Homologs in group_2036

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15275 FBDBKF_15275 75.7 Morganella morganii S1 gshA glutamate--cysteine ligase
EHELCC_10970 EHELCC_10970 75.7 Morganella morganii S2 gshA glutamate--cysteine ligase
NLDBIP_11315 NLDBIP_11315 75.7 Morganella morganii S4 gshA glutamate--cysteine ligase
LHKJJB_11175 LHKJJB_11175 75.7 Morganella morganii S3 gshA glutamate--cysteine ligase
HKOGLL_09785 HKOGLL_09785 75.7 Morganella morganii S5 gshA glutamate--cysteine ligase
F4V73_RS12170 F4V73_RS12170 76.5 Morganella psychrotolerans gshA glutamate--cysteine ligase

Distribution of the homologs in the orthogroup group_2036

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2036

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUV9 0.0 1095 100 0 526 3 gshA Glutamate--cysteine ligase Proteus mirabilis (strain HI4320)
Q7N7A4 0.0 821 73 0 518 3 gshA Glutamate--cysteine ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A8GA13 0.0 788 71 1 519 3 gshA Glutamate--cysteine ligase Serratia proteamaculans (strain 568)
Q66E64 0.0 786 71 0 518 3 gshA Glutamate--cysteine ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZBU2 0.0 784 71 0 518 3 gshA Glutamate--cysteine ligase Yersinia pestis
A1JK14 0.0 783 71 0 518 3 gshA Glutamate--cysteine ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DCQ5 0.0 755 69 1 514 3 gshA Glutamate--cysteine ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
C5BGG7 0.0 752 68 2 519 3 gshA Glutamate--cysteine ligase Edwardsiella ictaluri (strain 93-146)
Q6D1T4 0.0 746 68 1 514 3 gshA Glutamate--cysteine ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A6TCV4 0.0 737 67 1 518 3 gshA Glutamate--cysteine ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B2VHD0 0.0 734 67 2 516 3 gshA Glutamate--cysteine ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B5XVC3 0.0 734 66 1 518 3 gshA Glutamate--cysteine ligase Klebsiella pneumoniae (strain 342)
Q2NVK9 0.0 733 66 1 519 3 gshA Glutamate--cysteine ligase Sodalis glossinidius (strain morsitans)
A4WDQ2 0.0 733 67 2 518 3 gshA Glutamate--cysteine ligase Enterobacter sp. (strain 638)
O68838 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT00 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella schwarzengrund (strain CVM19633)
B5BEN1 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi A (strain AKU_12601)
C0PWL7 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi C (strain RKS4594)
A9N0B5 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PF10 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T394 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella newport (strain SL254)
B4TF06 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella heidelberg (strain SL476)
B5QV72 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella enteritidis PT4 (strain P125109)
B5FSX4 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella dublin (strain CT_02021853)
Q57KV3 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella choleraesuis (strain SC-B67)
B5F346 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Salmonella agona (strain SL483)
B5RDE8 0.0 729 66 1 518 3 gshA Glutamate--cysteine ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A7MJ27 0.0 729 66 1 518 3 gshA Glutamate--cysteine ligase Cronobacter sakazakii (strain ATCC BAA-894)
Q8Z4D6 0.0 728 66 1 518 3 gshA Glutamate--cysteine ligase Salmonella typhi
B7LVZ1 0.0 725 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A9MFZ5 0.0 724 66 1 517 3 gshA Glutamate--cysteine ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B7M9D0 0.0 723 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O8 (strain IAI1)
