Homologs in group_1560

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10105 FBDBKF_10105 67.9 Morganella morganii S1 lipB lipoyl(octanoyl) transferase LipB
EHELCC_04905 EHELCC_04905 67.9 Morganella morganii S2 lipB lipoyl(octanoyl) transferase LipB
NLDBIP_04905 NLDBIP_04905 67.9 Morganella morganii S4 lipB lipoyl(octanoyl) transferase LipB
LHKJJB_13725 LHKJJB_13725 67.9 Morganella morganii S3 lipB lipoyl(octanoyl) transferase LipB
HKOGLL_12810 HKOGLL_12810 67.9 Morganella morganii S5 lipB lipoyl(octanoyl) transferase LipB
F4V73_RS00230 F4V73_RS00230 67.3 Morganella psychrotolerans lipB lipoyl(octanoyl) transferase LipB

Distribution of the homologs in the orthogroup group_1560

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1560

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N766 2.65e-114 327 73 0 208 3 lipB Octanoyltransferase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q66DF4 3.93e-104 303 68 0 205 3 lipB Octanoyltransferase Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TP08 3.93e-104 303 68 0 205 3 lipB Octanoyltransferase Yersinia pestis (strain Pestoides F)
Q1CKR5 3.93e-104 303 68 0 205 3 lipB Octanoyltransferase Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZDG9 3.93e-104 303 68 0 205 3 lipB Octanoyltransferase Yersinia pestis
B2K875 3.93e-104 303 68 0 205 3 lipB Octanoyltransferase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C508 3.93e-104 303 68 0 205 3 lipB Octanoyltransferase Yersinia pestis bv. Antiqua (strain Antiqua)
C6DBV7 7.28e-104 301 69 1 205 3 lipB Octanoyltransferase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
A7FKY8 8.75e-104 301 68 0 205 3 lipB Octanoyltransferase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B2VBK0 1.86e-103 300 70 0 201 3 lipB Octanoyltransferase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B1JGB6 2.59e-103 300 68 0 205 3 lipB Octanoyltransferase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
A8GB10 1.34e-101 296 67 0 205 3 lipB Octanoyltransferase Serratia proteamaculans (strain 568)
Q6D7M7 1.36e-101 296 68 1 205 3 lipB Octanoyltransferase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6T691 1.67e-98 288 69 0 192 3 lipB Octanoyltransferase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4W816 1.88e-98 287 72 1 186 3 lipB Octanoyltransferase Enterobacter sp. (strain 638)
A8AJH4 3.11e-98 287 70 1 191 3 lipB Octanoyltransferase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7N9N6 3.43e-98 287 66 1 202 3 lipB Octanoyltransferase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7NLY9 3.43e-98 287 66 1 202 3 lipB Octanoyltransferase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q7UDD0 4.37e-98 286 66 1 202 3 lipB Octanoyltransferase Shigella flexneri
Q0T6P0 4.37e-98 286 66 1 202 3 lipB Octanoyltransferase Shigella flexneri serotype 5b (strain 8401)
Q3Z4G2 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Shigella sonnei (strain Ss046)
Q32IV0 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Shigella dysenteriae serotype 1 (strain Sd197)
Q324R3 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Shigella boydii serotype 4 (strain Sb227)
B2TU88 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1RET2 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli (strain UTI89 / UPEC)
B6I139 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli (strain SE11)
P60720 4.93e-98 286 66 1 202 1 lipB Octanoyltransferase Escherichia coli (strain K12)
B1IYH8 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P60722 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TK43 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A8Q5 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O1:K1 / APEC
A7ZXQ7 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O9:H4 (strain HS)
C4ZWB7 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M5F7 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O8 (strain IAI1)
B7MRR7 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O81 (strain ED1a)
B5YQI1 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60721 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O157:H7
B7MFQ3 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UKS0 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJ18 4.93e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli O139:H28 (strain E24377A / ETEC)
A1JPR8 5.02e-98 287 65 0 205 3 lipB Octanoyltransferase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1LKM1 8.42e-98 286 66 1 202 3 lipB Octanoyltransferase Escherichia coli (strain SMS-3-5 / SECEC)
B5XZS4 2.23e-97 285 68 0 192 3 lipB Octanoyltransferase Klebsiella pneumoniae (strain 342)
B7L9H4 2.36e-97 285 65 1 202 3 lipB Octanoyltransferase Escherichia coli (strain 55989 / EAEC)
Q7MN16 4.72e-94 276 62 0 201 3 lipB Octanoyltransferase Vibrio vulnificus (strain YJ016)
Q8DFD2 5.5e-94 276 62 0 201 3 lipB Octanoyltransferase Vibrio vulnificus (strain CMCP6)
Q8Z8I2 5.59e-94 276 67 1 191 3 lipB Octanoyltransferase Salmonella typhi
Q8ZR03 5.91e-94 276 67 1 191 3 lipB Octanoyltransferase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5PM99 5.91e-94 276 67 1 191 3 lipB Octanoyltransferase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
A5F2Y1 2.6e-93 275 62 1 204 3 lipB Octanoyltransferase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q6LN88 5.63e-93 273 62 0 203 3 lipB Octanoyltransferase Photobacterium profundum (strain SS9)
Q9KTF8 6.03e-93 273 62 1 204 3 lipB Octanoyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87RR0 9.8e-93 273 61 0 201 3 lipB Octanoyltransferase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5QYE6 1.62e-92 273 62 2 204 3 lipB Octanoyltransferase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q65RH6 6.58e-92 271 59 2 214 3 lipB Octanoyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q0I1H7 8.72e-92 271 61 2 210 3 lipB Octanoyltransferase Histophilus somni (strain 129Pt)
