Homologs in group_2266

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17430 FBDBKF_17430 65.6 Morganella morganii S1 phoR phosphate regulon sensor histidine kinase PhoR
EHELCC_17325 EHELCC_17325 65.6 Morganella morganii S2 phoR phosphate regulon sensor histidine kinase PhoR
NLDBIP_17870 NLDBIP_17870 65.6 Morganella morganii S4 phoR phosphate regulon sensor histidine kinase PhoR
LHKJJB_17790 LHKJJB_17790 65.6 Morganella morganii S3 phoR phosphate regulon sensor histidine kinase PhoR
HKOGLL_17800 HKOGLL_17800 65.6 Morganella morganii S5 phoR phosphate regulon sensor histidine kinase PhoR
F4V73_RS16605 F4V73_RS16605 65.3 Morganella psychrotolerans phoR phosphate regulon sensor histidine kinase PhoR

Distribution of the homologs in the orthogroup group_2266

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2266

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P45608 0.0 584 63 0 427 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P08400 0.0 566 64 0 428 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P45609 0.0 563 63 0 428 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P71380 3.98e-98 303 40 3 413 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23621 3.52e-89 280 42 5 393 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0QR01 8.6e-41 152 36 3 244 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P35164 1.78e-40 155 31 8 329 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
Q8DPL8 7.09e-40 151 31 6 341 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 7.09e-40 151 31 6 341 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P23545 5.82e-39 150 36 5 245 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
A5A2P0 7.16e-38 145 30 8 346 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
Q45614 4.13e-36 143 35 5 243 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P9WGK5 1.26e-35 139 34 3 243 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 1.26e-35 139 34 3 243 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 1.26e-35 139 34 3 243 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54883 8.54e-35 137 34 4 246 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q9RDT3 1.06e-33 134 27 6 342 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q7A5H7 5.42e-33 134 32 5 244 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 5.42e-33 134 32 5 244 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q9L523 6.33e-33 134 32 5 244 1 srrB Sensor protein SrrB Staphylococcus aureus
Q6GKS6 6.46e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q8NWF3 6.65e-33 134 32 5 244 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 6.65e-33 134 32 5 244 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 6.65e-33 134 32 5 244 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 6.65e-33 134 32 5 244 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GGK7 7.54e-33 134 32 5 244 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
Q7A215 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 7.68e-33 134 28 6 336 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 7.68e-33 134 28 6 336 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 7.68e-33 134 28 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
A6QD58 2.51e-32 132 27 6 336 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q4LAJ8 4.8e-30 125 26 5 336 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
Q4A159 6.26e-30 125 27 7 342 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8CU87 1.36e-29 124 26 6 350 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.36e-29 124 26 6 350 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
O69729 1.46e-29 123 32 4 242 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q49ZT9 7.25e-29 120 30 5 231 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q55932 2.74e-28 119 33 4 222 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0DMK6 3.58e-27 116 33 7 221 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
I1WSZ3 7.69e-27 115 32 5 214 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
O34638 9.12e-27 115 33 4 220 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
A0A0H3GPN8 2.94e-26 113 33 4 212 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
P0AE82 4.85e-26 112 31 3 216 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 4.85e-26 112 31 3 216 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 4.85e-26 112 31 3 216 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
P30847 5.12e-26 113 30 6 253 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
Q8KIY1 4.54e-25 111 30 9 280 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 0.001 45 24 10 235 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P20169 2.41e-24 109 33 7 251 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P94414 2.49e-24 108 30 9 257 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