B7LEA4 0.0 723 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain 55989 / EAEC)
B7UHB1 0.0 723 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQC1 0.0 723 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T1B9 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Shigella flexneri serotype 5b (strain 8401)
Q32CN5 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R808 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain UTI89 / UPEC)
B6I679 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain SE11)
P0A6W9 0.0 722 66 1 518 1 gshA Glutamate--cysteine ligase Escherichia coli (strain K12)
B1IUY6 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6X0 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEI7 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A3H0 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O9:H4 (strain HS)
B1XCM1 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain K12 / DH10B)
C4ZYT8 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7MYJ3 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O81 (strain ED1a)
B7MKG2 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LPG3 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain SMS-3-5 / SECEC)
B7NSH3 0.0 722 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z2A3 0.0 721 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X900 0.0 721 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O157:H7
A8ANP6 0.0 721 66 1 518 3 gshA Glutamate--cysteine ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q31X58 0.0 721 66 1 518 3 gshA Glutamate--cysteine ligase Shigella boydii serotype 4 (strain Sb227)
Q3YYH0 0.0 721 66 1 517 3 gshA Glutamate--cysteine ligase Shigella sonnei (strain Ss046)
B7N6S3 0.0 720 66 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2U053 0.0 718 66 1 518 3 gshA Glutamate--cysteine ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1LTQ6 0.0 664 60 2 515 3 gshA Glutamate--cysteine ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q6LMV1 0.0 578 53 2 512 3 gshA Glutamate--cysteine ligase Photobacterium profundum (strain SS9)
A7MZY1 0.0 577 54 3 515 3 gshA Glutamate--cysteine ligase Vibrio campbellii (strain ATCC BAA-1116)
Q87LS2 0.0 575 54 3 515 3 gshA Glutamate--cysteine ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KUG5 0.0 575 55 3 500 3 gshA Glutamate--cysteine ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B6EGB3 0.0 568 54 5 515 3 gshA Glutamate--cysteine ligase Aliivibrio salmonicida (strain LFI1238)
B5FAD9 0.0 565 54 5 509 3 gshA Glutamate--cysteine ligase Aliivibrio fischeri (strain MJ11)
Q8DC38 0.0 563 53 3 515 3 gshA Glutamate--cysteine ligase Vibrio vulnificus (strain CMCP6)
Q7MHS5 0.0 563 53 3 515 3 gshA Glutamate--cysteine ligase Vibrio vulnificus (strain YJ016)
Q5E7F8 0.0 561 54 5 509 3 gshA Glutamate--cysteine ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B8D7U0 0.0 539 49 2 516 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9I8 0.0 539 49 2 516 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57485 0.0 538 49 2 516 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P58994 6.95e-178 513 48 4 520 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AD8 2.67e-171 497 48 4 519 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1S4F9 1.08e-169 493 49 5 503 3 gshA Glutamate--cysteine ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q8EBF9 6.31e-166 483 48 5 505 3 gshA Glutamate--cysteine ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q3IEB7 2.46e-165 482 45 5 522 3 gshA Glutamate--cysteine ligase Pseudoalteromonas translucida (strain TAC 125)
