Homologs in group_2076

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15275 FBDBKF_15275 94.6 Morganella morganii S1 gshA glutamate--cysteine ligase
EHELCC_10970 EHELCC_10970 94.6 Morganella morganii S2 gshA glutamate--cysteine ligase
NLDBIP_11315 NLDBIP_11315 94.6 Morganella morganii S4 gshA glutamate--cysteine ligase
LHKJJB_11175 LHKJJB_11175 94.6 Morganella morganii S3 gshA glutamate--cysteine ligase
HKOGLL_09785 HKOGLL_09785 94.6 Morganella morganii S5 gshA glutamate--cysteine ligase
PMI_RS01835 PMI_RS01835 76.5 Proteus mirabilis HI4320 gshA glutamate--cysteine ligase

Distribution of the homologs in the orthogroup group_2076

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2076

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUV9 0.0 851 76 0 518 3 gshA Glutamate--cysteine ligase Proteus mirabilis (strain HI4320)
Q7N7A4 0.0 789 71 0 518 3 gshA Glutamate--cysteine ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JK14 0.0 786 71 0 519 3 gshA Glutamate--cysteine ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q66E64 0.0 784 71 0 519 3 gshA Glutamate--cysteine ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZBU2 0.0 782 71 0 519 3 gshA Glutamate--cysteine ligase Yersinia pestis
A8GA13 0.0 776 70 1 519 3 gshA Glutamate--cysteine ligase Serratia proteamaculans (strain 568)
C6DCQ5 0.0 763 69 1 515 3 gshA Glutamate--cysteine ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D1T4 0.0 754 69 1 515 3 gshA Glutamate--cysteine ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5XVC3 0.0 745 69 1 518 3 gshA Glutamate--cysteine ligase Klebsiella pneumoniae (strain 342)
A6TCV4 0.0 743 69 1 518 3 gshA Glutamate--cysteine ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WDQ2 0.0 741 69 2 518 3 gshA Glutamate--cysteine ligase Enterobacter sp. (strain 638)
B2VHD0 0.0 736 68 2 515 3 gshA Glutamate--cysteine ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
O68838 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT00 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella schwarzengrund (strain CVM19633)
B5BEN1 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi A (strain AKU_12601)
A9N0B5 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PF10 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T394 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella newport (strain SL254)
B4TF06 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella heidelberg (strain SL476)
B5QV72 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella enteritidis PT4 (strain P125109)
B5FSX4 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella dublin (strain CT_02021853)
Q57KV3 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella choleraesuis (strain SC-B67)
B5F346 0.0 735 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella agona (strain SL483)
C0PWL7 0.0 734 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi C (strain RKS4594)
C5BGG7 0.0 734 68 2 519 3 gshA Glutamate--cysteine ligase Edwardsiella ictaluri (strain 93-146)
A8ANP6 0.0 734 68 1 518 3 gshA Glutamate--cysteine ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LVZ1 0.0 734 68 1 518 3 gshA Glutamate--cysteine ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B5RDE8 0.0 733 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A9MFZ5 0.0 733 68 1 517 3 gshA Glutamate--cysteine ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8Z4D6 0.0 732 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella typhi
Q2NVK9 0.0 731 66 1 520 3 gshA Glutamate--cysteine ligase Sodalis glossinidius (strain morsitans)
