Homologs in group_2301

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17430 FBDBKF_17430 100.0 Morganella morganii S1 phoR phosphate regulon sensor histidine kinase PhoR
EHELCC_17325 EHELCC_17325 100.0 Morganella morganii S2 phoR phosphate regulon sensor histidine kinase PhoR
NLDBIP_17870 NLDBIP_17870 100.0 Morganella morganii S4 phoR phosphate regulon sensor histidine kinase PhoR
LHKJJB_17790 LHKJJB_17790 100.0 Morganella morganii S3 phoR phosphate regulon sensor histidine kinase PhoR
F4V73_RS16605 F4V73_RS16605 90.3 Morganella psychrotolerans phoR phosphate regulon sensor histidine kinase PhoR
PMI_RS00255 PMI_RS00255 65.6 Proteus mirabilis HI4320 phoR phosphate regulon sensor histidine kinase PhoR

Distribution of the homologs in the orthogroup group_2301

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2301

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P08400 0.0 560 63 0 430 1 phoR Phosphate regulon sensor protein PhoR Escherichia coli (strain K12)
P45608 0.0 559 61 0 429 3 phoR Phosphate regulon sensor protein PhoR Klebsiella pneumoniae
P45609 0.0 556 63 0 431 3 phoR Phosphate regulon sensor protein PhoR Shigella dysenteriae
P71380 1.81e-97 301 39 6 423 3 phoR Phosphate regulon sensor protein PhoR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P23621 1.21e-91 286 42 4 390 3 phoR Phosphate regulon sensor protein PhoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0QR01 1.49e-40 151 37 3 235 1 senX3 Sensor-like histidine kinase SenX3 Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
A5A2P0 6.95e-40 150 30 9 354 3 walK Sensor protein kinase WalK (Fragment) Mammaliicoccus sciuri
P35164 2.48e-39 152 32 11 336 1 resE Sensor histidine kinase ResE Bacillus subtilis (strain 168)
P23545 4.28e-39 151 37 4 242 1 phoR Alkaline phosphatase synthesis sensor protein PhoR Bacillus subtilis (strain 168)
Q45614 1.35e-38 150 30 7 362 1 walK Sensor histidine kinase WalK Bacillus subtilis (strain 168)
P9WGK5 2.45e-37 143 37 4 236 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK4 2.45e-37 143 37 4 236 2 senX3 Sensor-like histidine kinase SenX3 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A601 2.45e-37 143 37 4 236 1 senX3 Sensor-like histidine kinase SenX3 Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P54883 1.33e-36 142 36 2 236 3 senX3 Sensor-like histidine kinase SenX3 Mycobacterium leprae (strain TN)
Q9RDT3 1.18e-35 139 30 7 344 1 walK Sensor protein kinase WalK (Fragment) Staphylococcus aureus
Q6GKS6 1.94e-35 141 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MRSA252)
Q4A159 3.7e-35 140 29 6 340 3 walK Sensor protein kinase WalK Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A215 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MW2)
A8YYU2 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300 / TCH1516)
Q6GD71 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain MSSA476)
Q7A8E0 9.72e-35 139 30 7 344 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain N315)
Q7A305 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJX6 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain COL)
Q2YUQ2 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5INR0 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH9)
Q2G2U4 9.72e-35 139 30 7 344 1 walK Sensor protein kinase WalK Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FKN7 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain USA300)
A6TXG9 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain JH1)
A7WWQ7 9.72e-35 139 30 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4LAJ8 1.67e-34 139 25 6 426 3 walK Sensor protein kinase WalK Staphylococcus haemolyticus (strain JCSC1435)