Q8D2V5 2.75e-165 481 46 2 507 3 gshA Glutamate--cysteine ligase Wigglesworthia glossinidia brevipalpis
B0TK23 3.98e-158 463 47 4 504 3 gshA Glutamate--cysteine ligase Shewanella halifaxensis (strain HAW-EB4)
A8H1U8 3.86e-154 453 46 4 504 3 gshA Glutamate--cysteine ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q0VSY7 2.71e-137 410 42 9 508 3 gshA Glutamate--cysteine ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C1DJH1 5.34e-134 402 42 6 507 3 gshA Glutamate--cysteine ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q21EP1 1.9e-131 395 42 8 506 3 gshA Glutamate--cysteine ligase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
A4VG81 1.55e-128 388 42 8 507 3 gshA Glutamate--cysteine ligase Stutzerimonas stutzeri (strain A1501)
Q2S8F7 2.16e-127 385 41 10 510 3 gshA Glutamate--cysteine ligase Hahella chejuensis (strain KCTC 2396)
A6VDX9 2.82e-124 377 41 8 500 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain PA7)
Q88R90 4.85e-124 376 39 6 517 3 gshA Glutamate--cysteine ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1IGL1 6.22e-123 374 39 8 523 3 gshA Glutamate--cysteine ligase Pseudomonas entomophila (strain L48)
Q88AR1 2.75e-121 369 40 9 496 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B7V3V0 4.35e-121 369 40 10 503 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain LESB58)
Q9HTY6 4.59e-121 369 40 10 503 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B1JET4 7.74e-121 368 40 7 517 3 gshA Glutamate--cysteine ligase Pseudomonas putida (strain W619)
Q02EG1 1.17e-120 367 40 9 503 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4KK14 3.1e-120 367 42 9 499 3 gshA Glutamate--cysteine ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q3KJQ5 6.32e-120 366 40 9 499 3 gshA Glutamate--cysteine ligase Pseudomonas fluorescens (strain Pf0-1)
P61379 1.54e-119 365 40 9 496 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. syringae
Q4ZZU4 4.98e-119 363 40 9 496 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. syringae (strain B728a)
A4XP63 6.37e-119 363 39 5 492 3 gshA Glutamate--cysteine ligase Pseudomonas mendocina (strain ymp)
Q48PX1 9.06e-118 360 39 9 496 3 gshA Glutamate--cysteine ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q7WES2 3.4e-117 358 39 8 516 3 gshA Glutamate--cysteine ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7W3F2 5.77e-117 358 39 8 516 3 gshA Glutamate--cysteine ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
A6SX59 7.09e-116 355 38 7 511 3 gshA Glutamate--cysteine ligase Janthinobacterium sp. (strain Marseille)
Q8F4D5 9.68e-111 342 41 6 475 3 gshA Glutamate--cysteine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RD4 1.44e-110 341 41 6 475 3 gshA Glutamate--cysteine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
A9HYE0 8.25e-110 340 38 10 515 3 gshA Glutamate--cysteine ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q97IV1 6.15e-85 274 37 5 411 3 gshA Glutamate--cysteine ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Y3R3 4.42e-60 214 30 11 470 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8XK30 2.63e-56 204 30 11 463 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Clostridium perfringens (strain 13 / Type A)
Q71VZ1 2.32e-55 201 29 11 470 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria monocytogenes serotype 4b (strain F2365)
