Homologs in group_396

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_15400 FBDBKF_15400 89.2 Morganella morganii S1 rbsB ribose ABC transporter substrate-binding protein RbsB
EHELCC_15760 EHELCC_15760 89.2 Morganella morganii S2 rbsB ribose ABC transporter substrate-binding protein RbsB
NLDBIP_16610 NLDBIP_16610 89.2 Morganella morganii S4 rbsB ribose ABC transporter substrate-binding protein RbsB
LHKJJB_16195 LHKJJB_16195 89.2 Morganella morganii S3 rbsB ribose ABC transporter substrate-binding protein RbsB
HKOGLL_15965 HKOGLL_15965 89.2 Morganella morganii S5 rbsB ribose ABC transporter substrate-binding protein RbsB
F4V73_RS09115 F4V73_RS09115 31.9 Morganella psychrotolerans - substrate-binding domain-containing protein
F4V73_RS17745 F4V73_RS17745 89.5 Morganella psychrotolerans rbsB ribose ABC transporter substrate-binding protein RbsB

Distribution of the homologs in the orthogroup group_396

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_396

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P02925 3.25e-167 468 77 0 296 1 rbsB Ribose import binding protein RbsB Escherichia coli (strain K12)
P0A2C5 1.7e-166 466 77 0 296 1 rbsB Ribose import binding protein RbsB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2C6 1.7e-166 466 77 0 296 3 rbsB Ribose import binding protein RbsB Salmonella typhi
P44737 3.42e-142 405 66 1 293 1 rbsB Ribose import binding protein RbsB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P36949 1.51e-89 271 50 2 269 1 rbsB Ribose import binding protein RbsB Bacillus subtilis (strain 168)
A6VKQ8 7.24e-36 134 33 4 246 1 Asuc_0175 D-apiose import binding protein Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
P39265 1.09e-35 133 34 7 286 1 alsB D-allose-binding periplasmic protein Escherichia coli (strain K12)
B1G898 3.62e-35 132 32 3 281 1 BgramDRAFT_5566 D-apiose import binding protein Paraburkholderia graminis (strain ATCC 700544 / DSM 17151 / LMG 18924 / NCIMB 13744 / C4D1M)
B9JK76 7.89e-35 131 32 6 266 3 Arad_9233 D-apiose import binding protein Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q9I2F8 4.32e-34 129 34 13 322 1 rbsB D-ribose/D-allose-binding protein Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2JZQ5 6.5e-34 129 30 3 269 1 RHE_PF00037 D-apiose import binding protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
P39325 1.24e-27 112 31 6 256 1 ytfQ Galactofuranose-binding protein YtfQ Escherichia coli (strain K12)
P49308 4.11e-27 110 29 5 290 3 mocB Putative rhizopine-binding protein Rhizobium meliloti
A0QYB3 1.65e-24 104 29 3 249 1 xypA Xylitol-binding protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A0QYB5 1.46e-22 99 28 2 215 1 thpA D-threitol-binding protein Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9F9B2 7.05e-22 97 29 9 306 1 frcB Fructose import binding protein FrcB Rhizobium meliloti
Q8G848 5.75e-20 91 27 8 279 1 fruE Fructose import binding protein FruE Bifidobacterium longum (strain NCC 2705)
Q9K6K2 2.05e-19 90 29 7 220 3 rbsR Ribose operon repressor Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A5UCM9 5.89e-15 77 27 7 222 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain PittEE)
Q4QL70 5.89e-15 77 27 7 222 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain 86-028NP)
B0BP99 8.66e-15 77 27 9 229 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
P0ACQ3 1.8e-14 75 26 6 220 3 rbsR Ribose operon repressor Shigella flexneri
P0ACQ0 1.8e-14 75 26 6 220 1 rbsR Ribose operon repressor Escherichia coli (strain K12)
P0ACQ1 1.8e-14 75 26 6 220 3 rbsR Ribose operon repressor Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ2 1.8e-14 75 26 6 220 3 rbsR Ribose operon repressor Escherichia coli O157:H7
A5UIZ0 4.22e-14 75 27 8 222 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain PittGG)
P46456 1.07e-13 73 27 7 222 3 purR HTH-type transcriptional repressor PurR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
B3H1F6 1.09e-13 73 27 9 229 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3N0H9 1.09e-13 73 27 9 229 3 purR HTH-type transcriptional repressor PurR Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q7VL44 1.29e-13 73 26 9 231 3 purR HTH-type transcriptional repressor PurR Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9JMQ1 2.92e-13 72 27 11 252 2 exuR Probable HTH-type transcriptional repressor ExuR Bacillus subtilis (strain 168)
