Homologs in group_2036

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15275 FBDBKF_15275 100.0 Morganella morganii S1 gshA glutamate--cysteine ligase
EHELCC_10970 EHELCC_10970 100.0 Morganella morganii S2 gshA glutamate--cysteine ligase
NLDBIP_11315 NLDBIP_11315 100.0 Morganella morganii S4 gshA glutamate--cysteine ligase
LHKJJB_11175 LHKJJB_11175 100.0 Morganella morganii S3 gshA glutamate--cysteine ligase
F4V73_RS12170 F4V73_RS12170 94.6 Morganella psychrotolerans gshA glutamate--cysteine ligase
PMI_RS01835 PMI_RS01835 75.7 Proteus mirabilis HI4320 gshA glutamate--cysteine ligase

Distribution of the homologs in the orthogroup group_2036

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2036

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4EUV9 0.0 842 75 0 518 3 gshA Glutamate--cysteine ligase Proteus mirabilis (strain HI4320)
Q7N7A4 0.0 799 72 0 518 3 gshA Glutamate--cysteine ligase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A1JK14 0.0 795 72 0 519 3 gshA Glutamate--cysteine ligase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q66E64 0.0 788 71 0 519 3 gshA Glutamate--cysteine ligase Yersinia pseudotuberculosis serotype I (strain IP32953)
A8GA13 0.0 787 71 1 519 3 gshA Glutamate--cysteine ligase Serratia proteamaculans (strain 568)
Q8ZBU2 0.0 786 71 0 519 3 gshA Glutamate--cysteine ligase Yersinia pestis
C6DCQ5 0.0 768 70 1 515 3 gshA Glutamate--cysteine ligase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D1T4 0.0 761 69 1 515 3 gshA Glutamate--cysteine ligase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B5XVC3 0.0 751 69 1 518 3 gshA Glutamate--cysteine ligase Klebsiella pneumoniae (strain 342)
A6TCV4 0.0 750 69 1 518 3 gshA Glutamate--cysteine ligase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A4WDQ2 0.0 743 68 2 518 3 gshA Glutamate--cysteine ligase Enterobacter sp. (strain 638)
A7MJ27 0.0 742 69 1 515 3 gshA Glutamate--cysteine ligase Cronobacter sakazakii (strain ATCC BAA-894)
C5BGG7 0.0 741 69 2 519 3 gshA Glutamate--cysteine ligase Edwardsiella ictaluri (strain 93-146)
O68838 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT00 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella schwarzengrund (strain CVM19633)
B5BEN1 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi A (strain AKU_12601)
A9N0B5 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PF10 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T394 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella newport (strain SL254)
B4TF06 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella heidelberg (strain SL476)
B5QV72 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella enteritidis PT4 (strain P125109)
B5FSX4 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella dublin (strain CT_02021853)
Q57KV3 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella choleraesuis (strain SC-B67)
B5F346 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella agona (strain SL483)
C0PWL7 0.0 740 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella paratyphi C (strain RKS4594)
B5RDE8 0.0 738 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8Z4D6 0.0 737 68 1 518 3 gshA Glutamate--cysteine ligase Salmonella typhi
A9MFZ5 0.0 736 68 1 517 3 gshA Glutamate--cysteine ligase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
B2VHD0 0.0 736 67 2 515 3 gshA Glutamate--cysteine ligase Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7LVZ1 0.0 734 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
A8ANP6 0.0 733 67 1 518 3 gshA Glutamate--cysteine ligase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q0T1B9 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Shigella flexneri serotype 5b (strain 8401)
B5Z2A3 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X900 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O157:H7
B7LEA4 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain 55989 / EAEC)
A7ZQC1 0.0 731 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q32CN5 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Shigella dysenteriae serotype 1 (strain Sd197)
Q1R808 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain UTI89 / UPEC)
B1LPG3 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain SMS-3-5 / SECEC)
B6I679 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain SE11)
P0A6W9 0.0 730 67 1 518 1 gshA Glutamate--cysteine ligase Escherichia coli (strain K12)
B1IUY6 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P0A6X0 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TEI7 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A3H0 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O9:H4 (strain HS)
B1XCM1 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain K12 / DH10B)
C4ZYT8 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli (strain K12 / MC4100 / BW2952)
B7MYJ3 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O81 (strain ED1a)
B7NSH3 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MKG2 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UHB1 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q3YYH0 0.0 730 67 1 517 3 gshA Glutamate--cysteine ligase Shigella sonnei (strain Ss046)
B7M9D0 0.0 730 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O8 (strain IAI1)
B7N6S3 0.0 728 67 1 518 3 gshA Glutamate--cysteine ligase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q2NVK9 0.0 726 66 1 520 3 gshA Glutamate--cysteine ligase Sodalis glossinidius (strain morsitans)
Q31X58 0.0 726 67 1 518 3 gshA Glutamate--cysteine ligase Shigella boydii serotype 4 (strain Sb227)
B2U053 0.0 726 67 1 518 3 gshA Glutamate--cysteine ligase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q1LTQ6 0.0 644 59 2 516 3 gshA Glutamate--cysteine ligase Baumannia cicadellinicola subsp. Homalodisca coagulata
A7MZY1 0.0 588 55 3 514 3 gshA Glutamate--cysteine ligase Vibrio campbellii (strain ATCC BAA-1116)
Q87LS2 0.0 582 55 3 514 3 gshA Glutamate--cysteine ligase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5FAD9 0.0 574 54 3 507 3 gshA Glutamate--cysteine ligase Aliivibrio fischeri (strain MJ11)
B6EGB3 0.0 572 53 3 514 3 gshA Glutamate--cysteine ligase Aliivibrio salmonicida (strain LFI1238)