O34206 8.94e-24 107 27 11 362 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
Q6GGZ4 1.59e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q7A0W5 1.61e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 1.61e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 1.61e-23 105 30 3 224 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 1.61e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 1.61e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 1.61e-23 105 30 3 224 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 1.61e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q2YY04 1.72e-23 105 30 3 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q47745 2.52e-23 105 29 1 207 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
A5W4E3 5.48e-23 105 29 7 279 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 3.62e-05 50 23 6 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
E0X9C7 5.64e-23 105 29 7 279 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 3.43e-05 50 23 7 230 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
P48027 1.06e-22 104 30 7 244 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
O34989 2.07e-22 103 28 7 245 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
P37894 3.84e-22 102 33 9 244 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q4L8M0 4.8e-22 101 28 4 227 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
Q8FK37 5.68e-22 101 30 1 217 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9ZHD4 8.83e-22 100 31 5 213 3 silS Probable sensor kinase SilS Salmonella typhimurium
Q9HUI3 9.02e-22 101 31 7 243 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9RQQ9 1.28e-21 101 27 5 269 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
O31661 1.77e-21 100 24 11 403 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
Q9F8D7 6.65e-21 99 29 7 244 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
Q54SP4 6.87e-21 99 26 12 409 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 1.27e-11 70 24 6 289 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P77485 7.05e-21 98 29 1 217 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q44930 2.04e-20 95 29 6 245 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
Q8XBY4 2.45e-20 96 28 1 218 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q9KHI5 4.91e-20 96 31 7 234 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8CSL7 5.88e-20 95 27 5 235 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPC4 6.82e-20 95 27 5 235 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q5HLN1 8.35e-20 94 28 4 212 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8GP19 8.84e-20 94 31 7 212 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
P51392 1.06e-19 95 30 8 252 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
P39664 2.37e-19 92 29 3 221 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P14377 4.13e-19 92 28 4 216 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q8CRA8 4.44e-19 92 28 4 212 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q8NV46 5.17e-19 92 28 4 229 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 5.17e-19 92 28 4 229 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
Q1XD95 5.46e-19 93 29 9 252 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q54YZ9 6.54e-19 93 30 12 301 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
Q93CB7 6.74e-19 92 29 7 252 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P0A4I6 7.02e-19 92 29 5 233 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 7.02e-19 92 29 5 233 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q4L6C5 9.06e-19 91 28 4 224 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
Q49XM6 1.02e-18 91 28 4 221 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q55630 1.14e-18 90 28 7 247 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B1WYT4 1.17e-18 90 29 5 228 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q742C0 1.47e-18 91 31 9 230 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q8CTI3 1.69e-18 89 25 6 255 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 1.69e-18 89 25 6 255 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B7KFU0 1.83e-18 90 28 6 224 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
Q6GE72 1.88e-18 90 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
O14002 2e-18 92 27 5 230 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q08430 2.1e-18 90 24 6 245 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
Q9APE0 2.24e-18 90 28 6 218 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
A0QBR0 2.29e-18 90 31 9 230 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q06067 2.42e-18 90 23 13 367 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
P39764 2.46e-18 90 25 6 283 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
