Homologs in group_2078

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15290 FBDBKF_15290 72.6 Morganella morganii S1 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
EHELCC_10955 EHELCC_10955 72.6 Morganella morganii S2 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
NLDBIP_11300 NLDBIP_11300 72.6 Morganella morganii S4 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
LHKJJB_11160 LHKJJB_11160 72.6 Morganella morganii S3 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
HKOGLL_09770 HKOGLL_09770 72.6 Morganella morganii S5 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
F4V73_RS12160 F4V73_RS12160 73.1 Morganella psychrotolerans - CNNM domain-containing protein

Distribution of the homologs in the orthogroup group_2078

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2078

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37908 0.0 626 71 0 424 1 yfjD UPF0053 inner membrane protein YfjD Escherichia coli (strain K12)
Q57017 1.16e-169 484 55 3 416 1 HI_0107 UPF0053 protein HI_0107 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P74409 3.85e-46 168 26 7 424 3 sll0260 UPF0053 protein sll0260 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0AE45 5.15e-37 143 22 9 427 1 paeA Polyamine export protein Escherichia coli (strain K12)
P0AE46 5.15e-37 143 22 9 427 3 paeA Polyamine export protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE47 5.15e-37 143 22 9 427 3 paeA Polyamine export protein Escherichia coli O157:H7
P44717 3.55e-36 140 24 10 426 3 paeA Polyamine export protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P54428 1.51e-35 139 27 7 420 3 yrkA UPF0053 protein YrkA Bacillus subtilis (strain 168)
A0A0F6BAS6 6.01e-35 137 23 11 436 3 paeA Polyamine export protein Salmonella typhimurium (strain 14028s / SGSC 2262)
Q84R21 3.47e-34 138 25 10 402 2 CBSDUFCH2 DUF21 domain-containing protein At1g55930, chloroplastic Arabidopsis thaliana
O07589 1.25e-30 125 25 10 429 3 yhdT UPF0053 protein YhdT Bacillus subtilis (strain 168)
Q9LK65 5.5e-30 125 24 11 390 4 CBSDUFCH1 Putative DUF21 domain-containing protein At3g13070, chloroplastic Arabidopsis thaliana
O07585 1.51e-29 122 25 4 385 3 yhdP UPF0053 protein YhdP Bacillus subtilis (strain 168)
Q54318 1.32e-28 116 32 5 239 3 tlyC Hemolysin C Brachyspira hyodysenteriae
Q9CM13 3.3e-28 116 30 4 260 3 corC Magnesium and cobalt efflux protein CorC Pasteurella multocida (strain Pm70)
P54505 4.91e-28 118 27 5 328 3 yqhB UPF0053 protein YqhB Bacillus subtilis (strain 168)
O05241 1.58e-26 114 23 7 419 3 yugS UPF0053 protein YugS Bacillus subtilis (strain 168)
P67131 8.96e-26 111 24 11 401 3 BQ2027_MB2387C UPF0053 protein Mb2387c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFP1 8.96e-26 111 24 11 401 1 Rv2366c UPF0053 protein Rv2366c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFP0 8.96e-26 111 24 11 401 3 MT2435 UPF0053 protein MT2435 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AE81 1.7e-25 108 27 3 246 3 corC Magnesium and cobalt efflux protein CorC Shigella flexneri
P0AE78 1.7e-25 108 27 3 246 1 corC Magnesium and cobalt efflux protein CorC Escherichia coli (strain K12)
P0AE79 1.7e-25 108 27 3 246 3 corC Magnesium and cobalt efflux protein CorC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE80 1.7e-25 108 27 3 246 3 corC Magnesium and cobalt efflux protein CorC Escherichia coli O157:H7
P0A2L3 2.55e-25 107 27 3 246 1 corC Magnesium and cobalt efflux protein CorC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2L4 2.55e-25 107 27 3 246 3 corC Magnesium and cobalt efflux protein CorC Salmonella typhi