B1LPG3 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain SMS-3-5 / SECEC)
B7NSH3 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7LEA4 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain 55989 / EAEC)
B7UHB1 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZQC1 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q0T1B9 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Shigella flexneri serotype 5b (strain 8401)
Q32CN5 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R808 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain UTI89 / UPEC)
B6I679 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain SE11)
P0A6W9 0.0 731 67 1 518 1 gshA Glutamate--cysteine ligase Escherichia coli (strain K12)
B1IUY6 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6X0 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEI7 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A3H0 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O9:H4 (strain HS)
B1XCM1 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain K12 / DH10B)
C4ZYT8 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7MYJ3 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O81 (strain ED1a)
B7MKG2 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7M9D0 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O8 (strain IAI1)
B5Z2A3 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X900 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O157:H7
Q3YYH0 0.0 730 68 1 517 3 gshA Glutamate--cysteine ligase Shigella sonnei (strain Ss046)
A7MJ27 0.0 730 67 1 515 3 gshA Glutamate--cysteine ligase Cronobacter sakazakii (strain ATCC BAA-894)
B7N6S3 0.0 728 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2U053 0.0 726 67 1 518 3 gshA Glutamate--cysteine ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q31X58 0.0 726 67 1 518 3 gshA Glutamate--cysteine ligase Shigella boydii serotype 4 (strain Sb227)
Q1LTQ6 0.0 642 59 2 516 3 gshA Glutamate--cysteine ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
A7MZY1 0.0 599 56 3 514 3 gshA Glutamate--cysteine ligase Vibrio campbellii (strain ATCC BAA-1116)
Q87LS2 0.0 588 55 3 514 3 gshA Glutamate--cysteine ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5FAD9 0.0 579 55 3 507 3 gshA Glutamate--cysteine ligase Aliivibrio fischeri (strain MJ11)
B6EGB3 0.0 577 54 3 514 3 gshA Glutamate--cysteine ligase Aliivibrio salmonicida (strain LFI1238)
Q5E7F8 0.0 575 55 3 507 3 gshA Glutamate--cysteine ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6LMV1 0.0 571 53 2 512 3 gshA Glutamate--cysteine ligase Photobacterium profundum (strain SS9)
Q8DC38 0.0 569 53 3 516 3 gshA Glutamate--cysteine ligase Vibrio vulnificus (strain CMCP6)
Q7MHS5 0.0 568 53 3 516 3 gshA Glutamate--cysteine ligase Vibrio vulnificus (strain YJ016)
Q9KUG5 0.0 565 53 3 507 3 gshA Glutamate--cysteine ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B8D7U0 0.0 531 47 2 515 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9I8 0.0 531 47 2 515 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57485 0.0 530 47 2 515 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P58994 0.0 523 48 4 513 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AD8 1.78e-180 520 48 4 519 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1S4F9 5.8e-169 491 50 5 502 3 gshA Glutamate--cysteine ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q3IEB7 6.68e-169 490 47 5 516 3 gshA Glutamate--cysteine ligase Pseudoalteromonas translucida (strain TAC 125)
Q8EBF9 9.23e-159 464 49 7 506 3 gshA Glutamate--cysteine ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8D2V5 7.69e-158 461 43 4 508 3 gshA Glutamate--cysteine ligase Wigglesworthia glossinidia brevipalpis