A6QD58 2.96e-34 138 29 7 344 3 walK Sensor protein kinase WalK Staphylococcus aureus (strain Newman)
Q8CU87 1.68e-33 135 25 6 424 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HK19 1.68e-33 135 25 6 424 1 walK Sensor protein kinase WalK Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8DPL8 6.61e-32 129 29 7 388 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZNH9 6.61e-32 129 29 7 388 1 walK Sensor histidine protein kinase/phosphatase WalK Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q7A5H7 5.69e-31 128 30 3 241 1 srrB Sensor protein SrrB Staphylococcus aureus (strain N315)
Q99TZ9 5.69e-31 128 30 3 241 3 srrB Sensor protein SrrB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8NWF3 6.83e-31 128 30 3 241 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MW2)
Q6G973 6.83e-31 128 30 3 241 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MSSA476)
Q5HFT1 6.83e-31 128 30 3 241 2 srrB Sensor protein SrrB Staphylococcus aureus (strain COL)
Q2FY80 6.83e-31 128 30 3 241 3 srrB Sensor protein SrrB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q6GGK7 7.03e-31 128 30 3 241 3 srrB Sensor protein SrrB Staphylococcus aureus (strain MRSA252)
O34638 7.43e-31 126 32 7 260 3 ykoH Sensor histidine kinase YkoH Bacillus subtilis (strain 168)
Q9L523 7.44e-31 128 30 3 241 1 srrB Sensor protein SrrB Staphylococcus aureus
P30847 2.07e-30 125 29 5 280 1 baeS Signal transduction histidine-protein kinase BaeS Escherichia coli (strain K12)
O69729 2.24e-27 117 33 5 239 1 tcrY Probable sensor histidine kinase TcrY Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q55932 2.84e-26 113 31 3 220 1 rppB Sensor histidine kinase RppB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O34206 5.5e-26 114 26 8 364 1 kinB Alginate biosynthesis sensor protein KinB Pseudomonas aeruginosa
P94414 5.44e-25 110 31 7 239 3 yclK Sensor histidine kinase YclK Bacillus subtilis (strain 168)
P77485 1.56e-24 108 35 5 224 1 cusS Sensor histidine kinase CusS Escherichia coli (strain K12)
Q7A0W5 2.84e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MW2)
Q6G9E7 2.84e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MSSA476)
Q7A5N3 2.84e-24 107 31 3 220 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain N315)
Q7A2R7 2.84e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG05 2.84e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain COL)
Q9KJN3 2.84e-24 107 31 3 220 1 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH24 2.84e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain USA300)
Q6GGZ4 3.01e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain MRSA252)
Q2YY04 3.44e-24 107 31 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0DMK6 9.65e-24 106 30 3 224 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain K96243)
Q8FK37 2.5e-23 105 34 5 224 3 cusS Sensor histidine kinase CusS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q55630 8.55e-23 102 27 11 301 1 sasA Adaptive-response sensory kinase SasA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8XBY4 9.18e-23 103 33 5 225 3 cusS Sensor histidine kinase CusS Escherichia coli O157:H7
Q4L6C5 1.18e-22 103 30 3 220 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus haemolyticus (strain JCSC1435)
I1WSZ3 2.98e-22 102 29 3 224 3 irlS Sensor protein IrlS Burkholderia pseudomallei (strain 1026b)
Q49XM6 3.03e-22 102 30 3 223 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P37894 4.11e-22 102 31 9 260 1 pleC Non-motile and phage-resistance protein Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9ZHD4 7.84e-22 100 31 5 229 3 silS Probable sensor kinase SilS Salmonella typhimurium