Q9KTE3 3.41e-25 107 28 3 246 3 corC Magnesium and cobalt efflux protein CorC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P74078 4.17e-25 108 23 6 347 3 sll1254 UPF0053 protein sll1254 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q57368 1.58e-24 105 27 5 256 3 corC Magnesium and cobalt efflux protein CorC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P9WFP2 6.6e-23 103 23 11 418 3 MT1890 UPF0053 protein MT1890 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WFP3 6.92e-23 103 23 11 418 1 Rv1842c UPF0053 protein Rv1842c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P57518 4.22e-22 99 26 3 237 3 corC Magnesium and cobalt efflux protein CorC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9C0 6.56e-22 98 28 5 238 3 corC Magnesium and cobalt efflux protein CorC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AC1 1.54e-21 97 26 4 246 3 corC Magnesium and cobalt efflux protein CorC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q4UK99 1.83e-21 97 29 7 248 3 tlyC Hemolysin C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q92GI2 8.55e-21 95 29 7 248 3 tlyC Hemolysin C homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
A8GTI4 1.24e-20 95 29 7 248 3 tlyC Hemolysin C homolog Rickettsia rickettsii (strain Sheila Smith)
A8GPR9 1.61e-20 94 29 7 248 3 tlyC Possible hemolysin C Rickettsia akari (strain Hartford)
A8F2M1 2.4e-20 94 29 7 248 3 tlyC Hemolysin C homolog Rickettsia massiliae (strain Mtu5)
Q68W10 6.41e-20 93 28 7 244 1 tlyC Hemolysin C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RGX2 1.02e-19 92 29 9 253 3 tlyC Possible hemolysin C Rickettsia bellii (strain RML369-C)
A8EZU0 3.16e-19 90 26 9 291 3 tlyC Possible hemolysin C Rickettsia canadensis (strain McKiel)
A8GUH1 8.38e-19 89 29 9 254 3 tlyC Possible hemolysin C Rickettsia bellii (strain OSU 85-389)
O05961 2.64e-18 88 28 7 241 2 tlyC Hemolysin C Rickettsia prowazekii (strain Madrid E)
Q89AI6 2.46e-17 87 29 8 241 3 bbp_300 UPF0053 protein bbp_300 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P0AEC0 1.03e-16 85 30 7 230 1 yoaE UPF0053 inner membrane protein YoaE Escherichia coli (strain K12)
P0AEC1 1.03e-16 85 30 7 230 3 yoaE UPF0053 inner membrane protein YoaE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC2 1.03e-16 85 30 7 230 3 yoaE UPF0053 inner membrane protein YoaE Escherichia coli O157:H7
Q83KI8 2e-16 84 26 4 232 3 yegH UPF0053 protein YegH Shigella flexneri
P76389 2.17e-16 84 26 4 232 3 yegH UPF0053 protein YegH Escherichia coli (strain K12)
P9WLQ7 2.07e-14 77 24 10 336 1 Rv1841c Uncharacterized protein Rv1841c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49399 2.95e-14 77 22 9 337 3 MG146 UPF0053 protein MG146 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P57408 5.53e-14 77 27 8 247 3 BU323 UPF0053 protein BU323 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9M0 1.22e-13 76 26 7 224 3 BUsg_314 UPF0053 protein BUsg_314 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P9WLQ6 2.39e-13 74 25 11 336 3 MT1889 Uncharacterized protein MT1889 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A0A0B7P9G0 1.16e-12 73 21 9 337 1 uex Unextended protein Drosophila melanogaster
P0C588 6.46e-12 71 24 11 341 1 Cnnm4 Metal transporter CNNM4 Rattus norvegicus
Q6P4Q7 8.98e-12 70 23 9 339 1 CNNM4 Metal transporter CNNM4 Homo sapiens
Q69ZF7 1.22e-11 70 24 11 341 1 Cnnm4 Metal transporter CNNM4 Mus musculus
Q8VZI2 1.66e-11 69 22 11 349 1 CBSDUF6 DUF21 domain-containing protein At4g33700 Arabidopsis thaliana
P75586 1.86e-11 68 20 9 325 3 MPN_159 UPF0053 protein MG146 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q48445 5.89e-11 67 24 5 209 3 None UPF0053 protein in cps region (Fragment) Klebsiella pneumoniae
Q12296 3.43e-10 65 24 14 345 1 MAM3 Protein MAM3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9ZQR4 4.14e-10 65 22 10 326 2 CBSDUF3 DUF21 domain-containing protein At2g14520 Arabidopsis thaliana
Q3TWN3 5.53e-10 65 23 10 340 1 Cnnm2 Metal transporter CNNM2 Mus musculus
Q5U2P1 6.1e-10 65 23 10 340 2 Cnnm2 Metal transporter CNNM2 Rattus norvegicus
Q9H8M5 6.15e-10 65 22 10 340 1 CNNM2 Metal transporter CNNM2 Homo sapiens
A0JPA0 1.88e-08 60 21 13 383 2 cnnm4 Metal transporter CNNM4 Xenopus tropicalis
G5ED05 8.79e-08 58 21 11 344 3 cnnm-5 Metal transporter cnnm-5 Caenorhabditis elegans
Q9LTD8 3.27e-06 52 20 8 281 2 CBSDUF5 DUF21 domain-containing protein At5g52790 Arabidopsis thaliana
Q32NY4 6.46e-06 52 25 8 253 1 Cnnm3 Metal transporter CNNM3 Mus musculus
Q4V3C7 3.26e-05 49 22 12 317 2 CBSDUF2 DUF21 domain-containing protein At4g14230 Arabidopsis thaliana
Q8NE01 0.000246 47 24 9 278 1 CNNM3 Metal transporter CNNM3 Homo sapiens
Q17586 0.000432 46 22 15 360 3 cnnm-4 Metal transporter cnnm-4 Caenorhabditis elegans

