Homologs in group_2078

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15290 FBDBKF_15290 100.0 Morganella morganii S1 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
EHELCC_10955 EHELCC_10955 100.0 Morganella morganii S2 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
LHKJJB_11160 LHKJJB_11160 100.0 Morganella morganii S3 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
HKOGLL_09770 HKOGLL_09770 100.0 Morganella morganii S5 corB Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
F4V73_RS12160 F4V73_RS12160 90.9 Morganella psychrotolerans - CNNM domain-containing protein
PMI_RS01845 PMI_RS01845 72.6 Proteus mirabilis HI4320 - HlyC/CorC family transporter

Distribution of the homologs in the orthogroup group_2078

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2078

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37908 0.0 617 70 0 427 1 yfjD UPF0053 inner membrane protein YfjD Escherichia coli (strain K12)
Q57017 1.5e-168 482 54 3 421 1 HI_0107 UPF0053 protein HI_0107 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P74409 3.08e-45 166 27 8 415 3 sll0260 UPF0053 protein sll0260 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0AE45 2.43e-41 155 24 9 447 1 paeA Polyamine export protein Escherichia coli (strain K12)
P0AE46 2.43e-41 155 24 9 447 3 paeA Polyamine export protein Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE47 2.43e-41 155 24 9 447 3 paeA Polyamine export protein Escherichia coli O157:H7
Q84R21 1.1e-38 150 28 12 404 2 CBSDUFCH2 DUF21 domain-containing protein At1g55930, chloroplastic Arabidopsis thaliana
A0A0F6BAS6 2.24e-37 144 24 12 422 3 paeA Polyamine export protein Salmonella typhimurium (strain 14028s / SGSC 2262)
O07585 1.13e-35 139 25 5 407 3 yhdP UPF0053 protein YhdP Bacillus subtilis (strain 168)
O07589 3.86e-35 138 24 5 425 3 yhdT UPF0053 protein YhdT Bacillus subtilis (strain 168)
P44717 5.22e-35 137 24 9 414 3 paeA Polyamine export protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9LK65 6.54e-35 140 28 12 390 4 CBSDUFCH1 Putative DUF21 domain-containing protein At3g13070, chloroplastic Arabidopsis thaliana
P54428 1.31e-32 131 23 6 417 3 yrkA UPF0053 protein YrkA Bacillus subtilis (strain 168)
O05241 1.54e-31 128 24 8 427 3 yugS UPF0053 protein YugS Bacillus subtilis (strain 168)
P67131 1.1e-30 125 25 9 427 3 BQ2027_MB2387C UPF0053 protein Mb2387c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFP1 1.1e-30 125 25 9 427 1 Rv2366c UPF0053 protein Rv2366c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFP0 1.1e-30 125 25 9 427 3 MT2435 UPF0053 protein MT2435 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q54318 3.87e-29 117 31 4 237 3 tlyC Hemolysin C Brachyspira hyodysenteriae
P74078 2.5e-24 106 22 4 343 3 sll1254 UPF0053 protein sll1254 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P54505 1.56e-23 105 24 4 323 3 yqhB UPF0053 protein YqhB Bacillus subtilis (strain 168)
P9WFP2 2.49e-22 102 24 10 410 3 MT1890 UPF0053 protein MT1890 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WFP3 2.87e-22 102 24 10 410 1 Rv1842c UPF0053 protein Rv1842c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q57368 8.2e-21 95 25 4 250 3 corC Magnesium and cobalt efflux protein CorC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9CM13 3.97e-20 93 24 3 248 3 corC Magnesium and cobalt efflux protein CorC Pasteurella multocida (strain Pm70)
P57518 4.75e-20 93 24 3 244 3 corC Magnesium and cobalt efflux protein CorC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AC1 5.22e-20 92 24 4 244 3 corC Magnesium and cobalt efflux protein CorC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q9KTE3 1.14e-19 92 24 3 239 3 corC Magnesium and cobalt efflux protein CorC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0A2L3 6.82e-19 89 25 3 237 1 corC Magnesium and cobalt efflux protein CorC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2L4 6.82e-19 89 25 3 237 3 corC Magnesium and cobalt efflux protein CorC Salmonella typhi
P0AE81 9.55e-19 89 25 3 237 3 corC Magnesium and cobalt efflux protein CorC Shigella flexneri