P0A4I6 8.91e-22 100 32 2 226 3 ciaH Sensor protein CiaH Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4I5 8.91e-22 100 32 2 226 3 ciaH Sensor protein CiaH Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9RQQ9 9.74e-22 101 26 4 258 1 divL Sensor protein DivL Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q9F8D7 9.97e-22 101 32 9 250 3 gacS Sensor histidine kinase GacS Pseudomonas protegens (strain DSM 19095 / LMG 27888 / CFBP 6595 / CHA0)
P48027 1.56e-21 100 31 8 245 3 gacS Sensor protein GacS Pseudomonas syringae pv. syringae
A0A0H3GPN8 1.69e-21 99 29 7 241 2 cpxA Sensor histidine kinase CpxA Klebsiella pneumoniae subsp. pneumoniae (strain HS11286)
E0X9C7 1.74e-21 100 30 7 242 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
E0X9C7 7.48e-12 71 22 14 388 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain DOT-T1E)
Q9KHI5 1.8e-21 100 32 8 229 1 cikA Circadian input-output histidine kinase CikA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A5W4E3 1.89e-21 100 30 7 236 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
A5W4E3 8.16e-12 71 22 14 388 1 todS Sensor histidine kinase TodS Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
P0AE82 1.94e-21 99 28 7 238 1 cpxA Sensor histidine kinase CpxA Escherichia coli (strain K12)
P0AE83 1.94e-21 99 28 7 238 3 cpxA Sensor protein CpxA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AE84 1.94e-21 99 28 7 238 3 cpxA Sensor protein CpxA Escherichia coli O157:H7
Q8KIY1 2.67e-21 100 31 6 236 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
Q8KIY1 3.36e-08 59 22 13 389 1 tmoS Sensor histidine kinase TmoS Pseudomonas mendocina
P20169 5.81e-21 99 28 6 250 3 dspA Drug sensory protein A Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q06240 1.28e-20 96 27 6 227 1 vanS Sensor protein VanS Enterococcus faecium
A9M715 1.53e-20 98 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q8FZ86 1.58e-20 98 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella suis biovar 1 (strain 1330)
B0CI82 1.73e-20 97 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella suis (strain ATCC 23445 / NCTC 10510)
P58402 1.75e-20 98 24 14 400 3 evgS Sensor protein EvgS Escherichia coli O157:H7
Q8YIM6 2.73e-20 97 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q57BR6 2.8e-20 97 25 12 391 1 pdhS Cell-division control histidine kinase PdhS Brucella abortus biovar 1 (strain 9-941)
Q2YRB4 2.8e-20 97 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain 2308)
B2S758 2.8e-20 97 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella abortus (strain S19)
A5VRX4 3.04e-20 97 25 12 391 3 pdhS Cell-division control histidine kinase PdhS Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q54YZ9 3.18e-20 97 29 10 292 3 dhkJ Hybrid signal transduction histidine kinase J Dictyostelium discoideum
P30855 5.05e-20 96 24 15 397 1 evgS Sensor protein EvgS Escherichia coli (strain K12)
Q8CSL7 5.56e-20 95 29 4 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9CCJ1 5.77e-20 95 28 5 244 3 mtrB Sensor histidine kinase MtrB Mycobacterium leprae (strain TN)
P39764 7.15e-20 94 26 3 253 1 kinC Sporulation kinase C Bacillus subtilis (strain 168)
B1WYT4 8.89e-20 94 30 4 229 3 sasA Adaptive-response sensory kinase SasA Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q5HPC4 1.18e-19 94 29 4 228 3 arlS Signal transduction histidine-protein kinase ArlS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q49ZT9 1.87e-19 93 28 5 225 3 hssS Heme sensor protein HssS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P0AEC4 3.34e-19 94 25 14 362 3 arcB Aerobic respiration control sensor protein ArcB Shigella flexneri
P0AEC3 3.34e-19 94 25 14 362 1 arcB Aerobic respiration control sensor protein ArcB Escherichia coli (strain K12)
P58363 3.46e-19 94 25 14 362 3 arcB Aerobic respiration control sensor protein ArcB Escherichia coli O157:H7