Q926X7 3.89e-55 201 29 11 480 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AMA3 7.08e-54 197 29 11 479 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6ANW2 2.09e-49 185 31 12 449 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q8DW15 2.74e-47 179 28 13 449 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8DXM9 5.24e-47 177 28 15 451 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E399 5.24e-47 177 28 15 451 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus agalactiae serotype III (strain NEM316)
Q5M3J8 1.14e-45 174 28 14 473 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY5 1.4e-45 174 28 14 473 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus thermophilus (strain CNRZ 1066)
Q82ZG8 4.05e-45 172 27 15 474 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Enterococcus faecalis (strain ATCC 700802 / V583)
Q65RX0 6.71e-44 169 28 17 506 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CM00 1.14e-41 162 29 10 363 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Pasteurella multocida (strain Pm70)
Q88UW5 1.84e-18 92 24 15 399 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01835
Feature type CDS
Gene gshA
Product glutamate--cysteine ligase
Location 431843 - 433423 (strand: 1)
Length 1581 (nucleotides) / 526 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2036
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04262 Glutamate-cysteine ligase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2918 Coenzyme transport and metabolism (H) H Gamma-glutamylcysteine synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MIPDVSKALSWLEAHPKVLCGIHRGIERETLRVTPDGHLAATGHPVELGKSLTHKWITTDFAESLLEFITPVDDNIDHTLHFLSDLHRYTARHLTNERMWPMSMPCFIEAEDKITLAQFGTSNVGRFKTLYREGLKNRYGALMQTISGVHYNFSLPIEFWQAWANITDEETGKEAISDGYLRLIRNYYRFGWIIPFFFGASPAICGSFLKGRKTNLPFENTPKGAKYLPYATSLRLSDLGYTNKSQSDLDITFNHLETYVKGLKKAIHKPSEEFAKLGVKKDGKYIQLNTNVLQIENELYAPIRPKRVVKGDESPSDALLRGGIEYIEVRSLDINPFTPIGVDETQIRFLDLFLIWCVLADAPEMNAEELACCRANWNNVILEGRKPGQVIGMGCGERKEPLAQVGKALFADLQRVAKVLDSCSGTKYLEVCLKLEEMFDNPQLTFSGRLLEKIKAQGIGGYGLSLAEEYHQQLVNTAYEVLTDDAFEHERISSIKRQADLEKSDTISFDEYLKLHAGPNNDGVAS

Flanking regions ( +/- flanking 50bp)

AAAGTAACTGTTATCTACTTATTAACATTAACCAACGCGGGAGGTCACCTTTGATCCCGGACGTATCTAAAGCGCTTTCTTGGTTGGAAGCCCATCCTAAAGTTTTATGTGGTATCCACCGTGGTATAGAGCGAGAAACCTTAAGAGTTACTCCTGATGGTCATTTAGCGGCTACAGGACACCCTGTCGAGCTAGGTAAGTCACTCACTCACAAGTGGATCACGACAGATTTTGCTGAGTCTCTGTTAGAGTTTATTACTCCTGTTGACGATAATATTGATCACACCTTACATTTTTTAAGTGATTTGCATCGCTATACGGCACGTCATTTAACCAATGAGCGTATGTGGCCGATGAGTATGCCTTGCTTTATTGAAGCCGAAGATAAAATAACATTAGCGCAATTTGGTACCTCTAATGTTGGGCGTTTTAAGACGTTATATCGAGAAGGGCTGAAAAATCGTTATGGTGCGTTAATGCAAACTATTTCTGGTGTGCATTACAATTTTTCGTTACCTATCGAATTTTGGCAAGCGTGGGCAAATATCACCGATGAAGAAACAGGTAAAGAGGCGATTTCAGACGGTTATTTACGTTTGATCCGTAATTACTACCGTTTTGGTTGGATAATTCCTTTTTTCTTTGGTGCTTCGCCAGCTATTTGTGGTTCATTCTTAAAAGGTCGAAAAACCAATTTACCCTTTGAAAATACCCCTAAAGGCGCCAAATACTTACCTTATGCAACTTCGTTGCGCTTAAGTGATTTAGGCTATACCAATAAGTCACAGAGTGATTTAGATATTACTTTTAATCATCTAGAGACTTATGTGAAAGGTTTGAAAAAGGCTATTCATAAACCGTCAGAAGAATTTGCTAAATTAGGTGTAAAGAAAGACGGTAAGTATATTCAATTAAATACTAACGTATTACAAATTGAAAATGAATTATATGCGCCTATTCGTCCTAAACGCGTAGTCAAAGGGGATGAATCACCTTCTGATGCATTATTACGTGGTGGTATCGAATATATCGAGGTTCGCTCATTAGATATCAATCCATTTACGCCTATCGGCGTTGATGAAACACAAATCCGTTTCTTAGATTTATTCTTGATTTGGTGTGTATTAGCGGATGCACCAGAAATGAATGCAGAAGAATTGGCCTGCTGTCGTGCAAATTGGAATAACGTTATTCTAGAAGGGCGTAAGCCAGGTCAAGTTATTGGCATGGGTTGTGGTGAAAGAAAAGAGCCATTAGCACAAGTGGGGAAAGCGCTTTTTGCTGACTTACAGCGCGTAGCTAAGGTATTAGATAGCTGTTCTGGAACTAAATATCTAGAAGTTTGCCTTAAGTTAGAGGAAATGTTTGATAATCCGCAATTAACCTTCTCTGGCAGATTATTAGAAAAAATTAAAGCACAGGGTATTGGCGGTTATGGTCTATCTTTAGCTGAAGAATATCATCAACAATTAGTCAATACCGCTTATGAAGTGTTAACAGATGATGCTTTTGAACATGAGAGAATTTCATCTATTAAACGTCAGGCAGACTTAGAAAAGAGTGATACCATTTCTTTCGATGAATATTTGAAGCTCCATGCTGGGCCAAATAATGATGGTGTGGCTTCTTAAAACTCAGATAGAAAAAAGCCACACTAAAATTTGTGTGGCTGAATAAATTC