Q2T0V9 2.95e-18 90 29 5 228 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q03228 4.24e-18 90 28 6 271 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
A8Z553 4.31e-18 89 28 4 229 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 4.31e-18 89 28 4 229 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 4.31e-18 89 28 4 229 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 4.31e-18 89 28 4 229 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 4.31e-18 89 28 4 229 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
Q7A3X0 4.6e-18 89 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 4.6e-18 89 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 4.6e-18 89 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 4.6e-18 89 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 4.6e-18 89 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P30855 4.94e-18 90 23 15 393 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
A0PWB3 5.21e-18 89 32 7 216 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
P0AEC4 5.33e-18 90 29 13 272 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 5.33e-18 90 29 13 272 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
Q8DMT2 5.64e-18 88 29 7 225 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P58363 5.67e-18 90 29 13 272 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
P9WGK8 5.97e-18 89 26 5 247 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 5.97e-18 89 26 5 247 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGK9 6.25e-18 89 26 5 247 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P58402 1.05e-17 89 24 17 401 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q8YR50 1.15e-17 87 26 5 227 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q3M8A7 1.49e-17 87 26 5 227 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P42245 1.7e-17 86 26 2 226 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q08408 1.85e-17 87 26 5 235 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
B2J946 1.89e-17 87 27 7 247 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A0QTK3 1.97e-17 88 28 7 245 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P74111 2.16e-17 88 29 6 231 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P30844 3.79e-17 85 29 7 226 1 basS Sensor protein BasS Escherichia coli (strain K12)
P26762 4.98e-17 87 26 14 399 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P36557 5.61e-17 85 32 8 216 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9CCJ1 6.2e-17 86 26 6 248 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P40330 8.6e-17 86 25 14 399 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8X614 9.92e-17 85 27 4 216 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
Q02482 1.07e-16 85 24 13 375 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q2YZ23 1.21e-16 85 28 4 225 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q54YH4 1.32e-16 86 28 5 226 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
Q07737 1.47e-16 85 28 9 233 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q7MD16 1.59e-16 85 28 8 252 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 1.65e-16 85 28 8 252 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
E5KK10 1.9e-16 85 30 8 229 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
Q06904 2.28e-16 84 28 6 246 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P72292 2.4e-16 84 28 7 232 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
Q47457 2.67e-16 84 28 6 219 3 pcoS Probable sensor protein PcoS Escherichia coli
B7K3M6 4.83e-16 82 27 6 224 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
P33113 4.9e-16 83 26 6 233 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
P0DMC5 5.59e-16 84 27 6 260 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q06240 5.68e-16 82 26 7 231 1 vanS Sensor protein VanS Enterococcus faecium
P40719 6.01e-16 83 31 6 209 1 qseC Sensor protein QseC Escherichia coli (strain K12)
P0DMC6 6.45e-16 84 27 6 260 1 rcsC Sensor histidine kinase RcsC Escherichia coli
A3Q5L8 7.42e-16 83 30 10 255 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
P59342 8.17e-16 83 29 8 243 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
P37461 8.5e-16 82 26 6 220 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AEC5 8.7e-16 83 29 8 243 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 8.7e-16 83 29 8 243 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 8.7e-16 83 29 8 243 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
A1TEL6 8.99e-16 82 31 7 221 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q8DKG0 9.53e-16 83 30 9 235 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q8X524 1.07e-15 82 31 6 209 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q1B3X9 1.09e-15 82 30 10 255 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 1.09e-15 82 30 10 255 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