B5BKD9 3.89e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi A (strain AKU_12601)
Q5PH15 3.89e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
O68446 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TUY8 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella schwarzengrund (strain CVM19633)
C0Q5V2 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi C (strain RKS4594)
A9N0Y2 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4TH70 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella heidelberg (strain SL476)
B5RAM9 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5QV29 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella enteritidis PT4 (strain P125109)
B5FIH3 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella dublin (strain CT_02021853)
Q57PK6 3.93e-12 69 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella choleraesuis (strain SC-B67)
C5BE45 4.31e-12 68 25 8 279 3 purR HTH-type transcriptional repressor PurR Edwardsiella ictaluri (strain 93-146)
Q8Z6P1 4.48e-12 68 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella typhi
B4T567 4.48e-12 68 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella newport (strain SL254)
B5F6L7 4.48e-12 68 26 8 280 3 purR HTH-type transcriptional repressor PurR Salmonella agona (strain SL483)
A6VNL0 9.88e-12 68 27 11 283 3 purR HTH-type transcriptional repressor PurR Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
A8GDV6 1.32e-11 67 23 8 280 3 purR HTH-type transcriptional repressor PurR Serratia proteamaculans (strain 568)
B8F4D0 1.42e-11 67 24 8 270 3 purR HTH-type transcriptional repressor PurR Glaesserella parasuis serovar 5 (strain SH0165)
A1JP52 1.64e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
B1JJ59 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66A32 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TIQ4 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pestis (strain Pestoides F)
Q1CIL0 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pestis bv. Antiqua (strain Nepal516)
A9QZB3 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pestis bv. Antiqua (strain Angola)
Q7CIS2 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pestis
B2K5I4 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FHK2 1.83e-11 67 23 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B5XWL8 2.01e-11 67 24 10 303 3 purR HTH-type transcriptional repressor PurR Klebsiella pneumoniae (strain 342)
A9MEJ1 4.18e-11 66 25 9 304 3 purR HTH-type transcriptional repressor PurR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
A7MFD3 6.8e-11 65 24 10 306 3 purR HTH-type transcriptional repressor PurR Cronobacter sakazakii (strain ATCC BAA-894)
Q0I4B4 7.37e-11 65 25 9 227 3 purR HTH-type transcriptional repressor PurR Histophilus somni (strain 129Pt)
Q7N3V8 7.46e-11 65 23 9 305 3 purR HTH-type transcriptional repressor PurR Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P37387 7.61e-11 65 26 9 277 1 xylF D-xylose-binding periplasmic protein Escherichia coli (strain K12)
Q8FH72 7.89e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RBD7 8.04e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain UTI89 / UPEC)
Q0THG9 8.04e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1ABJ9 8.04e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O1:K1 / APEC
B7MVD4 8.04e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O81 (strain ED1a)
B7MA12 8.04e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7URZ9 8.04e-11 65 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
B4EWM9 9.51e-11 65 24 9 281 3 purR HTH-type transcriptional repressor PurR Proteus mirabilis (strain HI4320)
A7ZMC4 1.68e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O139:H28 (strain E24377A / ETEC)
P0ACP9 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Shigella flexneri
Q0T4B4 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Shigella flexneri serotype 5b (strain 8401)
Q321B7 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Shigella boydii serotype 4 (strain Sb227)