Q7VKB0 2.25e-91 270 59 2 211 3 lipB Octanoyltransferase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
A7MY97 2.79e-91 270 61 0 201 3 lipB Octanoyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q2NUV7 7.96e-91 268 67 1 201 3 lipB Octanoyltransferase Sodalis glossinidius (strain morsitans)
Q5E6V8 1.84e-90 268 59 1 211 3 lipB Octanoyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B0UVP8 3.48e-90 266 61 2 210 3 lipB Octanoyltransferase Histophilus somni (strain 2336)
B7VKE7 4.53e-90 266 62 0 200 3 lipB Octanoyltransferase Vibrio atlanticus (strain LGP32)
Q2SA37 2.06e-89 265 57 0 209 3 lipB Octanoyltransferase Hahella chejuensis (strain KCTC 2396)
Q3IJ80 3.5e-89 264 60 0 203 3 lipB Octanoyltransferase Pseudoalteromonas translucida (strain TAC 125)
A5UBB1 5.7e-89 263 60 2 206 3 lipB Octanoyltransferase Haemophilus influenzae (strain PittEE)
Q4QPL7 5.7e-89 263 60 2 206 3 lipB Octanoyltransferase Haemophilus influenzae (strain 86-028NP)
A4SJV7 5.82e-89 264 57 1 206 3 lipB Octanoyltransferase Aeromonas salmonicida (strain A449)
A5UFJ9 7.66e-89 263 60 2 206 3 lipB Octanoyltransferase Haemophilus influenzae (strain PittGG)
A1RGT3 1.17e-88 263 60 0 206 3 lipB Octanoyltransferase Shewanella sp. (strain W3-18-1)
A4Y9G1 1.6e-88 263 60 0 206 3 lipB Octanoyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
P57977 3.12e-88 262 61 2 207 3 lipB Octanoyltransferase Pasteurella multocida (strain Pm70)
Q15VL2 6.85e-88 261 59 0 200 3 lipB Octanoyltransferase Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P44464 9.79e-88 260 59 2 206 3 lipB Octanoyltransferase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0HXV6 2.14e-87 259 60 0 206 3 lipB Octanoyltransferase Shewanella sp. (strain MR-7)
Q0HLK2 2.14e-87 259 60 0 206 3 lipB Octanoyltransferase Shewanella sp. (strain MR-4)
A0KTV5 2.41e-87 259 60 0 206 3 lipB Octanoyltransferase Shewanella sp. (strain ANA-3)
A6VM78 2.5e-87 259 59 3 211 3 lipB Octanoyltransferase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A0KNA1 1.12e-86 258 55 1 210 3 lipB Octanoyltransferase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B8E4W5 2.37e-86 257 59 0 206 3 lipB Octanoyltransferase Shewanella baltica (strain OS223)
A9L013 2.64e-86 257 59 0 206 3 lipB Octanoyltransferase Shewanella baltica (strain OS195)
A6WRL1 2.64e-86 257 59 0 206 3 lipB Octanoyltransferase Shewanella baltica (strain OS185)
A3D7P8 2.64e-86 257 59 0 206 3 lipB Octanoyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q21FD9 4.23e-86 256 66 0 175 3 lipB Octanoyltransferase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q8EHQ5 5.27e-86 256 59 0 206 3 lipB Octanoyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q57RU1 8e-86 254 68 0 170 3 lipB Octanoyltransferase Salmonella choleraesuis (strain SC-B67)
B1KDX2 8.44e-86 256 57 0 206 3 lipB Octanoyltransferase Shewanella woodyi (strain ATCC 51908 / MS32)
Q087L4 1.79e-85 254 58 0 206 3 lipB Octanoyltransferase Shewanella frigidimarina (strain NCIMB 400)
Q1I4G0 2.23e-85 254 61 0 201 3 lipB Octanoyltransferase Pseudomonas entomophila (strain L48)
A8H7D4 5.65e-85 253 59 0 203 3 lipB Octanoyltransferase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
B0TR56 6.59e-85 253 59 0 203 3 lipB Octanoyltransferase Shewanella halifaxensis (strain HAW-EB4)
B0KJX5 6.65e-85 253 60 0 201 3 lipB Octanoyltransferase Pseudomonas putida (strain GB-1)
B3PKN9 8.74e-85 253 61 1 197 3 lipB Octanoyltransferase Cellvibrio japonicus (strain Ueda107)
A8FZ22 1.18e-84 253 57 0 206 3 lipB Octanoyltransferase Shewanella sediminis (strain HAW-EB3)
B0BRS0 1.52e-84 253 57 2 211 3 lipB Octanoyltransferase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3H2J1 1.65e-84 252 57 2 211 3 lipB Octanoyltransferase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N2P2 1.65e-84 252 57 2 211 3 lipB Octanoyltransferase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B8CSH6 1.82e-84 252 58 0 203 3 lipB Octanoyltransferase Shewanella piezotolerans (strain WP3 / JCM 13877)
B1J143 2.12e-84 252 60 0 201 3 lipB Octanoyltransferase Pseudomonas putida (strain W619)
A1S8U0 2.17e-84 252 59 2 207 3 lipB Octanoyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A3QH59 2.58e-84 252 58 0 206 3 lipB Octanoyltransferase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q484R7 7.1e-84 251 57 0 199 3 lipB Octanoyltransferase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q88DM4 2.22e-83 249 60 0 201 3 lipB Octanoyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A5W9I6 2.68e-83 249 60 0 201 3 lipB Octanoyltransferase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A4VQZ7 2.61e-82 247 59 0 202 3 lipB Octanoyltransferase Stutzerimonas stutzeri (strain A1501)
A1SZ16 3.1e-82 246 57 0 203 3 lipB Octanoyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
C1DMR0 4.45e-82 246 59 1 202 3 lipB Octanoyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A1U3B4 5.06e-82 246 55 0 199 3 lipB Octanoyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4ZN83 1.22e-81 245 58 0 204 3 lipB Octanoyltransferase Pseudomonas syringae pv. syringae (strain B728a)
Q4K5G9 1.3e-81 245 59 0 205 3 lipB Octanoyltransferase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1LTM4 1.55e-81 245 59 3 202 3 lipB Octanoyltransferase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q12QX0 5.27e-81 244 57 0 203 3 lipB Octanoyltransferase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q48DM5 8.32e-81 243 59 0 201 3 lipB Octanoyltransferase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A4XYX4 1.05e-80 242 57 1 201 3 lipB Octanoyltransferase Pseudomonas mendocina (strain ymp)
A6VZ75 1.73e-80 242 58 0 200 3 lipB Octanoyltransferase Marinomonas sp. (strain MWYL1)