P16575 1.35e-15 82 25 16 403 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q2JWK9 1.48e-15 81 26 6 225 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
A0R3I7 1.57e-15 82 33 8 217 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q04943 1.7e-15 82 26 5 234 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0C0F6 1.94e-15 82 28 7 253 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
O31671 1.96e-15 81 23 12 329 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P0C0F7 1.96e-15 82 28 7 253 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
Q9Z5G7 2.21e-15 81 31 10 229 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
P96368 2.24e-15 81 34 4 214 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q54U87 2.48e-15 82 27 9 262 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
P58662 2.69e-15 82 28 5 231 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z332 3.05e-15 80 26 6 220 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q56128 3.49e-15 81 28 5 231 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
Q8DXQ8 4.34e-15 80 29 8 206 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
P18392 5.06e-15 80 26 4 226 1 rstB Sensor protein RstB Escherichia coli (strain K12)
Q03069 5.26e-15 79 22 7 241 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q5A599 5.72e-15 80 29 8 248 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8E3C7 6.09e-15 79 29 8 206 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
Q551X9 6.78e-15 80 30 11 247 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q2JKD9 7.33e-15 79 26 8 225 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
T2KMF4 8.61e-15 80 24 4 232 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
Q5AHA0 1e-14 80 28 9 248 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P45336 1.01e-14 79 26 6 217 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87GU5 1.08e-14 80 25 5 240 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8Z3P2 1.09e-14 79 30 4 194 3 qseC Sensor protein QseC Salmonella typhi
Q8ZLZ9 1.28e-14 79 30 4 194 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P9WGL1 1.37e-14 79 31 8 212 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 1.37e-14 79 31 8 212 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 1.37e-14 79 31 8 212 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
O33071 1.38e-14 79 30 7 233 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
A0A4P7TSF2 2.17e-14 78 28 5 210 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 2.17e-14 78 28 5 210 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 2.17e-14 78 28 5 210 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
P16497 2.45e-14 78 24 9 253 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
P44578 2.55e-14 77 29 13 277 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q52969 2.58e-14 78 24 5 257 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q6GIT7 2.92e-14 77 27 7 237 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 3.38e-14 77 27 7 237 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 3.38e-14 77 27 7 237 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 3.38e-14 77 27 7 237 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 3.38e-14 77 27 7 237 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 3.38e-14 77 27 7 237 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9HV31 3.46e-14 77 30 9 212 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZPP5 3.88e-14 78 26 8 249 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KLK7 3.93e-14 78 25 5 251 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P08401 3.99e-14 77 30 7 203 1 creC Sensor protein CreC Escherichia coli (strain K12)
P0DOA0 4.17e-14 78 26 10 279 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
O82436 4.39e-14 78 25 10 294 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
O32193 4.52e-14 77 24 5 225 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
P41406 6.23e-14 77 30 7 214 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
Q9LCC2 7.1e-14 77 27 6 241 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A1KHB8 7.81e-14 76 31 8 212 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 7.81e-14 76 31 8 212 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P49333 8.46e-14 77 25 8 288 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P08982 8.62e-14 76 30 8 219 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 8.62e-14 76 30 8 219 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
O49230 9.48e-14 77 27 11 303 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q9SSY6 9.52e-14 77 25 10 294 2 ETR1 Ethylene receptor 1 Cucumis sativus
Q840P7 1.23e-13 75 26 7 237 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