B2U2G3 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B1LEM6 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain SMS-3-5 / SECEC)
B6IB98 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain SE11)
B7NBB1 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P0ACP7 1.71e-10 64 25 9 304 1 purR HTH-type transcriptional repressor PurR Escherichia coli (strain K12)
B1IQ96 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A0K5 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O9:H4 (strain HS)
C4ZYC2 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain K12 / MC4100 / BW2952)
B7M0L5 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O8 (strain IAI1)
B7NTX5 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z492 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O157:H7 (strain EC4115 / EHEC)
P0ACP8 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli O157:H7
B7L5L1 1.71e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia coli (strain 55989 / EAEC)
Q32FB3 1.86e-10 64 25 9 304 3 purR HTH-type transcriptional repressor PurR Shigella dysenteriae serotype 1 (strain Sd197)
P44329 2.29e-10 63 26 5 222 3 rbsR Ribose operon repressor Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3Z213 2.93e-10 63 25 9 304 3 purR HTH-type transcriptional repressor PurR Shigella sonnei (strain Ss046)
Q9CN88 3.33e-10 63 24 9 227 3 purR HTH-type transcriptional repressor PurR Pasteurella multocida (strain Pm70)
Q1C774 4.94e-10 63 22 9 302 3 purR HTH-type transcriptional repressor PurR Yersinia pestis bv. Antiqua (strain Antiqua)
B7LQA9 5.12e-10 63 24 9 304 3 purR HTH-type transcriptional repressor PurR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B2VEM5 7.09e-10 62 25 6 222 3 purR HTH-type transcriptional repressor PurR Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
P55568 9.87e-10 62 23 6 225 3 NGR_a02500 Probable ABC transporter periplasmic-binding protein y4mI Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B0UUN7 1.08e-09 62 25 9 227 3 purR HTH-type transcriptional repressor PurR Histophilus somni (strain 2336)
A6TA06 1.39e-09 61 24 9 279 3 purR HTH-type transcriptional repressor PurR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
Q9CPA2 1.95e-09 61 23 6 221 3 rbsR Ribose operon repressor Pasteurella multocida (strain Pm70)
C6DK36 2.04e-09 61 25 4 219 3 purR HTH-type transcriptional repressor PurR Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q65TP0 2.97e-09 60 24 8 228 3 purR HTH-type transcriptional repressor PurR Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
O87590 3.37e-09 60 34 5 146 4 celR HTH-type transcriptional regulator CelR Thermobifida fusca
Q6D5W3 4.38e-09 60 24 5 221 3 purR HTH-type transcriptional repressor PurR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P45047 7.03e-09 59 24 8 298 3 xylF D-xylose-binding periplasmic protein Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23925 7.93e-09 59 24 8 277 3 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Citrobacter freundii
P23905 9.44e-09 59 25 10 278 1 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEE7 5.38e-08 57 24 8 277 3 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Shigella flexneri
P0AEE5 5.38e-08 57 24 8 277 1 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Escherichia coli (strain K12)
P0AEE6 5.38e-08 57 24 8 277 3 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P77615 7.98e-08 56 26 8 199 4 ycjW Uncharacterized HTH-type transcriptional regulator YcjW Escherichia coli (strain K12)
P43472 1.21e-07 55 23 7 221 3 scrR Sucrose operon repressor Pediococcus pentosaceus
Q9KLK6 1.29e-07 55 23 2 173 3 luxP Autoinducer 2-binding periplasmic protein LuxP Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
C3LN44 1.54e-07 55 24 6 221 3 purR HTH-type transcriptional repressor PurR Vibrio cholerae serotype O1 (strain M66-2)
Q9KRC1 1.54e-07 55 24 6 221 3 purR HTH-type transcriptional repressor PurR Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F7H0 1.54e-07 55 24 6 221 3 purR HTH-type transcriptional repressor PurR Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P36944 1.6e-07 55 25 6 216 4 rbsR Ribose operon repressor Bacillus subtilis (strain 168)
P37947 1.69e-07 55 25 8 250 1 degA HTH-type transcriptional regulator DegA Bacillus subtilis (strain 168)