Q5E7F8 0.0 571 54 3 507 3 gshA Glutamate--cysteine ligase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q7MHS5 0.0 566 52 3 516 3 gshA Glutamate--cysteine ligase Vibrio vulnificus (strain YJ016)
Q9KUG5 0.0 566 53 3 507 3 gshA Glutamate--cysteine ligase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8DC38 0.0 564 52 3 516 3 gshA Glutamate--cysteine ligase Vibrio vulnificus (strain CMCP6)
Q6LMV1 0.0 563 52 2 512 3 gshA Glutamate--cysteine ligase Photobacterium profundum (strain SS9)
B8D7U0 0.0 527 47 2 515 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
B8D9I8 0.0 527 47 2 515 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
P57485 0.0 526 47 2 515 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P58994 5.99e-179 516 48 4 513 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q89AD8 3.29e-178 514 48 4 519 3 gshA Glutamate--cysteine ligase Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
A1S4F9 1.56e-169 492 50 5 502 3 gshA Glutamate--cysteine ligase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q3IEB7 1.73e-169 492 47 5 516 3 gshA Glutamate--cysteine ligase Pseudoalteromonas translucida (strain TAC 125)
Q8EBF9 4.54e-164 478 50 5 504 3 gshA Glutamate--cysteine ligase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B0TK23 2.58e-160 468 49 4 500 3 gshA Glutamate--cysteine ligase Shewanella halifaxensis (strain HAW-EB4)
Q8D2V5 3.85e-156 457 43 3 508 3 gshA Glutamate--cysteine ligase Wigglesworthia glossinidia brevipalpis
A8H1U8 4.48e-154 452 47 5 502 3 gshA Glutamate--cysteine ligase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
C1DJH1 1.71e-135 405 43 6 508 3 gshA Glutamate--cysteine ligase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q21EP1 2.59e-135 405 44 7 504 3 gshA Glutamate--cysteine ligase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q0VSY7 3.23e-135 404 42 10 513 3 gshA Glutamate--cysteine ligase Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q2S8F7 3.66e-129 389 41 7 506 3 gshA Glutamate--cysteine ligase Hahella chejuensis (strain KCTC 2396)
Q7W3F2 7.21e-129 388 42 8 510 3 gshA Glutamate--cysteine ligase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WES2 1.36e-128 387 42 8 510 3 gshA Glutamate--cysteine ligase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A4VG81 5.18e-127 384 43 11 513 3 gshA Glutamate--cysteine ligase Stutzerimonas stutzeri (strain A1501)
Q1IGL1 4.05e-126 381 40 7 521 3 gshA Glutamate--cysteine ligase Pseudomonas entomophila (strain L48)
Q88R90 1.23e-125 380 39 6 518 3 gshA Glutamate--cysteine ligase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88AR1 1.62e-125 380 40 8 504 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A6VDX9 7.2e-124 375 41 7 498 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain PA7)
Q3KJQ5 7.95e-124 375 40 7 505 3 gshA Glutamate--cysteine ligase Pseudomonas fluorescens (strain Pf0-1)
Q9HTY6 5.43e-123 373 41 7 498 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V3V0 5.73e-123 373 41 7 498 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain LESB58)
P61379 7.55e-123 373 40 8 504 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. syringae
Q48PX1 1.19e-122 373 40 8 504 3 gshA Glutamate--cysteine ligase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q02EG1 1.9e-122 372 41 9 500 3 gshA Glutamate--cysteine ligase Pseudomonas aeruginosa (strain UCBPP-PA14)
Q4ZZU4 2.5e-122 372 40 8 504 3 gshA Glutamate--cysteine ligase Pseudomonas syringae pv. syringae (strain B728a)
Q4KK14 7.49e-122 370 40 7 508 3 gshA Glutamate--cysteine ligase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
B1JET4 6.44e-121 368 40 6 518 3 gshA Glutamate--cysteine ligase Pseudomonas putida (strain W619)
A4XP63 9.28e-121 367 40 6 495 3 gshA Glutamate--cysteine ligase Pseudomonas mendocina (strain ymp)
A9HYE0 1.83e-118 362 40 10 516 3 gshA Glutamate--cysteine ligase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
A6SX59 2.12e-114 351 39 5 511 3 gshA Glutamate--cysteine ligase Janthinobacterium sp. (strain Marseille)
Q8F4D5 3.32e-108 335 42 5 437 3 gshA Glutamate--cysteine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72RD4 5.27e-108 334 42 5 437 3 gshA Glutamate--cysteine ligase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q97IV1 3.18e-82 266 35 5 451 3 gshA Glutamate--cysteine ligase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8Y3R3 2.85e-60 215 30 10 467 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q71VZ1 2.56e-58 209 29 10 467 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria monocytogenes serotype 4b (strain F2365)
Q926X7 1.01e-57 208 30 11 467 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8XK30 1.51e-56 204 29 11 471 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Clostridium perfringens (strain 13 / Type A)
A0AMA3 5.39e-56 203 29 11 468 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q8DXM9 1.05e-54 199 30 14 477 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E399 1.05e-54 199 30 14 477 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus agalactiae serotype III (strain NEM316)
Q82ZG8 4.47e-52 192 28 16 502 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Enterococcus faecalis (strain ATCC 700802 / V583)
Q8DW15 4.76e-50 186 29 12 451 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q5M3J8 8.64e-49 182 30 13 471 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5LYY5 9.63e-49 182 30 13 471 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Streptococcus thermophilus (strain CNRZ 1066)
Q65RX0 1.4e-47 179 28 12 438 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q9CM00 1.47e-46 176 29 13 444 1 gshAB Glutathione biosynthesis bifunctional protein GshAB Pasteurella multocida (strain Pm70)
Q6ANW2 5.18e-46 175 29 12 452 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Desulfotalea psychrophila (strain LSv54 / DSM 12343)
Q88UW5 3.35e-22 104 25 19 490 3 gshAB Glutathione biosynthesis bifunctional protein GshAB Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_09785
Feature type CDS
Gene gshA
Product glutamate--cysteine ligase
Location 19195 - 20754 (strand: -1)
Length 1560 (nucleotides) / 519 (amino acids)