Q9X6V9 1.81e-80 242 57 0 202 3 lipB Octanoyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02SG4 1.81e-80 242 57 0 202 3 lipB Octanoyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7V8B6 1.81e-80 242 57 0 202 3 lipB Octanoyltransferase Pseudomonas aeruginosa (strain LESB58)
A6V0B3 1.81e-80 242 57 0 202 3 lipB Octanoyltransferase Pseudomonas aeruginosa (strain PA7)
Q3K6A3 5.82e-80 241 57 0 204 3 lipB Octanoyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q87VW6 5.82e-80 241 59 0 201 3 lipB Octanoyltransferase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q1QXA4 3.57e-79 239 58 1 200 3 lipB Octanoyltransferase Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
C3K2L9 6.23e-79 238 58 0 201 3 lipB Octanoyltransferase Pseudomonas fluorescens (strain SBW25)
Q8P589 7.2e-78 236 55 0 198 3 lipB Octanoyltransferase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UYT3 7.2e-78 236 55 0 198 3 lipB Octanoyltransferase Xanthomonas campestris pv. campestris (strain 8004)
B0RNP8 1.26e-77 235 54 0 198 3 lipB Octanoyltransferase Xanthomonas campestris pv. campestris (strain B100)
Q8PPL9 3.25e-76 232 54 0 198 3 lipB Octanoyltransferase Xanthomonas axonopodis pv. citri (strain 306)
Q0AI04 3.59e-76 231 53 0 199 3 lipB Octanoyltransferase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q0ACA3 8.53e-76 230 54 0 193 3 lipB Octanoyltransferase Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5ZVC9 8.9e-76 229 52 0 198 3 lipB Octanoyltransferase Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q3BXQ4 9.37e-76 231 54 0 198 3 lipB Octanoyltransferase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5WWD9 2.09e-75 228 51 0 198 3 lipB Octanoyltransferase Legionella pneumophila (strain Lens)
Q5GVR6 3.55e-75 229 54 0 198 3 lipB Octanoyltransferase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2NYZ1 3.55e-75 229 54 0 198 3 lipB Octanoyltransferase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q7NTG0 3.85e-75 228 53 0 197 3 lipB Octanoyltransferase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
A5IC06 6.36e-75 227 51 0 198 3 lipB Octanoyltransferase Legionella pneumophila (strain Corby)
Q3SM28 8.63e-75 228 53 0 197 3 lipB Octanoyltransferase Thiobacillus denitrificans (strain ATCC 25259)
Q5X551 9.02e-75 227 51 0 198 3 lipB Octanoyltransferase Legionella pneumophila (strain Paris)
C1D5T4 2.73e-73 223 51 1 202 3 lipB Octanoyltransferase Laribacter hongkongensis (strain HLHK9)
A1AWI7 6.12e-73 223 50 1 198 3 lipB Octanoyltransferase Ruthia magnifica subsp. Calyptogena magnifica
Q82UJ6 1.23e-72 222 52 0 199 3 lipB Octanoyltransferase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B4RLL0 1.45e-72 221 54 1 193 3 lipB Octanoyltransferase Neisseria gonorrhoeae (strain NCCP11945)
Q5F8I1 1.45e-72 221 54 1 193 3 lipB Octanoyltransferase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q87DZ8 2.25e-72 222 52 0 202 3 lipB Octanoyltransferase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9JZA4 2.32e-72 221 54 2 198 3 lipB Octanoyltransferase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A9LZ96 2.32e-72 221 54 2 198 3 lipB Octanoyltransferase Neisseria meningitidis serogroup C (strain 053442)
A1KU21 3.51e-72 221 53 2 198 3 lipB Octanoyltransferase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
P57356 1.03e-71 219 48 0 196 3 lipB Octanoyltransferase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9JUC7 1.3e-71 219 53 2 198 3 lipB Octanoyltransferase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9PDV9 3.08e-71 219 56 0 180 3 lipB Octanoyltransferase Xylella fastidiosa (strain 9a5c)
Q1GYC2 4.7e-71 218 51 0 203 3 lipB Octanoyltransferase Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q60CJ7 1.05e-70 217 49 0 200 3 lipB Octanoyltransferase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q47JD4 1.3e-70 216 57 0 176 3 lipB Octanoyltransferase Dechloromonas aromatica (strain RCB)
A1WVS9 4.03e-70 216 55 0 178 3 lipB Octanoyltransferase Halorhodospira halophila (strain DSM 244 / SL1)
Q83C64 4.55e-70 216 53 2 204 3 lipB Octanoyltransferase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9KFW4 4.75e-70 216 53 2 204 3 lipB Octanoyltransferase Coxiella burnetii (strain Dugway 5J108-111)
Q89AL8 4.99e-70 215 51 1 193 3 lipB Octanoyltransferase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A9NDX7 5.6e-70 216 53 2 204 3 lipB Octanoyltransferase Coxiella burnetii (strain RSA 331 / Henzerling II)
B6IZL5 5.6e-70 216 53 2 204 3 lipB Octanoyltransferase Coxiella burnetii (strain CbuG_Q212)
Q31F43 9.69e-70 214 52 4 206 3 lipB Octanoyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B6J7S2 3.2e-69 214 53 2 204 3 lipB Octanoyltransferase Coxiella burnetii (strain CbuK_Q154)
Q3J7W3 5.75e-69 213 49 0 209 3 lipB Octanoyltransferase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q5NG26 1.32e-68 211 51 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14HH8 1.32e-68 211 51 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
Q5P4B9 2.87e-68 211 51 2 199 3 lipB Octanoyltransferase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q2Y7I8 3.58e-68 211 57 0 168 3 lipB Octanoyltransferase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A4IXX8 5.75e-68 210 50 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q0BLW1 5.75e-68 210 50 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A3E7 5.75e-68 210 50 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7NC90 5.75e-68 210 50 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A0Q6D2 7.81e-68 209 50 1 196 3 lipB Octanoyltransferase Francisella tularensis subsp. novicida (strain U112)
B2SGJ2 1.32e-67 209 51 1 194 3 lipB Octanoyltransferase Francisella tularensis subsp. mediasiatica (strain FSC147)
Q6F8H3 3.8e-67 208 48 2 212 3 lipB Octanoyltransferase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q0VN37 2.85e-66 207 50 2 206 3 lipB Octanoyltransferase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
