Homologs in group_1847

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_13815 FBDBKF_13815 61.5 Morganella morganii S1 hpaR homoprotocatechuate degradation operon regulator HpaR
EHELCC_11485 EHELCC_11485 61.5 Morganella morganii S2 hpaR homoprotocatechuate degradation operon regulator HpaR
NLDBIP_11830 NLDBIP_11830 61.5 Morganella morganii S4 hpaR homoprotocatechuate degradation operon regulator HpaR
LHKJJB_11690 LHKJJB_11690 61.5 Morganella morganii S3 hpaR homoprotocatechuate degradation operon regulator HpaR
HKOGLL_10300 HKOGLL_10300 61.5 Morganella morganii S5 hpaR homoprotocatechuate degradation operon regulator HpaR
F4V73_RS12680 F4V73_RS12680 60.4 Morganella psychrotolerans hpaR homoprotocatechuate degradation operon regulator HpaR

Distribution of the homologs in the orthogroup group_1847

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1847

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P62574 2.01e-63 193 63 0 136 3 hpcR Homoprotocatechuate degradative operon repressor Shigella flexneri
P62573 2.01e-63 193 63 0 136 4 hpcR Homoprotocatechuate degradative operon repressor Escherichia coli
P0DPR8 3.42e-41 137 48 0 121 1 farR HTH-type transcriptional regulator FarR Neisseria gonorrhoeae
O07458 6.26e-08 52 29 3 115 1 badR Transcriptional activatory protein BadR Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P62086 1.53e-05 45 27 0 79 4 SAV2265 Uncharacterized HTH-type transcriptional regulator SAV2265 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HDU4 1.53e-05 45 27 0 79 4 SACOL2256 Uncharacterized HTH-type transcriptional regulator SACOL2256 Staphylococcus aureus (strain COL)
P62087 1.53e-05 45 27 0 79 4 SA2060 Uncharacterized HTH-type transcriptional regulator SA2060 Staphylococcus aureus (strain N315)
Q6GEG9 1.58e-05 45 27 0 79 1 SAR2349 Uncharacterized HTH-type transcriptional regulator SAR2349 Staphylococcus aureus (strain MRSA252)
Q8NVA6 1.73e-05 45 27 0 79 4 MW2183 Uncharacterized HTH-type transcriptional regulator MW2183 Staphylococcus aureus (strain MW2)
Q6G757 1.73e-05 45 27 0 79 4 SAS2155 Uncharacterized HTH-type transcriptional regulator SAS2155 Staphylococcus aureus (strain MSSA476)
Q7ABA6 7.52e-05 43 29 0 77 3 hosA Transcriptional regulator HosA Escherichia coli O157:H7
Q93CC3 8.42e-05 43 29 0 77 3 hosA Transcriptional regulator HosA Escherichia coli
P69782 8.42e-05 43 29 0 77 1 hosA Transcriptional regulator HosA Escherichia coli O127:H6 (strain E2348/69 / EPEC)
O31541 0.000117 43 26 1 79 1 yetL HTH-type transcriptional repressor YetL Bacillus subtilis (strain 168)
Q7A1J9 0.000129 42 24 1 99 3 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain MW2)
P0C1S0 0.000129 42 24 1 99 1 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus
Q6GBE4 0.000129 42 24 1 99 3 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain MSSA476)
Q6GIV6 0.000129 42 24 1 99 3 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain MRSA252)
Q7A6X2 0.000129 42 24 1 99 1 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain N315)
Q99VT5 0.000129 42 24 1 99 3 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HHY2 0.000129 42 24 1 99 3 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain COL)
Q2G0B1 0.000129 42 24 1 99 1 mgrA HTH-type transcriptional regulator MgrA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q9F8R8 0.000165 42 29 0 77 3 hosA Transcriptional regulator HosA Escherichia coli O111:H-
O34777 0.000299 42 26 0 82 1 ohrR Organic hydroperoxide resistance transcriptional regulator Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS01205
Feature type CDS
Gene hpaR
Product homoprotocatechuate degradation operon regulator HpaR
Location 295772 - 296209 (strand: 1)
Length 438 (nucleotides) / 145 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1847
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01047 MarR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1846 Transcription (K) K DNA-binding transcriptional regulator, MarR family

Protein Sequence

MHESLTIALLQARESAMGFFRPVLKEHNLTEQQWRIIRVLADKRSIDFHELAQKTCILRPSLTGILIRMERDELICRLKPVSDQRKLFVSLSTNGQNLYDKIQPKIEEGYQLLEQKFSTEKLQHLSILLKELIALNPENSHSTEK

Flanking regions ( +/- flanking 50bp)

AGATTGAGTGATTTTTCATCAATTTATCTATCAATAAAGAGCTTCTGATTATGCATGAGTCATTAACAATCGCGCTATTGCAAGCACGGGAATCTGCGATGGGATTTTTTCGCCCCGTTCTTAAAGAGCATAATCTGACAGAGCAGCAGTGGCGGATCATCCGAGTTCTTGCTGATAAGCGCTCTATCGATTTTCACGAATTAGCACAAAAAACCTGTATCCTGCGTCCAAGTTTGACAGGTATTTTGATTAGAATGGAAAGAGATGAGCTAATTTGTCGATTAAAACCAGTGAGTGATCAACGTAAATTATTCGTTTCTCTATCAACCAATGGGCAAAATTTATATGATAAAATCCAGCCTAAGATAGAAGAAGGGTACCAATTACTCGAACAAAAGTTTTCTACAGAAAAACTGCAACATTTATCTATCTTACTGAAAGAACTGATAGCGTTAAATCCAGAAAATAGTCATTCAACTGAAAAATAACATGTGTGCACCAAGAAAAAAGAGATGATGTTATACCATCATCTCTTTTG