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01845
Feature type CDS
Gene -
Product HlyC/CorC family transporter
Location 434235 - 435509 (strand: -1)
Length 1275 (nucleotides) / 424 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2078
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00571 CBS domain
PF01595 Cyclin M transmembrane N-terminal domain
PF03471 Transporter associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4536 Inorganic ion transport and metabolism (P) P Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03699 magnesium and cobalt exporter, CNNM family - -

Protein Sequence

MEHVSTTTLIIILIGMIFASAYFSGTETSMMTINRYRLRHAAKQGNRSAKRVEKLLQRPDRLISLVLIGNNLINIVASALATIVGMRLYGDAGVAIATGVLTFVILIFAEVLPKSIAALYPERFAYPSSVLLSPLQKIMLPVVWFFNQITLVFMRIFGIKSPVIQGNAVSKEELRTIVNESKSKLSQRNQNMLISILDLEKVTIGDIMVPRNEIFGIDVNDEWKSIVRQLTHSPHGRIVLYRDTLDDVIGMLRVREAYRLMTEKKEFTKQILIKAADKIYFIPESTPLSLQLVNFQRNNEKAGIVVDEYGEIQGLVTVEDILEEIVGDFTTSMSPSLAEEVIPQKDGSLLVDGTTNIRDINKAFACHLPENEARTINGVIIEELGDLPVVGAKITIDGYEFEVLEVQDNVIKKALIRHLTPSRH

Flanking regions ( +/- flanking 50bp)

TTAATGCTTAATTAATCTTTTCATTTTAAGGTAGCAAAAGGAACTCAATTTTGGAGCATGTGTCGACAACAACGCTCATTATCATACTTATCGGTATGATCTTTGCCTCAGCCTATTTTTCAGGCACTGAAACTAGCATGATGACTATCAATCGTTATCGGCTACGCCACGCGGCCAAGCAAGGTAATCGCTCAGCCAAAAGAGTAGAAAAACTATTACAGCGTCCCGATAGATTGATTAGCTTAGTATTAATTGGTAATAACCTGATTAATATTGTCGCCTCCGCTCTCGCCACTATTGTAGGAATGCGTTTATATGGTGATGCAGGAGTAGCTATTGCAACAGGTGTATTAACCTTTGTCATTCTTATTTTTGCTGAGGTACTACCAAAATCTATCGCAGCGCTTTATCCAGAACGTTTCGCTTATCCAAGTAGCGTTCTTTTGTCACCTTTACAGAAAATCATGTTGCCCGTTGTGTGGTTTTTTAACCAAATTACCTTAGTGTTTATGCGCATTTTCGGTATTAAATCCCCCGTAATACAGGGTAATGCGGTATCAAAAGAAGAACTACGCACCATTGTGAATGAATCAAAATCGAAACTGTCACAGCGTAACCAAAATATGCTGATTTCTATTTTGGATTTAGAAAAAGTGACCATTGGCGATATTATGGTACCAAGAAATGAAATTTTTGGTATTGATGTCAATGATGAGTGGAAATCCATTGTCAGACAGTTAACTCACTCCCCTCATGGGCGTATTGTCCTTTATCGTGATACCCTCGATGATGTCATTGGTATGCTACGAGTACGCGAAGCTTACCGTCTTATGACAGAGAAGAAAGAATTTACTAAACAAATTTTGATTAAAGCGGCTGATAAAATCTATTTTATCCCAGAAAGTACACCACTTAGCTTACAACTAGTTAATTTTCAACGTAATAATGAAAAAGCCGGTATTGTCGTCGATGAATATGGTGAAATTCAAGGATTAGTCACTGTTGAAGATATCCTAGAAGAGATTGTCGGTGATTTTACTACCTCAATGTCTCCTTCTTTAGCAGAAGAAGTGATCCCACAAAAAGATGGTTCACTATTAGTGGATGGCACAACTAATATCCGAGATATCAATAAAGCCTTTGCTTGCCATTTACCAGAAAATGAAGCACGAACAATTAATGGGGTTATTATTGAAGAGTTGGGTGATTTACCCGTAGTAGGTGCCAAAATAACGATTGATGGTTATGAATTTGAAGTGTTGGAAGTGCAAGACAATGTGATTAAGAAAGCCTTGATCCGCCATCTTACGCCCTCTCGTCACTAGCGATTATTAATAGCGGTTCAATGCAATTGGCGTTGGCCGTTATGATAAAT