A5EY93 3.89e-65 202 55 1 187 3 lipB Octanoyltransferase Dichelobacter nodosus (strain VCS1703A)
A1VIU0 4.56e-64 201 45 1 221 3 lipB Octanoyltransferase Polaromonas naphthalenivorans (strain CJ2)
Q63XX6 6.74e-64 200 48 2 204 3 lipB Octanoyltransferase Burkholderia pseudomallei (strain K96243)
Q62N15 6.74e-64 200 48 2 204 3 lipB Octanoyltransferase Burkholderia mallei (strain ATCC 23344)
A5CWR5 7.78e-64 199 48 1 193 3 lipB Octanoyltransferase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q2T1K6 1.53e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A3NQX5 1.61e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia pseudomallei (strain 1106a)
Q3JWL3 1.65e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia pseudomallei (strain 1710b)
A1V017 1.76e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia mallei (strain SAVP1)
A2S5Y8 1.76e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia mallei (strain NCTC 10229)
A3MR18 1.76e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia mallei (strain NCTC 10247)
A3N575 1.93e-63 200 48 2 204 3 lipB Octanoyltransferase Burkholderia pseudomallei (strain 668)
Q8K9Q3 5.88e-63 197 43 1 200 3 lipB Octanoyltransferase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q21RG9 1.39e-61 194 46 1 212 3 lipB Octanoyltransferase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A1K1U6 3.41e-61 193 53 1 179 3 lipB Octanoyltransferase Azoarcus sp. (strain BH72)
A4T0B0 6.3e-60 190 45 2 210 3 lipB Octanoyltransferase Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A9IH67 3.34e-59 188 56 3 166 3 lipB Octanoyltransferase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q8D326 4.04e-59 187 44 2 192 3 lipB Octanoyltransferase Wigglesworthia glossinidia brevipalpis
A4JI72 4.82e-59 189 48 2 208 3 lipB Octanoyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
B2SWY4 5.33e-59 188 47 2 212 3 lipB Octanoyltransferase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
A4G9C5 1.09e-58 187 45 3 207 3 lipB Octanoyltransferase Herminiimonas arsenicoxydans
A6T344 1.28e-58 186 44 3 207 3 lipB Octanoyltransferase Janthinobacterium sp. (strain Marseille)
Q146F2 2.34e-58 187 47 2 212 3 lipB Octanoyltransferase Paraburkholderia xenovorans (strain LB400)
B1JZ91 9.12e-58 185 48 2 204 3 lipB Octanoyltransferase Burkholderia orbicola (strain MC0-3)
Q7W223 1.09e-57 184 47 3 200 3 lipB Octanoyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A9AEG7 1.11e-57 185 49 2 201 3 lipB Octanoyltransferase Burkholderia multivorans (strain ATCC 17616 / 249)
Q2L1E2 1.28e-57 184 47 1 193 3 lipB Octanoyltransferase Bordetella avium (strain 197N)
A2SCI8 1.72e-57 184 45 1 217 3 lipB Octanoyltransferase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
Q7WR01 2.18e-57 183 47 3 200 3 lipB Octanoyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q39CJ1 3.01e-57 184 48 2 204 3 lipB Octanoyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C5CP20 5.48e-57 182 42 1 215 3 lipB Octanoyltransferase Variovorax paradoxus (strain S110)
B2UE02 7.62e-57 182 52 1 180 3 lipB Octanoyltransferase Ralstonia pickettii (strain 12J)
Q7W0K9 7.94e-57 182 47 3 200 3 lipB Octanoyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q1BT81 8.38e-57 183 48 2 204 3 lipB Octanoyltransferase Burkholderia orbicola (strain AU 1054)
A0KAV9 9.54e-57 183 48 2 204 3 lipB Octanoyltransferase Burkholderia cenocepacia (strain HI2424)
Q0BBH9 1.32e-56 182 48 2 204 3 lipB Octanoyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YNM7 1.54e-56 182 48 2 204 3 lipB Octanoyltransferase Burkholderia ambifaria (strain MC40-6)
B2JC45 1.57e-56 182 47 2 209 3 lipB Octanoyltransferase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q8Y2L2 1.65e-56 181 52 1 180 3 lipB Octanoyltransferase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B1XSA5 1.68e-56 181 44 2 208 3 lipB Octanoyltransferase Polynucleobacter necessarius subsp. necessarius (strain STIR1)
A1WF49 1.29e-54 177 39 1 228 3 lipB Octanoyltransferase Verminephrobacter eiseniae (strain EF01-2)
Q12GR3 1.5e-54 177 38 1 245 3 lipB Octanoyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q477G6 1.95e-54 177 50 3 191 3 lipB Octanoyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
A1TJ32 2e-53 174 39 1 228 3 lipB Octanoyltransferase Paracidovorax citrulli (strain AAC00-1)
Q0KFE7 1.48e-52 172 50 2 187 3 lipB Octanoyltransferase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9BPT8 8.35e-52 170 39 1 222 3 lipB Octanoyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q1QBT8 8.28e-45 153 39 4 220 3 lipB Octanoyltransferase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FS63 8.59e-45 153 38 4 221 3 lipB Octanoyltransferase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
A7HWU9 4.67e-43 147 43 1 182 3 lipB Octanoyltransferase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
A4WQA7 1.48e-42 145 38 2 206 3 lipB Octanoyltransferase Cereibacter sphaeroides (strain ATCC 17025 / ATH 2.4.3)
C0RLB0 8.12e-42 145 41 3 193 3 lipB Octanoyltransferase Brucella melitensis biotype 2 (strain ATCC 23457)
Q8YC54 9.54e-42 145 41 3 193 3 lipB Octanoyltransferase Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q577Y8 9.77e-42 145 41 3 193 3 lipB Octanoyltransferase Brucella abortus biovar 1 (strain 9-941)
Q2YKK8 9.77e-42 145 41 3 193 3 lipB Octanoyltransferase Brucella abortus (strain 2308)
A3PH28 1.13e-41 143 38 2 202 3 lipB Octanoyltransferase Cereibacter sphaeroides (strain ATCC 17029 / ATH 2.4.9)
Q2RSU9 1.48e-41 143 41 1 185 3 lipB Octanoyltransferase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3J5A6 2.54e-41 142 38 2 202 3 lipB Octanoyltransferase Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q8FW72 2.57e-41 144 41 3 193 3 lipB Octanoyltransferase Brucella suis biovar 1 (strain 1330)
