain CNS-205)
A0PP05 2.25e-53 182 32 7 311 3 bioB Biotin synthase Mycobacterium ulcerans (strain Agy99)
A7I1A0 2.68e-53 181 35 7 310 3 bioB Biotin synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
B1W5F4 2.79e-53 184 35 5 297 3 bioB Biotin synthase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q0SHW6 3.22e-53 181 33 6 297 3 bioB Biotin synthase Rhodococcus jostii (strain RHA1)
B1VF77 3.3e-53 181 34 7 309 3 bioB Biotin synthase Corynebacterium urealyticum (strain ATCC 43042 / DSM 7109)
B2HQ93 4.16e-53 181 32 6 304 3 bioB Biotin synthase Mycobacterium marinum (strain ATCC BAA-535 / M)
A1SM80 6.24e-53 181 35 4 272 3 bioB Biotin synthase Nocardioides sp. (strain ATCC BAA-499 / JS614)
A0L3M0 1.38e-52 179 34 6 308 3 bioB Biotin synthase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8XK59 1.67e-52 179 32 6 305 3 bioB Biotin synthase Clostridium perfringens (strain 13 / Type A)
A0PYU9 2.28e-52 178 32 6 302 3 bioB Biotin synthase Clostridium novyi (strain NT)
B2UNW0 2.79e-52 178 34 5 296 3 bioB Biotin synthase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q6NHL3 2.83e-52 179 33 6 301 3 bioB2 Biotin synthase 2 Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
O67104 3.46e-52 178 31 6 316 3 bioB Biotin synthase Aquifex aeolicus (strain VF5)
Q9FCC3 4.04e-52 180 36 4 285 3 bioB Biotin synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A0LJA8 5.09e-52 177 33 4 295 3 bioB Biotin synthase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
Q1B7F4 7.26e-52 177 35 5 279 3 bioB Biotin synthase Mycobacterium sp. (strain MCS)
A1UHL9 7.26e-52 177 35 5 279 3 bioB Biotin synthase Mycobacterium sp. (strain KMS)
A3Q142 7.26e-52 177 35 5 279 3 bioB Biotin synthase Mycobacterium sp. (strain JLS)
A4J1M3 8.02e-52 177 32 3 278 3 bioB Biotin synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q2J5A7 8.2e-52 178 36 4 281 3 bioB2 Biotin synthase 2 Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A4FIS6 8.95e-52 178 32 5 292 3 bioB Biotin synthase Saccharopolyspora erythraea (strain ATCC 11635 / DSM 40517 / JCM 4748 / NBRC 13426 / NCIMB 8594 / NRRL 2338)
Q0TQ59 1.2e-51 176 32 6 311 3 bioB Biotin synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B1WTI3 1.24e-51 178 33 6 301 3 bioB Biotin synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
B2TL73 2.42e-51 176 33 5 301 3 bioB Biotin synthase Clostridium botulinum (strain Eklund 17B / Type B)
B9EA22 4.56e-51 175 33 6 293 3 bioB Biotin synthase Macrococcus caseolyticus (strain JCSC5402)
A0RW96 1.12e-50 174 34 4 302 3 bioB Biotin synthase Cenarchaeum symbiosum (strain A)
P73538 1.41e-50 175 35 6 301 3 bioB Biotin synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B7K1U3 1.68e-50 175 36 6 297 3 bioB Biotin synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q826T2 2.03e-50 175 35 5 293 3 bioB Biotin synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A8FGR8 2.65e-50 173 35 5 308 3 bioB Biotin synthase Bacillus pumilus (strain SAFR-032)
B1KW08 4.21e-50 172 32 5 281 3 bioB Biotin synthase Clostridium botulinum (strain Loch Maree / Type A3)
Q18D35 4.3e-50 172 31 3 287 3 bioB Biotin synthase Clostridioides difficile (strain 630)
C0QVM0 5.76e-50 172 32 7 308 3 bioB Biotin synthase Brachyspira hyodysenteriae (strain ATCC 49526 / WA1)
Q3INU3 5.9e-50 174 34 8 310 3 bioB Biotin synthase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
B1I4G4 7.92e-50 172 31 5 308 3 bioB Biotin synthase Desulforudis audaxviator (strain MP104C)
Q10YQ3 1.91e-49 172 35 6 297 3 bioB Biotin synthase Trichodesmium erythraeum (strain IMS101)
Q74CT7 2.16e-49 171 34 4 300 3 bioB Biotin synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B1XNE1 2.25e-49 172 34 6 296 3 bioB Biotin synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
A5I427 2.44e-49 171 32 4 279 3 bioB Biotin synthase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FVS6 2.44e-49 171 32 4 279 3 bioB Biotin synthase Clostridium botulinum (strain ATCC 19397 / Type A)
B0SLQ3 2.53e-49 171 35 5 270 3 bioB Biotin synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / ATCC 23582 / Paris)
B0SDC5 2.53e-49 171 35 5 270 3 bioB Biotin synthase Leptospira biflexa serovar Patoc (strain Patoc 1 / Ames)
B7KFJ9 4.76e-49 171 36 6 297 3 bioB Biotin synthase Gloeothece citriformis (strain PCC 7424)
B0CC69 5.94e-49 170 36 5 277 3 bioB Biotin synthase Acaryochloris marina (strain MBIC 11017)
A7GFJ9 8.03e-49 169 31 4 279 3 bioB Biotin synthase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS00720
Feature type CDS
Gene bioB
Product biotin synthase BioB
Location 150021 - 151058 (strand: 1)
Length 1038 (nucleotides) / 345 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1490
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04055 Radical SAM superfamily
PF06968 Biotin and Thiamin Synthesis associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0502 Coenzyme transport and metabolism (H) H Biotin synthase or related enzyme