Q869S5 3.53e-19 94 27 7 266 1 dokA Hybrid signal transduction protein dokA Dictyostelium discoideum
Q04943 3.71e-19 93 32 8 237 3 afsQ2 Signal transduction histidine-protein kinase AfsQ2 Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q87GU5 5.07e-19 93 27 5 241 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q08430 5.26e-19 92 26 9 249 3 kinB Sporulation kinase B Bacillus subtilis (strain 168)
A6X5X4 6.51e-19 93 25 15 390 3 pdhS Cell-division control histidine kinase PdhS Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
P59342 8.87e-19 92 29 8 255 3 barA Signal transduction histidine-protein kinase BarA Shigella flexneri
A0QTK3 9.68e-19 92 27 4 244 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
P0C0F6 1.05e-18 92 30 6 265 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P0C0F7 1.06e-18 92 30 6 265 1 rpfC Sensory/regulatory protein RpfC Xanthomonas campestris pv. campestris (strain 8004)
P54302 1.06e-18 92 28 3 237 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio harveyi
P0AEC5 1.08e-18 92 29 8 255 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli (strain K12)
P0AEC6 1.08e-18 92 29 8 255 1 barA Signal transduction histidine-protein kinase BarA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC7 1.08e-18 92 29 8 255 3 barA Signal transduction histidine-protein kinase BarA Escherichia coli O157:H7
P9WGK8 1.74e-18 91 27 5 244 3 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59963 1.74e-18 91 27 5 244 3 mtrB Sensor histidine kinase MtrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WGK9 1.91e-18 91 27 5 244 1 mtrB Sensor histidine kinase MtrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q52969 3.01e-18 90 27 5 265 3 R01002 Uncharacterized sensor-like histidine kinase R01002 Rhizobium meliloti (strain 1021)
Q2T0V9 3.12e-18 90 29 4 229 3 atsR Sensor histidine kinase AtsR Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
B7KFU0 3.27e-18 89 29 6 225 3 sasA Adaptive-response sensory kinase SasA Gloeothece citriformis (strain PCC 7424)
B7K3M6 3.87e-18 89 28 4 225 3 sasA Adaptive-response sensory kinase SasA Rippkaea orientalis (strain PCC 8801 / RF-1)
Q93CB7 3.96e-18 90 27 4 237 3 mtrB Sensor histidine kinase MtrB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
B2J946 4.23e-18 89 27 6 230 3 sasA Adaptive-response sensory kinase SasA Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
P39664 5.31e-18 89 27 9 335 1 sphS Sensor protein SphS Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4L8M0 5.8e-18 89 27 5 227 3 hssS Heme sensor protein HssS Staphylococcus haemolyticus (strain JCSC1435)
O34989 6.41e-18 89 27 6 230 3 yvrG Sensor histidine kinase YvrG Bacillus subtilis (strain 168)
O31661 6.7e-18 89 23 10 362 1 kinE Sporulation kinase E Bacillus subtilis (strain 168)
P40719 7.65e-18 89 32 6 218 1 qseC Sensor protein QseC Escherichia coli (strain K12)
Q8X524 8.09e-18 88 32 6 218 2 qseC Sensor protein QseC Escherichia coli O157:H7
Q8GP19 9.23e-18 88 29 8 241 1 rssA Swarming motility regulation sensor protein RssA Serratia marcescens
Q02482 1.2e-17 89 24 14 371 3 Sfri_3689 Putative sensor protein Sfri_3689 Shewanella frigidimarina (strain NCIMB 400)
Q8DKG0 1.32e-17 89 28 4 228 1 cikA Circadian input-output histidine kinase CikA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q47745 1.39e-17 88 30 6 213 3 vanSB Sensor protein VanSB Enterococcus faecalis (strain ATCC 700802 / V583)
Q06067 1.4e-17 88 23 12 345 1 atoS Signal transduction histidine-protein kinase AtoS Escherichia coli (strain K12)
Q54SP4 1.51e-17 89 29 7 241 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
Q54SP4 3.82e-11 68 23 6 271 2 dhkD Hybrid signal transduction histidine kinase D Dictyostelium discoideum