A4YT30 4.08e-41 142 44 3 177 3 lipB Octanoyltransferase Bradyrhizobium sp. (strain ORS 278)
Q11JI3 6.48e-41 142 40 3 186 3 lipB Octanoyltransferase Chelativorans sp. (strain BNC1)
Q2W9F0 1.41e-40 140 41 1 180 3 lipB Octanoyltransferase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q211P6 1.58e-40 141 44 3 180 3 lipB Octanoyltransferase Rhodopseudomonas palustris (strain BisB18)
Q98KT0 4.43e-40 140 43 2 166 3 lipB Octanoyltransferase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1MG80 5.39e-40 139 41 1 185 3 lipB Octanoyltransferase Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
A5EL70 8.99e-40 139 43 3 177 3 lipB Octanoyltransferase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
A5V649 1.21e-39 138 37 2 209 3 lipB Octanoyltransferase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A8LRT6 1.71e-39 138 39 2 210 3 lipB Octanoyltransferase Dinoroseobacter shibae (strain DSM 16493 / NCIMB 14021 / DFL 12)
Q2K833 1.86e-39 138 42 1 180 3 lipB Octanoyltransferase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q6FZQ9 2.45e-39 138 34 2 201 3 lipB Octanoyltransferase Bartonella quintana (strain Toulouse)
Q9A6B8 3.46e-39 137 41 1 175 3 lipB Octanoyltransferase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q89JM6 3.64e-39 138 41 3 182 3 lipB Octanoyltransferase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A1UT80 3.82e-39 137 37 1 182 3 lipB Octanoyltransferase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q8UF44 5.48e-39 138 38 2 207 3 lipB Octanoyltransferase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1QLD9 6.61e-39 137 41 3 177 3 lipB Octanoyltransferase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q2GL91 6.99e-39 136 40 2 167 3 lipB Octanoyltransferase Anaplasma phagocytophilum (strain HZ)
Q07L16 7.67e-39 136 41 3 180 3 lipB Octanoyltransferase Rhodopseudomonas palustris (strain BisA53)
Q92QD5 7.99e-39 137 41 2 182 3 lipB Octanoyltransferase Rhizobium meliloti (strain 1021)
A6U899 1.67e-38 136 41 2 181 3 lipB Octanoyltransferase Sinorhizobium medicae (strain WSM419)
Q0ANV0 2.05e-38 135 44 2 153 3 lipB Octanoyltransferase Maricaulis maris (strain MCS10)
Q7ND22 2.35e-38 135 38 3 198 3 lipB Octanoyltransferase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
B3PP01 2.57e-38 135 42 1 180 3 lipB Octanoyltransferase Rhizobium etli (strain CIAT 652)
Q6G3I3 3.2e-38 135 37 1 161 3 lipB Octanoyltransferase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
Q5LTM4 4.54e-38 134 40 1 180 3 lipB Octanoyltransferase Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q3SRU9 5.97e-38 134 39 3 178 3 lipB Octanoyltransferase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q2GH92 9.64e-38 133 39 2 167 3 lipB Octanoyltransferase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
C4K2Y1 1.01e-37 133 38 2 174 3 lipB Octanoyltransferase Rickettsia peacockii (strain Rustic)
Q135D0 1.06e-37 134 42 3 177 3 lipB Octanoyltransferase Rhodopseudomonas palustris (strain BisB5)
Q5HAP4 1.22e-37 132 37 3 191 3 lipB Octanoyltransferase Ehrlichia ruminantium (strain Welgevonden)
Q5FFZ7 1.22e-37 132 37 3 191 3 lipB Octanoyltransferase Ehrlichia ruminantium (strain Gardel)
Q2GC80 1.62e-37 133 36 3 199 3 lipB Octanoyltransferase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q92FX0 3.8e-37 131 37 2 174 3 lipB Octanoyltransferase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q3YRI1 4.75e-37 131 39 3 167 3 lipB Octanoyltransferase Ehrlichia canis (strain Jake)
Q6N514 6.14e-37 132 44 3 155 3 lipB Octanoyltransferase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A8F300 8.72e-37 130 38 3 174 3 lipB Octanoyltransferase Rickettsia massiliae (strain Mtu5)
Q0C3A9 9.39e-37 131 40 2 164 3 lipB Octanoyltransferase Hyphomonas neptunium (strain ATCC 15444)
B3QAV6 1.13e-36 131 44 3 155 3 lipB Octanoyltransferase Rhodopseudomonas palustris (strain TIE-1)
C3PM18 1.27e-36 130 37 2 174 3 lipB Octanoyltransferase Rickettsia africae (strain ESF-5)
B6JF54 1.31e-36 131 40 3 181 3 lipB Octanoyltransferase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q2IXI4 1.59e-36 131 44 3 155 3 lipB Octanoyltransferase Rhodopseudomonas palustris (strain HaA2)
C0QQ61 2.32e-36 129 39 2 164 3 lipB Octanoyltransferase Persephonella marina (strain DSM 14350 / EX-H1)
A8GU54 3.24e-36 129 37 2 174 3 lipB Octanoyltransferase Rickettsia rickettsii (strain Sheila Smith)
B0BVP3 3.24e-36 129 37 2 174 3 lipB Octanoyltransferase Rickettsia rickettsii (strain Iowa)
Q4FLP4 5.07e-36 128 29 3 184 3 lipB Octanoyltransferase Pelagibacter ubique (strain HTCC1062)
Q2JKB7 9.09e-36 129 36 2 196 3 lipB Octanoyltransferase Synechococcus sp. (strain JA-2-3B'a(2-13))
A1B3D5 9.46e-36 128 42 2 159 3 lipB Octanoyltransferase Paracoccus denitrificans (strain Pd 1222)
Q28SZ3 1.32e-35 127 39 1 182 3 lipB Octanoyltransferase Jannaschia sp. (strain CCS1)
A9IVX0 1.53e-35 128 34 2 196 3 lipB Octanoyltransferase Bartonella tribocorum (strain CIP 105476 / IBS 506)
A5G0V3 2.32e-35 127 38 2 189 3 lipB Octanoyltransferase Acidiphilium cryptum (strain JF-5)
Q4UJQ5 3.82e-35 126 40 3 156 3 lipB Octanoyltransferase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q5NMY4 7.15e-35 125 36 2 166 3 lipB Octanoyltransferase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
A8GQA5 1.5e-34 125 37 2 169 3 lipB Octanoyltransferase Rickettsia akari (strain Hartford)
A9HJ12 1.17e-33 123 38 5 194 3 lipB Octanoyltransferase Gluconacetobacter diazotrophicus (strain ATCC 49037 / DSM 5601 / CCUG 37298 / CIP 103539 / LMG 7603 / PAl5)
Q68VN7 1.19e-33 122 39 3 156 3 lipB Octanoyltransferase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A8F0A0 4.32e-33 121 39 2 156 3 lipB Octanoyltransferase Rickettsia canadensis (strain McKiel)
Q9ZC91 8.59e-33 120 37 2 156 3 lipB Octanoyltransferase Rickettsia prowazekii (strain Madrid E)