Contig

Accession ZDB_687
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2036
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF04262 Glutamate-cysteine ligase

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG2918 Coenzyme transport and metabolism (H) H Gamma-glutamylcysteine synthetase

Kegg Ortholog Annotation(s)

Protein Sequence

MIPDVSKALSWLETHPRILKGINRGIERETLRITPDGALARTGHPEGLGKSLTHKWITTDFAESLLEFITPVDSRIDYTVKFLRDVHRYTARHLNNERMWPLSMPCFIDSEEHIELAQFGTSNAGRFKTLYREGLKNRYGALMQTISGVHYNFSLPMEFWQAWSGISDAQSGKDKISDGYFRLIRNYYRFGWVIPYLFGASPAICSSFLRGRKTNLPFETLPKGALYLPYATSLRLSDLGYTNKSQSDLNITFNHLDTYVAGLKNAIQIPSEEFAALGLTKDGKHLQINANVLQIENEFYAPIRPKRVQKGDESPSDALQRGGVEYIEVRALDINPFSATGVDETQIRFLDLFLIWCVLADAPEMSADELACARHNWNRVILEGRKPGQEIGIGCGREKQPLQKVGHALFNDLLRVADVLDTCSGTQYREVCEALKAQFDDPELTFSGRMLALIKEAGIGSYGLALADRYHEELTHEPYEVISEADFAEQWQASVDKQKAMEESDTISFDEYLALHGGR