Q54Q69 1.3e-13 77 25 6 289 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum
Q9XH57 1.49e-13 76 25 11 286 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
Q5HHW5 1.54e-13 75 26 7 237 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 1.54e-13 75 26 7 237 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 1.54e-13 75 26 7 237 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
P9WGK7 1.61e-13 75 28 6 243 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 1.61e-13 75 28 6 243 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 1.61e-13 75 28 6 243 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O81122 1.89e-13 75 24 7 294 2 ETR1 Ethylene receptor Malus domestica
Q9M7M1 1.9e-13 75 24 7 293 2 ETR1 Ethylene receptor Prunus persica
O48929 3.04e-13 75 25 8 283 2 ETR1 Ethylene receptor Nicotiana tabacum
P39453 4.56e-13 75 28 6 236 1 torS Sensor protein TorS Escherichia coli (strain K12)
Q8XA47 4.73e-13 74 24 3 228 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
Q54RP6 5.42e-13 75 25 16 368 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q9R6X3 6.03e-13 74 30 9 230 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q869S5 6.61e-13 74 26 6 230 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q41342 7.74e-13 73 26 9 287 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
P52101 7.87e-13 73 24 3 228 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
P58356 9.41e-13 73 28 6 236 3 torS Sensor protein TorS Escherichia coli O157:H7
Q3S4A7 1.08e-12 73 26 6 247 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P54302 1.64e-12 73 24 4 236 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
Q02541 1.8e-12 72 24 5 233 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
B0JK50 2.31e-12 71 26 6 229 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q9P7Q7 2.49e-12 72 25 6 246 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q86CZ2 2.57e-12 72 26 7 264 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
A3PDI2 3.6e-12 70 24 8 302 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
A1A696 4.6e-12 72 26 10 318 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
P33639 4.87e-12 71 25 7 226 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q38846 5.82e-12 71 26 9 293 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q9SXL4 5.92e-12 71 23 7 299 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q55168 6.17e-12 71 27 9 233 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A2BRQ6 6.78e-12 70 24 10 303 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
Q2FWH7 7.21e-12 71 27 7 231 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
P18540 7.29e-12 71 29 12 268 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
P94608 8.97e-12 70 25 5 245 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q9P896 9.05e-12 70 27 8 229 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A6X5X4 1.19e-11 70 22 13 389 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
Q8FZ86 1.23e-11 70 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
A2WYI4 1.26e-11 70 26 10 318 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
B0CI82 1.32e-11 70 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
A9M715 1.57e-11 70 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57BR6 1.81e-11 70 22 12 393 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 1.81e-11 70 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 1.81e-11 70 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
A5VRX4 1.91e-11 70 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YIM6 1.98e-11 69 22 12 393 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
O49187 2.58e-11 69 24 5 253 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
A7HD43 3.03e-11 68 28 8 221 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q31AE8 3.82e-11 67 24 10 303 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
Q9C5U2 4.11e-11 68 25 8 312 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q44007 4.26e-11 68 23 3 223 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q7BWI3 7.36e-11 67 25 10 258 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A8G5E7 1.09e-10 66 23 8 302 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q70FG9 1.31e-10 66 31 9 209 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
Q9C5U1 1.72e-10 67 24 7 272 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q9K620 1.84e-10 65 26 7 230 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P45670 1.97e-10 65 25 14 346 3 None Sensory histidine kinase/phosphatase NtrB Azospirillum brasilense
Q9HZ47 2.21e-10 65 24 6 223 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZWL6 3.21e-10 65 23 10 295 2 ETR1 Ethylene receptor Passiflora edulis
P76339 4.22e-10 65 27 6 201 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