Q5PA33 9.68e-33 120 35 4 199 3 lipB Octanoyltransferase Anaplasma marginale (strain St. Maries)
B9KJ95 9.68e-33 120 35 4 199 3 lipB Octanoyltransferase Anaplasma marginale (strain Florida)
Q2NDR7 1.28e-32 120 36 4 178 3 lipB Octanoyltransferase Erythrobacter litoralis (strain HTCC2594)
Q3A7N4 1.29e-32 120 35 3 198 3 lipB Octanoyltransferase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q39S09 1.72e-32 119 36 2 175 3 lipB Octanoyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
A0L510 2.72e-32 119 38 1 173 3 lipB Octanoyltransferase Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
B8DRR1 3.07e-32 119 37 1 178 3 lipB Octanoyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q2JTV2 7.72e-32 119 32 2 204 3 lipB Octanoyltransferase Synechococcus sp. (strain JA-3-3Ab)
Q73GE2 8.85e-32 117 33 4 184 3 lipB Octanoyltransferase Wolbachia pipientis wMel
B8G783 1.06e-31 117 34 5 215 3 lipB Octanoyltransferase Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q6ARJ9 1.24e-31 117 34 4 204 3 lipB Octanoyltransferase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
B5YD73 1.77e-31 117 39 2 154 3 lipB Octanoyltransferase Dictyoglomus thermophilum (strain ATCC 35947 / DSM 3960 / H-6-12)
Q1RKI1 2.66e-31 116 39 3 156 3 lipB Octanoyltransferase Rickettsia bellii (strain RML369-C)
A8GUN4 2.66e-31 116 39 3 156 3 lipB Octanoyltransferase Rickettsia bellii (strain OSU 85-389)
Q8A8S8 3.72e-31 116 40 3 155 3 lipB Octanoyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
B0K3J8 3.77e-31 116 31 3 204 3 lipB Octanoyltransferase Thermoanaerobacter sp. (strain X514)
B0K8D0 3.89e-31 116 31 3 204 3 lipB Octanoyltransferase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q5GT50 4.01e-31 115 33 5 185 3 lipB Octanoyltransferase Wolbachia sp. subsp. Brugia malayi (strain TRS)
Q7U8F2 4.61e-31 116 32 1 176 3 lipB Octanoyltransferase Parasynechococcus marenigrum (strain WH8102)
A1TB25 6.14e-31 116 37 3 178 3 lipB Octanoyltransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
B3CLJ0 7.55e-31 115 34 3 167 3 lipB Octanoyltransferase Wolbachia pipientis subsp. Culex pipiens (strain wPip)
Q1AT14 2.81e-30 114 37 5 182 3 lipB Octanoyltransferase Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q02AK4 3.15e-30 114 33 3 210 3 lipB Octanoyltransferase Solibacter usitatus (strain Ellin6076)
A0LIW0 3.19e-30 114 36 2 180 3 lipB Octanoyltransferase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B8DZW2 3.79e-30 114 35 4 179 3 lipB Octanoyltransferase Dictyoglomus turgidum (strain DSM 6724 / Z-1310)
B9LM66 4.19e-30 114 34 6 216 3 lipB Octanoyltransferase Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WKF8 4.19e-30 114 34 6 216 3 lipB Octanoyltransferase Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q5SLQ3 5.91e-30 113 30 5 214 1 lipB Octanoyltransferase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q72GV2 5.91e-30 113 30 5 214 3 lipB Octanoyltransferase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q30XT7 6.33e-30 113 36 1 178 3 lipB Octanoyltransferase Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
A1AMT7 6.46e-30 113 34 2 175 3 lipB Octanoyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q8R9E0 6.52e-30 113 32 3 199 3 lipB Octanoyltransferase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A4WK37 6.82e-30 113 33 3 199 3 lipB Probable octanoyltransferase Pyrobaculum arsenaticum (strain DSM 13514 / JCM 11321 / PZ6)
A1VF78 6.89e-30 113 40 1 150 3 lipB Octanoyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72DM3 6.89e-30 113 40 1 150 3 lipB Octanoyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q8DKM7 9.42e-30 113 32 3 202 3 lipB Octanoyltransferase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
A6TWD0 1.11e-29 112 37 4 167 3 lipB Octanoyltransferase Alkaliphilus metalliredigens (strain QYMF)
B3CRE6 1.14e-29 112 38 2 153 3 lipB Octanoyltransferase Orientia tsutsugamushi (strain Ikeda)
A5GAC4 1.84e-29 112 38 1 144 3 lipB Octanoyltransferase Geotalea uraniireducens (strain Rf4)
A5CEL3 2.2e-29 111 38 2 153 3 lipB Octanoyltransferase Orientia tsutsugamushi (strain Boryong)
Q1B6R2 2.35e-29 112 31 4 207 3 lipB Octanoyltransferase Mycobacterium sp. (strain MCS)
A1UIB3 2.35e-29 112 31 4 207 3 lipB Octanoyltransferase Mycobacterium sp. (strain KMS)
A3Q1S7 2.35e-29 112 31 4 207 3 lipB Octanoyltransferase Mycobacterium sp. (strain JLS)
Q948J9 3.17e-29 113 35 2 169 1 LIP2P Octanoyltransferase LIP2p, chloroplastic Arabidopsis thaliana
Q3AI29 3.63e-29 111 30 3 219 3 lipB Octanoyltransferase Synechococcus sp. (strain CC9605)
Q5LDM3 5.64e-29 110 37 3 170 3 lipB Octanoyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64UP8 5.82e-29 110 37 3 170 3 lipB Octanoyltransferase Bacteroides fragilis (strain YCH46)
A4TBJ9 5.99e-29 111 35 3 178 3 lipB Octanoyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
Q6KZK7 6.13e-29 111 35 5 167 3 lipB2 Probable octanoyltransferase 2 Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
A6GYW1 1.12e-28 110 33 3 200 3 lipB Octanoyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q5FUX5 1.41e-28 110 33 4 209 3 lipB Octanoyltransferase Gluconobacter oxydans (strain 621H)
A3PBB9 1.58e-28 109 32 1 168 3 lipB Octanoyltransferase Prochlorococcus marinus (strain MIT 9301)
A0JVC9 3.01e-28 108 30 6 209 3 lipB Octanoyltransferase Arthrobacter sp. (strain FB24)
A0R074 4.83e-28 108 32 4 203 3 lipB Octanoyltransferase Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q1GTF8 5.58e-28 108 36 2 165 3 lipB Octanoyltransferase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
A0QEY7 6.78e-28 108 31 4 205 3 lipB Octanoyltransferase Mycobacterium avium (strain 104)
A8G3B3 6.96e-28 107 31 1 168 3 lipB Octanoyltransferase Prochlorococcus marinus (strain MIT 9215)
A0M5H7 7.47e-28 108 32 7 222 3 lipB Octanoyltransferase Christiangramia forsetii (strain DSM 17595 / CGMCC 1.15422 / KT0803)