Flanking regions ( +/- flanking 50bp)

TAAAGTATCCCTCTTATGAATAATATCCATTATCAGGACGGGAGGTCGATTTGATCCCGGATGTATCCAAAGCGCTCTCATGGTTAGAGACGCACCCCCGGATTTTAAAAGGCATCAACCGCGGCATTGAGCGCGAAACACTGCGTATCACGCCGGATGGTGCTCTGGCACGTACCGGTCACCCGGAAGGGCTGGGAAAATCATTAACCCATAAGTGGATCACCACGGACTTTGCCGAGTCACTGCTGGAGTTTATTACCCCGGTGGATTCGCGTATTGATTACACCGTGAAATTTCTGCGTGATGTGCATCGCTACACTGCGCGTCATCTGAACAATGAACGGATGTGGCCGCTGAGCATGCCATGCTTCATTGATTCTGAAGAGCATATCGAACTGGCGCAGTTCGGCACATCCAATGCCGGCCGTTTCAAGACACTGTACCGTGAAGGACTTAAAAACCGCTATGGTGCGCTGATGCAGACCATTTCCGGTGTCCACTATAACTTCTCTCTGCCGATGGAATTCTGGCAGGCGTGGAGCGGTATCAGCGATGCACAGAGCGGCAAGGATAAAATCTCCGACGGCTACTTCCGCCTGATCCGCAACTATTACCGTTTCGGCTGGGTGATCCCGTATCTGTTCGGTGCTTCGCCGGCAATCTGCAGCTCGTTCCTGCGCGGCCGCAAAACTAATCTGCCGTTTGAAACGCTGCCGAAAGGGGCGTTATACCTGCCGTATGCCACGTCACTGCGTTTAAGTGACCTCGGTTATACCAACAAGTCACAAAGTGATCTGAACATCACCTTCAACCATCTGGACACATATGTTGCCGGGCTGAAGAATGCCATTCAGATCCCGTCTGAAGAATTTGCCGCACTGGGATTAACCAAAGACGGAAAACACCTTCAGATTAACGCCAACGTCCTGCAGATTGAAAACGAGTTCTATGCCCCTATCCGGCCGAAGCGTGTGCAGAAAGGTGATGAGTCACCGTCTGACGCCTTACAGCGCGGCGGGGTGGAGTATATCGAAGTCCGTGCCCTGGATATCAACCCGTTCTCTGCCACCGGTGTCGATGAAACACAAATCCGTTTCCTCGACCTGTTCCTTATCTGGTGTGTGCTGGCGGATGCGCCGGAAATGAGCGCGGATGAGCTGGCGTGTGCCCGCCATAACTGGAATCGTGTGATTCTTGAAGGGCGTAAACCGGGACAGGAAATCGGTATCGGCTGCGGTCGTGAAAAACAACCCTTGCAAAAAGTGGGTCACGCACTGTTTAATGATCTCCTGCGTGTTGCCGATGTGTTAGATACCTGCTCAGGCACACAGTATCGCGAAGTGTGCGAAGCACTGAAAGCACAGTTTGATGACCCGGAACTGACGTTCTCGGGGCGGATGCTGGCGCTGATAAAAGAAGCGGGTATCGGAAGTTACGGGCTGGCCCTGGCAGATCGGTATCATGAAGAACTGACTCACGAGCCGTATGAAGTGATCAGTGAAGCAGACTTTGCTGAACAATGGCAGGCTTCTGTCGATAAACAAAAAGCGATGGAAGAGAGTGATACGATAAGTTTTGATGAGTATCTGGCGCTGCACGGCGGTCGCTGATTTCTGACAGATAAGAAAATGGCCACAATCAATGTGGCCAAAATAAATCT