P42245 2.43e-17 85 27 3 227 3 ycbM Sensor histidine kinase YcbM Bacillus subtilis (strain 168)
Q7MD16 3.31e-17 87 28 6 239 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain YJ016)
Q8D5Z6 3.4e-17 87 28 6 239 3 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio vulnificus (strain CMCP6)
Q8DMT2 3.5e-17 86 30 7 228 1 sasA Adaptive-response sensory kinase SasA Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P74111 4.52e-17 87 30 7 236 1 cikA Circadian input-output histidine kinase CikA Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
T2KMF4 8.86e-17 86 26 7 245 3 BN863_21930 Histidine kinase P4 Formosa agariphila (strain DSM 15362 / KCTC 12365 / LMG 23005 / KMM 3901 / M-2Alg 35-1)
E5KK10 9.98e-17 86 28 7 226 1 filI Methanogenesis regulatory histidine kinase FilI Methanothrix harundinacea (strain 6Ac)
P72292 1.14e-16 85 31 10 235 3 chvG Sensor protein ChvG Rhizobium meliloti (strain 1021)
P33113 1.63e-16 84 28 6 234 3 spaK Sensor histidine kinase SpaK Bacillus subtilis
O33071 1.71e-16 84 31 5 222 3 prrB Sensor-type histidine kinase PrrB Mycobacterium leprae (strain TN)
O14002 1.77e-16 85 25 10 358 3 mak2 Peroxide stress-activated histidine kinase mak2 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7BWI3 2.41e-16 83 28 8 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q08408 2.93e-16 84 26 4 235 3 rprX Sensor protein RprX Bacteroides fragilis (strain YCH46)
P36557 4.32e-16 82 31 7 215 1 basS Sensor protein BasS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q47457 4.47e-16 83 28 4 228 3 pcoS Probable sensor protein PcoS Escherichia coli
Q5A599 5.78e-16 84 26 10 291 1 NIK1 Histidine protein kinase NIK1 Candida albicans (strain SC5314 / ATCC MYA-2876)
P16497 8.3e-16 83 24 7 254 1 kinA Sporulation kinase A Bacillus subtilis (strain 168)
Q8XA47 9.2e-16 82 27 3 227 1 qseE Sensor histidine kinase QseE Escherichia coli O157:H7
O32193 9.54e-16 82 25 5 226 1 cssS Sensor histidine kinase CssS Bacillus subtilis (strain 168)
Q5HLN1 1.11e-15 82 28 4 212 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q03228 1.21e-15 82 28 9 265 1 divJ Histidine protein kinase DivJ Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q7U871 1.36e-15 81 30 7 216 3 sasA Adaptive-response sensory kinase SasA Parasynechococcus marenigrum (strain WH8102)
P51392 1.52e-15 82 21 10 385 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Porphyra purpurea
P30844 1.79e-15 80 32 7 215 1 basS Sensor protein BasS Escherichia coli (strain K12)
A2WYI4 2.58e-15 82 26 7 287 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. indica
A1A696 2.63e-15 82 26 7 287 2 HK3 Probable histidine kinase 3 Oryza sativa subsp. japonica
Q8YR50 3.14e-15 80 26 9 235 3 sasA Adaptive-response sensory kinase SasA Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P52101 3.54e-15 80 26 3 227 1 glrK Sensor histidine kinase GlrK Escherichia coli (strain K12)
A0PWB3 3.71e-15 80 31 10 237 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium ulcerans (strain Agy99)
A0QBR0 3.88e-15 80 31 10 238 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium avium (strain 104)
Q9HV31 3.93e-15 80 30 8 206 2 pmrB Sensor protein kinase PmrB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2JKD9 3.99e-15 80 25 7 232 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-2-3B'a(2-13))
P9WGK7 4.1e-15 80 26 6 271 1 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGK6 4.1e-15 80 26 6 271 3 prrB Sensor-type histidine kinase PrrB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A5Z9 4.1e-15 80 26 6 271 3 prrB Sensor-type histidine kinase PrrB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q3M8A7 4.17e-15 80 26 9 236 3 sasA Adaptive-response sensory kinase SasA Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P96368 5.59e-15 80 31 8 227 1 trcS Sensor histidine kinase TrcS Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P0DMC6 5.64e-15 80 25 6 265 1 rcsC Sensor histidine kinase RcsC Escherichia coli