Q8ZUR4 7.73e-28 108 32 2 175 3 lipB Probable octanoyltransferase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q8YSA4 1.2e-27 107 30 2 200 3 lipB Octanoyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q2GEU6 1.42e-27 107 35 2 152 3 lipB Octanoyltransferase Neorickettsia sennetsu (strain ATCC VR-367 / Miyayama)
Q3AZ50 1.77e-27 107 33 2 183 3 lipB Octanoyltransferase Synechococcus sp. (strain CC9902)
A9BE20 1.99e-27 107 33 2 171 3 lipB Octanoyltransferase Prochlorococcus marinus (strain MIT 9211)
A2BPM9 2.2e-27 106 30 1 168 3 lipB Octanoyltransferase Prochlorococcus marinus (strain AS9601)
B8HGZ8 2.62e-27 106 31 6 212 3 lipB Octanoyltransferase Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q3M698 2.67e-27 106 29 2 208 3 lipB Octanoyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
C6E0V3 3.12e-27 105 40 1 134 3 lipB Octanoyltransferase Geobacter sp. (strain M21)
Q73YJ7 3.99e-27 106 31 4 205 3 lipB Octanoyltransferase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P0C7R2 7.06e-27 107 39 3 140 1 LIP2P2 Octanoyltransferase LIP2p2, chloroplastic Arabidopsis thaliana
Q00520 1.2e-26 103 42 1 126 3 lipB Octanoyltransferase (Fragment) Paracoccus versutus
Q7MUY1 1.59e-26 108 36 3 166 3 lipB Octanoyltransferase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
A4XHV1 1.86e-26 104 35 4 174 3 lipB Octanoyltransferase Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q5N180 2.32e-26 104 31 3 211 3 lipB Octanoyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31KN6 2.32e-26 104 31 3 211 3 lipB Octanoyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A5US49 2.8e-26 104 32 6 215 3 lipB Octanoyltransferase Roseiflexus sp. (strain RS-1)
Q2JB35 3.27e-26 103 36 5 165 3 lipB Octanoyltransferase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
A3MW04 3.92e-26 103 32 2 189 3 lipB Probable octanoyltransferase Pyrobaculum calidifontis (strain DSM 21063 / JCM 11548 / VA1)
Q7VDH8 4.11e-26 103 32 2 190 3 lipB Octanoyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A9WS39 4.63e-26 103 32 4 179 3 lipB Octanoyltransferase Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
A6L9E1 5.34e-26 103 33 3 166 3 lipB Octanoyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
C6BZY6 6.94e-26 102 31 2 176 3 lipB Octanoyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
O32961 8.21e-26 103 33 3 183 3 lipB Octanoyltransferase Mycobacterium leprae (strain TN)
B8ZQK0 8.21e-26 103 33 3 183 3 lipB Octanoyltransferase Mycobacterium leprae (strain Br4923)
Q10ZL5 9.36e-26 102 30 2 200 3 lipB Octanoyltransferase Trichodesmium erythraeum (strain IMS101)
Q11XW2 9.77e-26 103 31 8 225 3 lipB Octanoyltransferase Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q8FNP5 1.09e-25 103 35 5 187 3 lipB Octanoyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B2IVM2 1.11e-25 102 29 3 201 3 lipB Octanoyltransferase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q47R87 1.16e-25 102 34 4 175 3 lipB Octanoyltransferase Thermobifida fusca (strain YX)
P9WK83 1.39e-25 102 32 3 179 1 lipB Octanoyltransferase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WK82 1.39e-25 102 32 3 179 3 lipB Octanoyltransferase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U4P5 1.39e-25 102 32 3 179 3 lipB Octanoyltransferase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
Q31CD7 1.39e-25 102 32 1 158 3 lipB Octanoyltransferase Prochlorococcus marinus (strain MIT 9312)
C1AQD2 1.81e-25 102 32 3 179 3 lipB Octanoyltransferase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KKQ9 1.81e-25 102 32 3 179 3 lipB Octanoyltransferase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7VEN4 1.81e-25 102 32 3 179 3 lipB Octanoyltransferase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q7V8V9 1.82e-25 102 32 1 175 3 lipB Octanoyltransferase Prochlorococcus marinus (strain MIT 9313)
Q8NNJ1 1.86e-25 102 32 5 184 3 lipB Octanoyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QFS2 1.86e-25 102 32 5 184 3 lipB Octanoyltransferase Corynebacterium glutamicum (strain R)
A5FIL6 1.91e-25 102 33 4 180 3 lipB Octanoyltransferase Flavobacterium johnsoniae (strain ATCC 17061 / DSM 2064 / JCM 8514 / BCRC 14874 / CCUG 350202 / NBRC 14942 / NCIMB 11054 / UW101)
A5GJ90 1.92e-25 102 31 1 174 3 lipB Octanoyltransferase Synechococcus sp. (strain WH7803)
A2C0K7 2.09e-25 102 32 1 169 3 lipB Octanoyltransferase Prochlorococcus marinus (strain NATL1A)
B5EDZ5 2.23e-25 101 39 1 134 3 lipB Octanoyltransferase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
Q74AE2 3.32e-25 101 37 1 140 3 lipB Octanoyltransferase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B2HHL3 7.41e-25 100 30 5 217 3 lipB Octanoyltransferase Mycobacterium marinum (strain ATCC BAA-535 / M)
Q6A9W7 7.57e-25 101 33 5 185 3 lipB Octanoyltransferase Cutibacterium acnes (strain DSM 16379 / KPA171202)
A0LTE0 8.23e-25 100 34 5 187 3 lipB Octanoyltransferase Acidothermus cellulolyticus (strain ATCC 43068 / DSM 8971 / 11B)
Q46H10 1.02e-24 100 32 1 165 3 lipB Octanoyltransferase Prochlorococcus marinus (strain NATL2A)
B8J3G1 1.03e-24 100 37 1 151 3 lipB Octanoyltransferase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A4J246 1.09e-24 100 30 3 188 3 lipB Octanoyltransferase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
A5MZJ0 1.49e-24 99 35 3 170 3 lipB Octanoyltransferase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
Q7V2R8 1.78e-24 99 32 1 150 3 lipB Octanoyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
A2BV61 1.78e-24 99 31 1 161 3 lipB Octanoyltransferase Prochlorococcus marinus (strain MIT 9515)
A0PNH8 1.82e-24 99 30 5 217 3 lipB Octanoyltransferase Mycobacterium ulcerans (strain Agy99)
A1R5J6 1.92e-24 99 30 5 188 3 lipB Octanoyltransferase Paenarthrobacter aurescens (strain TC1)