P73276 4.25e-10 65 25 8 267 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9XH58 4.86e-10 65 23 7 283 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q95PI2 5.32e-10 65 25 8 237 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
P45675 1.32e-09 63 25 7 241 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
P41503 1.35e-09 63 27 11 238 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
P21865 1.58e-09 63 25 7 248 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q9I4N4 2.42e-09 62 24 13 361 3 fleS Sensor protein kinase FleS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0IBF4 3.65e-09 62 25 10 249 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
P19906 4.08e-09 61 24 11 264 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
Q8DMC5 5.16e-09 61 25 5 230 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P39928 5.72e-09 62 43 0 69 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q53RH0 5.9e-09 61 23 9 286 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 5.9e-09 61 23 9 286 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
P07167 6.72e-09 61 26 12 278 3 virA Limited host range VirA protein Rhizobium radiobacter
A7N6S2 6.79e-09 61 24 7 258 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q9HWR3 1.58e-08 60 24 6 229 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P07168 1.82e-08 60 26 10 265 3 virA Wide host range VirA protein Rhizobium radiobacter
P10799 1.83e-08 60 26 10 265 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
Q9RZA4 2.99e-08 59 25 7 252 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
P30663 3.86e-08 58 22 10 331 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
Q7U871 4.48e-08 58 27 8 221 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
Q5A872 4.91e-08 59 40 0 69 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q8THF6 5.93e-08 58 24 5 206 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
O34971 8.83e-08 58 25 8 241 3 kdpD Sensor protein KdpD Rathayibacter rathayi
P0A2D9 1.1e-07 57 24 17 358 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 1.1e-07 57 24 17 358 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q7V113 1.26e-07 57 24 6 226 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q04804 1.88e-07 56 22 4 197 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P9WGL3 2.04e-07 57 24 8 222 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 2.29e-07 57 24 8 222 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4I8 2.33e-07 56 25 3 226 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 2.33e-07 56 25 3 226 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A2C884 3.28e-07 55 24 9 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
O35044 3.55e-07 55 25 9 227 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
P96601 3.7e-07 55 30 2 105 3 dctS Probable C4-dicarboxylate sensor kinase Bacillus subtilis (strain 168)
A1A697 3.74e-07 56 41 0 70 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
A1A697 8.33e-05 48 25 5 164 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q52977 4.25e-07 55 25 10 235 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium meliloti (strain 1021)
P10955 4.48e-07 55 23 21 468 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
Q86AT9 5.13e-07 55 40 0 70 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
Q8CTL4 6.1e-07 54 23 6 213 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 6.1e-07 54 23 6 213 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q82EB2 6.11e-07 55 26 7 199 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q8DN03 7.21e-07 55 26 6 211 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 7.21e-07 55 26 6 211 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
P0AFB7 7.51e-07 54 26 13 258 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 7.51e-07 54 26 13 258 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 7.51e-07 54 26 13 258 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q9KM66 8.97e-07 55 21 5 236 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A3BE68 9.95e-07 55 42 0 69 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 1.04e-06 55 42 0 69 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q3AYV8 1.21e-06 53 26 8 221 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q04850 1.36e-06 54 23 6 210 3 ntrY Nitrogen regulation protein NtrY Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q7V6P7 1.54e-06 53 23 9 234 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P23222 1.79e-06 53 21 13 371 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P15939 1.95e-06 53 25 9 228 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P10578 2e-06 53 26 9 225 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q54W36 2.53e-06 53 41 0 72 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
Q54W36 0.001 45 26 5 155 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