P0A2P8 3.91e-07 54 24 5 190 3 cra Catabolite repressor/activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2P9 3.91e-07 54 24 5 190 3 cra Catabolite repressor/activator Salmonella typhi
B6EH86 7.8e-07 53 23 6 221 3 purR HTH-type transcriptional repressor PurR Aliivibrio salmonicida (strain LFI1238)
P0ACP4 7.97e-07 53 23 9 242 3 cra Catabolite repressor/activator Shigella flexneri
P0ACP1 7.97e-07 53 23 9 242 1 cra Catabolite repressor/activator Escherichia coli (strain K12)
P0ACP2 7.97e-07 53 23 9 242 3 cra Catabolite repressor/activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACP3 7.97e-07 53 23 9 242 3 cra Catabolite repressor/activator Escherichia coli O157:H7
B7VMG4 1.28e-06 52 23 7 221 3 purR HTH-type transcriptional repressor PurR Vibrio atlanticus (strain LGP32)
A8A069 1.3e-06 52 26 11 298 3 lsrB Autoinducer 2-binding protein LsrB Escherichia coli O9:H4 (strain HS)
P25144 3.68e-06 51 24 10 277 1 ccpA Catabolite control protein A Bacillus subtilis (strain 168)
B1IRU4 4.96e-06 50 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P44883 6.12e-06 50 23 9 312 1 mglB D-galactose/methyl-galactoside binding periplasmic protein MglB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7MJ57 7.54e-06 50 24 6 221 3 purR HTH-type transcriptional repressor PurR Vibrio vulnificus (strain YJ016)
Q8DAQ5 7.54e-06 50 24 6 221 3 purR HTH-type transcriptional repressor PurR Vibrio vulnificus (strain CMCP6)
Q6LQB9 1.02e-05 50 21 6 219 3 purR HTH-type transcriptional repressor PurR Photobacterium profundum (strain SS9)
P50844 1.04e-05 50 23 11 276 1 kdgR HTH-type transcriptional regulator KdgR Bacillus subtilis (strain 168)
Q5E4H9 1.61e-05 49 23 7 220 3 purR HTH-type transcriptional repressor PurR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q87GU4 1.9e-05 49 28 0 105 3 luxP Autoinducer 2-binding periplasmic protein LuxP Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5FF00 2.06e-05 48 23 7 220 3 purR HTH-type transcriptional repressor PurR Aliivibrio fischeri (strain MJ11)
P39343 2.23e-05 48 30 7 150 4 idnR HTH-type transcriptional regulator IdnR Escherichia coli (strain K12)
B1LF99 2.42e-05 48 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Escherichia coli (strain SMS-3-5 / SECEC)
P76142 2.42e-05 48 25 11 298 1 lsrB Autoinducer 2-binding protein LsrB Escherichia coli (strain K12)
B1XEA4 2.42e-05 48 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Escherichia coli (strain K12 / DH10B)
Q8XAY9 2.42e-05 48 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Escherichia coli O157:H7
P46828 5.21e-05 47 23 10 271 1 ccpA Catabolite control protein A Priestia megaterium
O05103 6.82e-05 47 23 8 232 4 None HTH-type transcriptional regulator MalR Clostridium butyricum
Q8D5Z5 0.000118 46 25 1 132 3 luxP Autoinducer 2-binding periplasmic protein LuxP Vibrio vulnificus (strain CMCP6)
P58358 0.000133 46 22 8 292 3 torT Periplasmic protein TorT Escherichia coli O157:H7
P38683 0.000135 46 22 8 278 1 torT Periplasmic protein TorT Escherichia coli (strain K12)
Q9S470 0.000142 46 24 10 232 3 araR Arabinose metabolism transcriptional repressor Geobacillus stearothermophilus
P54300 0.00015 46 26 0 105 1 luxP Autoinducer 2-binding periplasmic protein LuxP Vibrio harveyi
P0C888 0.000156 46 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Shigella flexneri serotype 5b (strain 8401)
A7ZLX3 0.000156 46 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Escherichia coli O139:H28 (strain E24377A / ETEC)
Q7MD15 0.000164 46 25 1 132 3 luxP Autoinducer 2-binding periplasmic protein LuxP Vibrio vulnificus (strain YJ016)
P0CL11 0.000203 45 23 8 251 3 galR HTH-type transcriptional regulator GalR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
E1WAQ4 0.000203 45 23 8 251 3 galR HTH-type transcriptional regulator GalR Salmonella typhimurium (strain SL1344)
P0C887 0.000206 45 25 11 298 3 lsrB Autoinducer 2-binding protein LsrB Shigella flexneri
P03023 0.000224 45 25 9 203 1 lacI Lactose operon repressor Escherichia coli (strain K12)
P03024 0.000266 45 22 8 251 1 galR HTH-type transcriptional regulator GalR Escherichia coli (strain K12)
P06220 0.000838 44 32 3 98 4 lacI Lactose operon repressor (Fragment) Klebsiella pneumoniae