Kegg Ortholog Annotation(s)

Protein Sequence

MSHRRQWILKEAKDLFEKPFFELLFEAQTIHRQHFDPQKVQISTLLSIKTGACPEDCKYCAQSARYKTGLEKERLMEVEQVVATARKARAAGSTRFCMGAAWKNPHERDMPYLETMVREVRALGMETCMTLGMLNDSQAARLAEAGLDYYNHNLDTSPEFYGSIVTTRTYQDRLDTLDNVRDAGIKVCSGGILGLGEDVRDRAAMLVQLANLPKAPESVPINMLAKIKGTPFEDNEEVDPFDFVRTIAAARIMMPQSHVRLSAGRELMNEQTQALCFMAGANSIFYGCKLLTTTNPEENTDIQLFRKLGIKREAIHVEQGDQEQSASLLDAISHSDEPQFYNAAL

Flanking regions ( +/- flanking 50bp)

ATAATGATGATATTTAAACTGGCAACACTTTTTTATTGGGAGTTGCCGTTATGAGTCATCGTCGTCAGTGGATACTAAAAGAAGCCAAAGATTTGTTTGAAAAGCCTTTTTTTGAATTATTATTTGAGGCGCAGACAATCCATCGTCAGCATTTTGACCCGCAGAAAGTACAGATCAGTACGTTGCTTTCGATTAAAACCGGTGCCTGTCCGGAAGATTGTAAATACTGTGCGCAGAGTGCGCGATACAAAACCGGGTTGGAAAAAGAGCGCCTGATGGAAGTAGAGCAGGTAGTGGCAACCGCGCGTAAAGCCAGAGCCGCCGGTTCAACCCGGTTTTGCATGGGGGCGGCGTGGAAAAACCCGCACGAGCGCGATATGCCGTATCTGGAAACCATGGTGCGGGAAGTCCGCGCGCTGGGAATGGAAACCTGCATGACACTCGGAATGCTCAATGACTCGCAGGCTGCGCGTCTGGCGGAGGCCGGGCTGGATTATTACAATCATAATCTCGATACCTCGCCGGAATTTTATGGCTCGATTGTCACCACCCGTACGTATCAGGATCGCCTGGATACCCTGGATAACGTGCGCGATGCCGGGATTAAAGTCTGCTCCGGCGGTATTTTAGGGCTGGGTGAAGACGTGCGTGACCGCGCGGCAATGCTGGTTCAGTTGGCAAATCTGCCGAAAGCACCGGAAAGTGTGCCGATCAACATGCTGGCGAAAATCAAAGGAACGCCGTTTGAAGATAACGAAGAGGTTGATCCGTTTGATTTTGTCCGCACCATTGCCGCGGCACGGATAATGATGCCGCAATCTCACGTCCGTCTGTCCGCCGGGCGTGAACTGATGAATGAACAGACCCAGGCACTCTGCTTTATGGCTGGCGCTAATTCCATTTTTTATGGCTGCAAGCTGCTCACCACCACCAATCCGGAAGAAAATACCGATATTCAGTTATTCCGCAAACTGGGGATAAAACGCGAAGCGATTCATGTTGAGCAGGGCGATCAGGAGCAGAGCGCAAGCCTGCTGGATGCTATCAGTCACAGCGACGAACCGCAGTTTTATAACGCAGCACTCTGAACGGCATAATTATCATGTGGCAAACTTTTCTTTCTGAGCGCCTGCAACAG