B0TK23 1.41e-157 461 48 4 502 3 gshA Glutamate--cysteine ligase Shewanella halifaxensis (strain HAW-EB4)
A8H1U8 1.23e-151 446 47 7 504 3 gshA Glutamate--cysteine ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q21EP1 3.26e-137 410 44 7 504 3 gshA Glutamate--cysteine ligase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VSY7 4.35e-136 407 43 11 508 3 gshA Glutamate--cysteine ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
C1DJH1 1.88e-134 403 44 6 508 3 gshA Glutamate--cysteine ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
A4VG81 7.23e-129 388 44 10 510 3 gshA Glutamate--cysteine ligase Stutzerimonas stutzeri (strain A1501)
Q2S8F7 9.28e-127 383 41 7 505 3 gshA Glutamate--cysteine ligase Hahella chejuensis (strain KCTC 2396)
Q7W3F2 1.27e-126 382 42 8 510 3 gshA Glutamate--cysteine ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WES2 1.59e-126 382 42 8 510 3 gshA Glutamate--cysteine ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q1IGL1 6.88e-126 381 40 7 518 3 gshA Glutamate--cysteine ligase Pseudomonas entomophila (strain L48)
Q88R90 1.59e-125 380 40 8 523 3 gshA Glutamate--cysteine ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A6VDX9 1.16e-124 377 41 7 498 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain PA7)
Q3KJQ5 4.68e-124 376 41 7 504 3 gshA Glutamate--cysteine ligase Pseudomonas fluorescens (strain Pf0-1)
B7V3V0 8.36e-123 373 41 7 498 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain LESB58)
Q9HTY6 9.41e-123 373 41 7 498 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88AR1 9.48e-123 373 40 10 508 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q4KK14 1.13e-122 372 41 7 507 3 gshA Glutamate--cysteine ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q02EG1 3.19e-122 371 42 9 500 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
B1JET4 1.23e-119 365 39 6 518 3 gshA Glutamate--cysteine ligase Pseudomonas putida (strain W619)
A4XP63 1.73e-119 364 40 6 495 3 gshA Glutamate--cysteine ligase Pseudomonas mendocina (strain ymp)
P61379 2.39e-119 364 40 10 508 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. syringae
Q48PX1 3.73e-119 363 39 10 508 3 gshA Glutamate--cysteine ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q4ZZU4 7.93e-119 363 39 10 508 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. syringae (strain B728a)
A9HYE0 7.98e-119 362 40 9 515 3 gshA Glutamate--cysteine ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A6SX59 2.19e-114 351 39 5 511 3 gshA Glutamate--cysteine ligase Janthinobacterium sp. (strain Marseille)
Q8F4D5 1.45e-106 331 42 5 437 3 gshA Glutamate--cysteine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RD4 2.7e-106 330 42 5 437 3 gshA Glutamate--cysteine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q97IV1 9.98e-85 273 36 5 441 3 gshA Glutamate--cysteine ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Y3R3 1.97e-59 213 29 10 472 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8XK30 1.06e-57 208 29 12 476 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Clostridium perfringens (strain 13 / Type A)
Q71VZ1 2.98e-57 206 29 10 472 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria monocytogenes serotype 4b (strain F2365)
Q926X7 4.54e-57 206 29 10 472 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
A0AMA3 1.07e-55 202 29 11 473 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8DXM9 1.95e-50 187 28 13 470 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E399 1.95e-50 187 28 13 470 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus agalactiae serotype III (strain NEM316)