P0AE78 9.55e-19 89 25 3 237 1 corC Magnesium and cobalt efflux protein CorC Escherichia coli (strain K12)
P0AE79 9.55e-19 89 25 3 237 3 corC Magnesium and cobalt efflux protein CorC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE80 9.55e-19 89 25 3 237 3 corC Magnesium and cobalt efflux protein CorC Escherichia coli O157:H7
Q8K9C0 3.51e-18 87 24 5 245 3 corC Magnesium and cobalt efflux protein CorC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q4UK99 3.95e-18 87 27 7 248 3 tlyC Hemolysin C Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q68W10 1.2e-17 86 28 9 252 1 tlyC Hemolysin C Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RGX2 1.85e-17 85 26 9 253 3 tlyC Possible hemolysin C Rickettsia bellii (strain RML369-C)
A8F2M1 3.87e-17 85 26 7 248 3 tlyC Hemolysin C homolog Rickettsia massiliae (strain Mtu5)
A8GPR9 4.28e-17 84 26 7 248 3 tlyC Possible hemolysin C Rickettsia akari (strain Hartford)
A8GUH1 8.61e-17 84 27 11 264 3 tlyC Possible hemolysin C Rickettsia bellii (strain OSU 85-389)
A8GTI4 9.63e-17 84 26 7 248 3 tlyC Hemolysin C homolog Rickettsia rickettsii (strain Sheila Smith)
Q92GI2 9.91e-17 84 27 8 251 3 tlyC Hemolysin C homolog Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P76389 1.99e-16 84 25 4 235 3 yegH UPF0053 protein YegH Escherichia coli (strain K12)
Q83KI8 2.09e-16 84 25 4 235 3 yegH UPF0053 protein YegH Shigella flexneri
O05961 2.15e-16 82 28 10 257 2 tlyC Hemolysin C Rickettsia prowazekii (strain Madrid E)
P0AEC0 1.74e-15 82 27 6 244 1 yoaE UPF0053 inner membrane protein YoaE Escherichia coli (strain K12)
P0AEC1 1.74e-15 82 27 6 244 3 yoaE UPF0053 inner membrane protein YoaE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC2 1.74e-15 82 27 6 244 3 yoaE UPF0053 inner membrane protein YoaE Escherichia coli O157:H7
A8EZU0 1.4e-14 77 25 8 247 3 tlyC Possible hemolysin C Rickettsia canadensis (strain McKiel)
Q49399 3.21e-14 77 23 8 331 3 MG146 UPF0053 protein MG146 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P57408 3.79e-14 77 25 9 260 3 BU323 UPF0053 protein BU323 Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P75586 4.17e-14 77 21 8 326 3 MPN_159 UPF0053 protein MG146 homolog Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q8VZI2 8.69e-14 76 24 9 345 1 CBSDUF6 DUF21 domain-containing protein At4g33700 Arabidopsis thaliana
Q89AI6 1.03e-13 76 24 7 254 3 bbp_300 UPF0053 protein bbp_300 Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8K9M0 1.5e-13 75 25 7 233 3 BUsg_314 UPF0053 protein BUsg_314 Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P9WLQ6 8.61e-12 69 23 9 328 3 MT1889 Uncharacterized protein MT1889 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WLQ7 1.37e-11 68 23 9 328 1 Rv1841c Uncharacterized protein Rv1841c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9ZQR4 1.05e-10 66 23 11 343 2 CBSDUF3 DUF21 domain-containing protein At2g14520 Arabidopsis thaliana
Q48445 2.16e-10 65 23 5 201 3 None UPF0053 protein in cps region (Fragment) Klebsiella pneumoniae
P0C588 4.23e-10 65 23 10 346 1 Cnnm4 Metal transporter CNNM4 Rattus norvegicus
Q6P4Q7 5.46e-10 65 24 11 331 1 CNNM4 Metal transporter CNNM4 Homo sapiens
Q9ZVS8 6.57e-10 64 25 12 305 4 CBSDUF4 Putative DUF21 domain-containing protein At1g03270 Arabidopsis thaliana
Q69ZF7 2.14e-09 63 23 10 328 1 Cnnm4 Metal transporter CNNM4 Mus musculus
Q9LTD8 3.07e-09 62 23 10 312 2 CBSDUF5 DUF21 domain-containing protein At5g52790 Arabidopsis thaliana
Q3TWN3 5.49e-09 62 21 9 349 1 Cnnm2 Metal transporter CNNM2 Mus musculus
Q12296 5.5e-09 62 24 14 365 1 MAM3 Protein MAM3 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q5U2P1 5.64e-09 62 21 9 349 2 Cnnm2 Metal transporter CNNM2 Rattus norvegicus
Q9H8M5 7.33e-09 61 21 8 346 1 CNNM2 Metal transporter CNNM2 Homo sapiens
Q67XQ0 9.91e-09 60 23 11 307 1 CBSDUF1 DUF21 domain-containing protein At4g14240 Arabidopsis thaliana
A0JPA0 6.06e-08 58 23 13 338 2 cnnm4 Metal transporter CNNM4 Xenopus tropicalis
A0A0B7P9G0 8.92e-08 58 21 10 338 1 uex Unextended protein Drosophila melanogaster
Q4V3C7 9.58e-07 54 24 15 394 2 CBSDUF2 DUF21 domain-containing protein At4g14230 Arabidopsis thaliana