P09431 3.16e-06 52 25 8 219 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P26489 6.33e-06 52 21 15 361 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P42707 6.98e-06 51 24 5 193 3 nisK Nisin biosynthesis sensor protein NisK Lactococcus lactis subsp. lactis
P23837 7.71e-06 51 23 5 210 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q8X739 7.99e-06 51 23 5 210 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q8FIB8 8.06e-06 51 23 5 210 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q83RR1 8.35e-06 51 23 5 210 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
O25917 8.35e-06 51 25 9 221 3 crdS Sensor histidine kinase CrdS Helicobacter pylori (strain ATCC 700392 / 26695)
P37739 9.28e-06 51 21 6 228 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
Q9RC53 1.04e-05 51 20 10 354 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O06979 1.3e-05 50 21 6 224 3 yvcQ Sensor histidine kinase YvcQ Bacillus subtilis (strain 168)
P59340 1.31e-05 51 22 14 361 3 dcuS Sensor histidine kinase DcuS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC8 1.36e-05 51 22 14 361 1 dcuS Sensor histidine kinase DcuS Escherichia coli (strain K12)
P0AEC9 1.36e-05 51 22 14 361 3 dcuS Sensor histidine kinase DcuS Escherichia coli O157:H7
P59341 1.44e-05 50 22 14 361 3 dcuS Sensor histidine kinase DcuS Shigella flexneri
O22267 2.1e-05 50 21 8 287 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
P13633 2.77e-05 50 24 8 218 1 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium meliloti (strain 1021)
B8AY75 3.53e-05 49 22 11 289 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. indica
Q9I0I2 3.76e-05 49 24 8 223 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q0DKM0 6.55e-05 48 22 11 290 2 ERS2 Probable ethylene response sensor 2 Oryza sativa subsp. japonica
Q9I4F8 6.86e-05 48 24 9 234 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1A698 0.000111 48 38 0 70 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
A1A698 0.001 45 28 5 138 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q9C5U0 0.000149 48 27 5 141 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
A1A699 0.000171 47 35 0 70 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q1RJB3 0.000178 47 21 6 221 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q55E44 0.000249 47 22 6 176 3 dhkE Hybrid signal transduction histidine kinase E Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00255
Feature type CDS
Gene phoR
Product phosphate regulon sensor histidine kinase PhoR
Location 79657 - 80949 (strand: 1)
Length 1293 (nucleotides) / 430 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_2266
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00989 PAS fold
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF11808 Phosphate regulon sensor protein PhoR

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07636 two-component system, OmpR family, phosphate regulon sensor histidine kinase PhoR [EC:2.7.13.3] Two-component system -

Protein Sequence

MLERLSWKALVWGLFLFCLPAFVLSLFIGHLPWLLVVSLLSALIWHAYNLMKLSKWLWLDRSVLPPEGKGGWEPIFYGIRQTQQRNRKRRRELGDLIKRFRSGAESLPDAVVMITNEGNIFWCNSLAQHLLGFRWPDDNGQNIFNLLRYPDFLHYFTVADFSRPLTIALNNGAIVEFRVMPYADDQRLMVARDVTEKNKLENSRRDFFANVSHELRTPLTVIQGYLEMMEENTAENPAEHKVIKTMQEQAKRMDLLVQQLLQLSRIESAPHIDLNTVVDMPALLSVLEHDAHSLSQEQQNIIFDIDHKWAVRGNEEQLRSAVSNLVYNAINHTPEGTTIRVSWKKVPQGMLFSVSDNGPGISAEHLTRLTERFYRVDKARSRHTGGTGLGLAIVKKSLQHHHSILNIESKVGVGSTFSFIMPQTLLTEKK

Flanking regions ( +/- flanking 50bp)

GGATATCGTTTCTCTGCTCGATTTTGAGTTGATAAGGGAGTAATTAACTGGTGTTAGAACGACTCTCATGGAAAGCCCTCGTGTGGGGGCTATTTCTATTTTGTTTACCTGCCTTTGTATTATCACTATTTATCGGCCACCTTCCTTGGTTGCTCGTGGTCTCATTACTGAGTGCCTTGATATGGCACGCCTATAATTTAATGAAATTATCTAAATGGTTATGGCTCGATAGATCAGTATTACCCCCAGAAGGGAAAGGGGGCTGGGAGCCTATTTTTTATGGTATACGACAAACACAGCAACGTAACCGTAAACGCCGTCGAGAATTAGGTGATTTAATTAAGCGTTTTCGTAGCGGGGCGGAGAGCCTACCAGATGCCGTTGTGATGATCACTAATGAAGGAAATATCTTTTGGTGTAATAGTCTTGCTCAGCATCTTCTAGGCTTTCGTTGGCCTGATGATAATGGACAAAATATTTTTAATTTATTGCGCTATCCCGATTTTTTACATTATTTCACCGTCGCCGATTTTAGCCGCCCTTTAACTATTGCATTAAATAATGGTGCTATTGTTGAATTTCGGGTGATGCCTTATGCGGATGATCAACGTTTAATGGTTGCTCGCGATGTGACCGAGAAGAATAAGTTAGAAAATTCGCGACGTGATTTTTTTGCTAATGTGAGCCATGAATTAAGAACACCTTTAACGGTTATTCAAGGCTATCTTGAGATGATGGAAGAGAATACCGCAGAAAACCCGGCTGAACATAAAGTGATTAAGACCATGCAAGAGCAAGCAAAGCGTATGGACTTATTAGTACAACAACTGTTACAGCTTTCACGTATTGAATCTGCGCCTCATATTGATTTGAACACGGTTGTCGATATGCCTGCGCTATTAAGCGTGCTTGAGCATGACGCGCACTCATTAAGCCAAGAACAACAAAATATCATCTTTGATATTGACCATAAATGGGCTGTTCGTGGTAATGAAGAGCAATTGCGTAGTGCCGTATCTAACCTTGTCTATAACGCCATAAATCATACCCCTGAGGGTACGACTATTCGCGTGAGTTGGAAAAAAGTACCACAAGGTATGTTGTTTAGTGTGTCAGATAATGGGCCGGGTATCAGTGCTGAACATTTAACGCGCTTAACCGAACGTTTTTATCGTGTAGATAAAGCGCGCTCCCGCCACACAGGTGGTACAGGGCTTGGATTGGCGATTGTCAAAAAGTCCTTACAACATCATCACTCAATACTGAATATTGAAAGTAAAGTCGGTGTAGGAAGCACTTTTTCTTTTATCATGCCGCAAACATTGTTAACAGAAAAAAAATAATTTCGTTTTTATCCTTATTTTATTAGTACCTTTATTACCTATTTTTAAAA