Q8DW15 4.39e-49 183 28 12 452 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5M3J8 5.56e-49 183 30 13 471 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY5 5.72e-49 183 30 13 471 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus thermophilus (strain CNRZ 1066)
Q82ZG8 6.87e-48 180 28 14 463 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Enterococcus faecalis (strain ATCC 700802 / V583)
Q6ANW2 2.44e-47 179 30 13 462 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q9CM00 3.71e-44 169 28 12 439 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Pasteurella multocida (strain Pm70)
Q65RX0 2.57e-43 167 27 12 438 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q88UW5 4.55e-21 100 26 16 392 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS12170
Feature type CDS
Gene gshA
Product glutamate--cysteine ligase
Location 18522 - 20081 (strand: -1)
Length 1560 (nucleotides) / 519 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000003
Length 425895 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2076
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04262 Glutamate-cysteine ligase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2918 Coenzyme transport and metabolism (H) H Gamma-glutamylcysteine synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MIPDVSKALSWLETHPRILKGINRGIERETLRVTPDGHLARTGHPDGLGKSLTHKWITTDFAESLLEFITPVDSRIDYTVKFLRDVHRYTARHLKNERMWPLSMPCFIDSEDAIELAQFGTSNTGRLKTLYREGLKNRYGALMQTISGVHYNFSLPMEFWQAWSGVSGEEDGKDKISDGYFRLIRNYYRFGWVIPYLFGASPAICSSFLRGRETNLPFETLPKGALYLPYATSLRLSDLGYTNKSQSELNITFNHLDTYVAGLKKAIQIPSEEFAAMGLTKDGKHLQINANVLQIENEFYAPIRPKRVQKGDESPSDALQRGGVEYIEVRALDINPFSATGVDETQIRFLDLFLIWCVLADAPEMSAEELACARHNWNRVILEGRKPGQVIGIGCGREKQPLQKVGHALFNDLLRVADVLDSCSGTHYREVCEALTAQFDDPELTFSGRMLALIKEAGIGSYGLALADRYHDELSHESYEVISEADFEEQRQASVDKQKAMEESDTLSFDEYLALHGGR

Flanking regions ( +/- flanking 50bp)

TAAAGTATCCCTCTTATGAATAACATCTATTATCAGCACGGGAGGTCGATTTGATCCCGGATGTATCTAAAGCGCTCTCATGGTTAGAGACGCACCCCCGAATTTTAAAAGGCATCAATCGTGGTATTGAGCGCGAAACACTTCGTGTCACACCCGATGGCCACCTTGCACGTACCGGTCATCCGGACGGCTTAGGCAAATCATTAACCCATAAGTGGATCACGACAGATTTCGCTGAATCATTGCTGGAATTTATTACGCCGGTTGACTCGCGTATAGATTACACAGTGAAGTTTCTGCGTGATGTCCACCGCTACACGGCCCGCCACCTGAAAAATGAGCGTATGTGGCCGCTGAGCATGCCGTGTTTTATTGATTCAGAAGACGCCATTGAGCTGGCGCAGTTCGGCACATCAAATACAGGACGTTTAAAAACCCTGTACCGCGAAGGCCTGAAAAACCGCTACGGCGCTCTGATGCAGACTATTTCAGGTGTGCATTATAACTTCTCTCTGCCGATGGAATTCTGGCAGGCGTGGAGTGGCGTCAGTGGCGAAGAAGATGGCAAAGATAAAATTTCAGATGGCTATTTCCGTCTGATCCGCAACTACTACCGTTTTGGCTGGGTTATTCCGTATCTGTTTGGTGCATCCCCGGCAATCTGCAGTTCTTTCCTGCGCGGGCGTGAAACCAATCTGCCGTTTGAAACATTGCCGAAAGGCGCGTTATACCTGCCGTACGCCACGTCACTGCGTTTAAGTGACCTCGGGTATACCAACAAGTCGCAAAGCGAACTGAACATCACCTTCAATCATCTGGACACCTATGTCGCCGGGCTGAAGAAGGCGATTCAGATCCCGTCTGAAGAATTTGCCGCAATGGGATTGACCAAAGACGGAAAACACCTTCAGATCAATGCTAACGTGTTGCAGATTGAAAACGAGTTCTATGCACCTATCCGCCCTAAACGTGTCCAGAAAGGCGATGAGTCGCCTTCTGATGCATTGCAGCGCGGTGGCGTTGAATATATTGAAGTCCGTGCGCTGGATATCAACCCGTTCTCCGCAACCGGTGTGGATGAAACTCAGATCCGTTTCCTCGATTTGTTCCTTATCTGGTGTGTGCTGGCTGATGCACCGGAAATGAGTGCAGAGGAGCTTGCCTGCGCCCGCCATAACTGGAATCGTGTGATTCTGGAAGGCCGGAAACCGGGGCAGGTTATCGGGATTGGCTGCGGTCGTGAAAAACAACCCTTGCAAAAAGTAGGTCACGCACTGTTTAATGACCTTCTGCGTGTTGCAGATGTGTTAGATTCTTGTTCAGGTACGCATTACCGCGAGGTGTGCGAAGCATTAACAGCGCAGTTTGACGATCCGGAGCTGACGTTCTCTGGTCGTATGCTGGCGCTGATAAAAGAAGCAGGCATCGGAAGTTATGGTCTGGCATTAGCGGACCGGTATCACGATGAGCTGAGCCACGAGTCGTATGAAGTGATCAGTGAAGCTGACTTTGAAGAACAACGGCAGGCTTCTGTTGATAAGCAAAAAGCAATGGAAGAGAGTGATACGCTGAGTTTTGATGAGTATCTGGCGCTGCATGGCGGTCGTTAGTCTCTGGCAGATAAGAAAATGGCCACAAATATGTGGCCAAAAAAAATATC