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00430
Feature type CDS
Gene rbsB
Product ribose ABC transporter substrate-binding protein RbsB
Location 116397 - 117287 (strand: -1)
Length 891 (nucleotides) / 296 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_396
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF13407 Periplasmic binding protein domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1879 Carbohydrate transport and metabolism (G) G ABC-type sugar transport system, periplasmic component, contains N-terminal xre family HTH domain

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K10439 ribose transport system substrate-binding protein ABC transporters
Bacterial chemotaxis		 -

Protein Sequence

MKLKKIATLLSVVALSATISANALAKESIALVISTLNNPFFVTMKDSAQKEADKLGYDLVVLDSMDNPAKELANVQDLTVKGTRLMLINPTDSDAVGNAVLMANKAKIPVVTLDRVANKGEVVSHVASDNRLGGKMAGDYIAEKVGNDAKVIQLEGIAGTSASRERGEGFKQAVDAHKLNILASQPADFDRTKGLNVMQNLLTANPSVQAVFAQNDEMALGALRALQTAGRTDVLVVGFDGTNDGIKAVNRGVLGATIAQRPDQIGIIGIQTADKILKGEKVDPTIPVELELVTQK

Flanking regions ( +/- flanking 50bp)

ACAAAAAATAATACGCTTTCTCTTAATCCGAACCCCGACAGGAATATATTATGAAACTAAAAAAAATAGCAACGCTTCTCTCAGTGGTTGCTCTAAGCGCTACCATAAGTGCCAATGCATTAGCAAAAGAGTCTATCGCCCTCGTTATTTCAACGCTCAATAATCCTTTCTTTGTCACCATGAAAGACAGTGCACAAAAAGAGGCGGATAAATTAGGTTATGACTTAGTCGTACTTGATTCAATGGATAATCCAGCCAAAGAATTGGCAAATGTGCAGGACTTAACCGTAAAAGGCACCCGTTTAATGCTCATTAATCCAACGGATTCTGATGCTGTAGGTAATGCCGTGTTAATGGCAAATAAAGCTAAAATTCCTGTAGTAACCCTAGATAGAGTAGCCAATAAAGGTGAGGTTGTTAGCCATGTTGCTTCTGATAACCGCCTAGGAGGAAAAATGGCGGGAGATTATATTGCGGAAAAAGTGGGTAATGATGCCAAAGTGATCCAACTAGAAGGGATCGCCGGAACCTCCGCTTCTCGTGAGCGTGGAGAAGGCTTTAAACAAGCTGTTGATGCTCACAAACTTAATATATTAGCAAGCCAACCTGCTGACTTTGACCGTACTAAAGGCCTTAATGTTATGCAAAATCTATTAACCGCTAATCCTTCAGTGCAAGCGGTATTTGCTCAAAACGATGAAATGGCATTAGGGGCATTGCGTGCATTACAAACTGCAGGTCGTACCGATGTCTTAGTTGTTGGCTTCGATGGCACAAATGATGGCATTAAAGCGGTTAACCGAGGTGTTTTAGGTGCGACTATTGCACAACGCCCCGATCAAATTGGTATTATTGGTATTCAAACCGCTGATAAAATTCTGAAAGGGGAAAAAGTGGATCCCACTATTCCTGTTGAGCTTGAATTAGTCACTCAAAAATAATCACCCATCTAACCACGTAGTACTTTCACTGCGTGGTTAGTTTCGTTATA