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_11300
Feature type CDS
Gene corB
Product Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains
Location 17151 - 18443 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)
In genomic island -

Contig

Accession ZDB_526
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2078
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00571 CBS domain
PF01595 Cyclin M transmembrane N-terminal domain
PF03471 Transporter associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4536 Inorganic ion transport and metabolism (P) P Mg2+ and Co2+ transporter CorB, contains DUF21, CBS pair, and CorC-HlyC domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03699 magnesium and cobalt exporter, CNNM family - -

Protein Sequence

MEHVSTNTLIIILILLVIISAYFSASETGMMTINRYRLRHQAKQGNRAARRVERLLEKPDRLLSLILIGNNLVNIVASALGTIVGMRLYGNAGVAIATGVLTFVILVFAEVMPKTIAALYPQQVAFPSSFLLRPLAKICLPLVWAFNAITLILMRCIGIRGTVIRSDAVSKEELKTIVNESKGKLSRRNQDMLISILDLDKVSVDEIMVPRTEIIGIDINDEWKSILRQLTHSPHGRIVLYRDSLDDAIGMLRVREAYRLMIEKQEFTKQMLIKAADKVYFVPDSTPLNLQLVNFQRNNEKVGLVVDEYGDIQGLISVEDILEEIVGDFTTSMSPSLAEEVTRQPDGTLLIEGSANIREINKALNLSLPEEGARTINGLLLEELGDIPTLNTLVAVGNYQFEVVAIGENVIKTVKLSPLKPAGADIAADI

Flanking regions ( +/- flanking 50bp)

GGTCTCTGTAACGCCCTTTTCCGCTCATCACAAAAGAAAGGAACACCGCTGTGGAGCACGTCTCAACAAATACGCTGATTATTATTCTTATTTTATTAGTGATAATTTCAGCGTACTTTTCCGCATCCGAAACCGGGATGATGACAATCAACCGCTACCGGCTGCGCCATCAGGCCAAGCAGGGAAACCGGGCGGCCCGCCGTGTCGAGCGGTTGCTGGAGAAACCGGATCGTCTGCTGAGCCTCATTCTTATCGGTAATAACCTGGTGAATATTGTCGCCTCCGCACTGGGGACGATTGTCGGTATGCGCCTGTACGGTAACGCCGGTGTGGCTATCGCCACCGGGGTGCTGACCTTTGTCATCCTCGTGTTTGCCGAAGTGATGCCGAAAACCATTGCCGCACTCTATCCGCAGCAGGTCGCCTTTCCGAGCAGTTTTCTGCTGCGTCCGCTGGCAAAAATCTGTCTGCCGCTGGTCTGGGCATTTAACGCAATAACCCTGATTCTGATGCGCTGCATCGGTATCCGCGGCACCGTGATCCGCAGTGATGCAGTATCAAAAGAAGAACTGAAAACCATCGTTAATGAGTCCAAAGGTAAACTGTCCCGCCGCAACCAGGACATGCTGATCTCCATCCTCGATCTGGATAAAGTCAGTGTGGATGAGATTATGGTGCCGCGCACTGAGATCATCGGGATTGATATCAATGATGAATGGAAATCCATTCTGCGCCAGCTTACGCACTCACCGCACGGCCGGATAGTGCTCTACCGCGACTCGCTGGATGATGCCATCGGTATGCTGCGTGTCCGTGAAGCTTACCGGCTGATGATTGAGAAGCAGGAATTCACCAAGCAAATGCTTATCAAGGCCGCTGATAAAGTTTACTTTGTGCCGGACAGCACACCACTGAACTTACAGTTGGTCAATTTCCAGCGCAATAATGAAAAAGTCGGATTAGTTGTCGATGAGTACGGCGATATTCAGGGGCTTATCTCCGTGGAAGACATCCTGGAAGAAATTGTCGGTGATTTTACCACCTCAATGTCACCATCGCTGGCCGAGGAAGTCACCCGTCAGCCTGACGGCACGCTGCTGATTGAAGGTTCTGCCAATATCCGCGAAATCAATAAAGCCCTGAACCTCTCCCTGCCGGAAGAAGGCGCCCGAACCATTAACGGTCTTCTGCTGGAAGAGCTCGGTGATATCCCGACACTCAATACCCTTGTCGCTGTCGGGAACTATCAGTTTGAAGTGGTTGCCATCGGTGAGAATGTGATTAAAACGGTAAAACTGTCGCCGCTGAAACCGGCCGGTGCCGATATCGCTGCTGATATCTGAAAAAGATAAAAGACATAAAAAAACCTGCGACAGCAATGCGCGCAGGTTTT