A4XA20 4.38e-24 97 37 3 150 3 lipB Octanoyltransferase Salinispora tropica (strain ATCC BAA-916 / DSM 44818 / JCM 13857 / NBRC 105044 / CNB-440)
Q6L1M2 4.54e-24 98 36 7 158 3 lipB1 Probable octanoyltransferase 1 Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
P74519 5.61e-24 98 29 2 194 3 lipB Octanoyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9SXP7 8.12e-24 97 32 3 184 1 LIP2 Octanoyltransferase LIP2, mitochondrial Arabidopsis thaliana
A8LYF4 1.15e-23 97 34 4 176 3 lipB Octanoyltransferase Salinispora arenicola (strain CNS-205)
C1F3S1 3.07e-23 96 32 5 220 3 lipB Octanoyltransferase Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q29R99 3.7e-23 95 37 3 154 2 lipt2 Octanoyl-[acyl-carrier-protein]:protein N-octanoyltransferase LIPT2, mitochondrial Danio rerio
Q83I07 4.12e-23 95 31 9 216 3 lipB Octanoyltransferase Tropheryma whipplei (strain TW08/27)
Q9X6X4 4.14e-23 98 31 4 211 3 lipB Octanoyltransferase Myxococcus xanthus
B9MQ23 4.48e-23 95 34 3 157 3 lipB Octanoyltransferase Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q83G63 7.41e-23 95 31 9 216 3 lipB Octanoyltransferase Tropheryma whipplei (strain Twist)
Q6NG87 8.71e-23 95 32 5 193 3 lipB Octanoyltransferase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q2RZI1 9.97e-23 95 34 3 178 3 lipB Octanoyltransferase Salinibacter ruber (strain DSM 13855 / M31)
Q4JWD9 1.27e-22 94 31 6 191 3 lipB Octanoyltransferase Corynebacterium jeikeium (strain K411)
C1AUB9 2.5e-21 91 30 6 197 3 lipB Octanoyltransferase Rhodococcus opacus (strain B4)
Q6AFG6 2.63e-21 90 30 4 180 3 lipB Octanoyltransferase Leifsonia xyli subsp. xyli (strain CTCB07)
Q6MPS6 3.35e-21 90 30 5 195 3 lipB Octanoyltransferase Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
O13476 3.96e-21 92 34 5 153 3 LIPB Octanoyltransferase, mitochondrial Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A5CQA0 5.36e-21 90 32 4 178 3 lipB Octanoyltransferase Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q0SHK6 7.6e-21 90 30 6 197 3 lipB Octanoyltransferase Rhodococcus jostii (strain RHA1)
O36017 8.01e-21 89 34 3 152 3 SPAC4F10.05c Probable octanoyltransferase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
B0RE23 8.97e-21 89 34 6 179 3 lipB Octanoyltransferase Clavibacter sepedonicus
Q72QP1 9.49e-21 89 28 5 221 3 lipB Octanoyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q1IIJ5 9.76e-21 90 31 4 176 3 lipB Octanoyltransferase Koribacter versatilis (strain Ellin345)
Q8F5F1 1.02e-20 89 28 5 221 3 lipB Octanoyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q9RWA5 1.07e-20 91 33 6 200 3 lipB Octanoyltransferase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B1VZM4 1.24e-20 90 30 4 215 3 lipB Octanoyltransferase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
C3PHK5 2.46e-20 89 30 6 223 3 lipB Octanoyltransferase Corynebacterium aurimucosum (strain ATCC 700975 / DSM 44827 / CIP 107346 / CN-1)
Q5YZ58 3.59e-20 88 30 4 181 3 lipB Octanoyltransferase Nocardia farcinica (strain IFM 10152)
Q82AP6 9.98e-20 87 29 5 227 3 lipB Octanoyltransferase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8CK04 1.06e-19 87 29 5 227 3 lipB Octanoyltransferase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q0VFH3 2.79e-19 85 30 5 203 2 lipt2 Octanoyl-[acyl-carrier-protein]:protein N-octanoyltransferase LIPT2, mitochondrial Xenopus tropicalis
B2GJ87 5.63e-19 85 34 3 148 3 lipB Octanoyltransferase Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q06005 9.94e-19 85 34 6 155 1 LIP2 Octanoyltransferase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9VN27 1.46e-17 81 30 2 166 2 Lipt2 Putative lipoyltransferase 2, mitochondrial Drosophila melanogaster
Q052G1 1.97e-17 80 28 6 202 3 lipB Octanoyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q04TD5 1.97e-17 80 28 6 202 3 lipB Octanoyltransferase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
O19898 2.43e-14 72 27 1 151 3 lipB Probable octanoyltransferase Cyanidium caldarium
Q9D009 5.99e-12 65 37 2 119 1 Lipt2 Octanoyl-[acyl-carrier-protein]:protein N-octanoyltransferase LIPT2, mitochondrial Mus musculus
A6NK58 8.61e-12 65 37 3 135 1 LIPT2 Octanoyl-[acyl-carrier-protein]:protein N-octanoyltransferase LIPT2, mitochondrial Homo sapiens
Q51854 0.000264 42 25 2 111 3 lipB Octanoyltransferase (Fragment) Prochlorothrix hollandica

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02075
Feature type CDS
Gene lipB
Product lipoyl(octanoyl) transferase LipB
Location 488471 - 489115 (strand: -1)
Length 645 (nucleotides) / 214 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1560
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF21948 Lipoyl protein ligase A/B catalytic domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0321 Coenzyme transport and metabolism (H) H Lipoate-protein ligase B

Kegg Ortholog Annotation(s)

Protein Sequence

MKIFTVQDKTIIIRQLGMKPYLPVSDSMHQFTEKRESHTPDEIWLVQHEQVFTQGQAGKAEHLLNTGSIPVIQSDRGGQVTYHGPGQQVMYVLLDLKRNHIGVRQLVTVLENTVINTLAEFNVDAYARADAPGVYVNGDKICSLGLRIRKGCSFHGLALNVDMDLSPFTRINPCGYPDLKMTQLVDLAPNATSEQVASLLINHFCTQLGFQPQQ

Flanking regions ( +/- flanking 50bp)

GGTAGTTCATTTGTTGGAGCGTTATACTGCCTTTCACAATTACGCTACAAATGAAGATTTTCACGGTGCAAGATAAAACAATCATTATTCGCCAATTGGGTATGAAACCCTATTTACCGGTTTCTGATTCTATGCATCAGTTTACGGAAAAACGGGAAAGTCATACACCTGATGAAATTTGGCTGGTTCAACATGAACAGGTTTTTACCCAAGGTCAAGCGGGTAAAGCAGAACACCTTTTAAACACAGGCTCTATACCGGTGATCCAATCTGACCGCGGTGGACAAGTGACCTACCACGGCCCTGGCCAACAAGTGATGTATGTTTTGCTTGATCTAAAACGTAACCATATTGGCGTTCGCCAATTAGTCACTGTTTTAGAGAATACTGTGATCAACACACTCGCAGAATTTAATGTAGACGCATATGCTCGTGCAGATGCACCGGGCGTGTATGTTAATGGTGATAAAATTTGCTCTTTGGGATTACGTATACGCAAAGGTTGCTCTTTTCACGGTCTAGCACTTAATGTTGATATGGACTTATCTCCTTTTACGCGAATAAATCCTTGTGGTTATCCTGATCTAAAAATGACACAACTGGTTGATTTGGCGCCTAATGCAACATCGGAACAAGTGGCATCATTATTAATCAACCATTTTTGTACACAACTGGGATTCCAACCACAGCAATAAAAATGCTATAATTTTTTTAACATTTATCATTTTTTTTTAAAACCCTGATT