P0DMC5 6.01e-15 80 25 6 265 1 rcsC Sensor histidine kinase RcsC Escherichia coli (strain K12)
Q1XD95 6.55e-15 80 21 10 387 3 ycf26 Uncharacterized sensor-like histidine kinase ycf26 Neopyropia yezoensis
Q8CRA8 6.76e-15 79 28 4 212 3 hssS Heme sensor protein HssS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q54U87 6.89e-15 80 26 8 254 1 dhkA Hybrid signal transduction histidine kinase A Dictyostelium discoideum
Q8NV46 8.75e-15 79 28 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MW2)
Q6G6V8 8.75e-15 79 28 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MSSA476)
A1A697 9.46e-15 80 24 7 281 2 HK5 Probable histidine kinase 5 Oryza sativa subsp. japonica
Q9APE0 9.83e-15 79 26 4 216 3 zraS Sensor histidine kinase ZraS Klebsiella oxytoca
Q07737 1.37e-14 79 28 9 234 3 chvG Sensor protein ChvG Agrobacterium fabrum (strain C58 / ATCC 33970)
Q742C0 1.51e-14 79 30 10 238 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
P14377 1.71e-14 78 24 3 221 1 zraS Sensor histidine kinase ZraS Escherichia coli (strain K12)
Q2FWH7 1.73e-14 79 28 7 234 1 kdpD Sensor histidine kinase KdpD Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q86CZ2 1.74e-14 79 28 9 254 1 dhkK Hybrid signal transduction histidine kinase K Dictyostelium discoideum
Q3AYV8 2.16e-14 77 30 8 218 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9902)
Q9HUI3 2.23e-14 79 27 8 262 3 aruS Sensor histidine kinase AruS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A0R3I7 2.63e-14 78 30 11 250 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
Q9C5U2 3.3e-14 78 25 6 281 1 AHK2 Histidine kinase 2 Arabidopsis thaliana
Q56128 3.34e-14 78 26 5 231 3 rcsC Sensor histidine kinase RcsC Salmonella typhi
P58662 3.59e-14 78 26 5 232 3 rcsC Sensor histidine kinase RcsC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q6GE72 3.95e-14 77 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain MRSA252)
B0JK50 4.02e-14 77 26 8 256 3 sasA Adaptive-response sensory kinase SasA Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q54YH4 4.54e-14 78 26 7 228 1 dhkB Hybrid signal transduction histidine kinase B Dictyostelium discoideum
P40330 4.73e-14 78 25 14 407 3 bvgS Virulence sensor protein BvgS Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
O31671 4.87e-14 77 21 8 322 1 kinD Sporulation kinase D Bacillus subtilis (strain 168)
P16575 5.13e-14 78 25 14 407 1 bvgS Virulence sensor protein BvgS Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
P94608 6.09e-14 77 26 5 234 3 kdpD Sensor protein KdpD Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q7A3X0 6.31e-14 77 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain N315)
Q99RR5 6.31e-14 77 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IVE3 6.31e-14 77 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH9)
A6U489 6.31e-14 77 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain JH1)
A7X5Y6 6.31e-14 77 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q5AHA0 6.8e-14 77 26 5 247 2 CHK1 Histidine protein kinase 1 Candida albicans (strain SC5314 / ATCC MYA-2876)
A8Z553 6.96e-14 76 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300 / TCH1516)
A6QJK4 6.96e-14 76 27 5 235 1 hssS Heme sensor protein HssS Staphylococcus aureus (strain Newman)
Q5HDJ3 6.96e-14 76 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain COL)
Q2FVQ8 6.96e-14 76 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FED4 6.96e-14 76 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain USA300)
P41406 7.85e-14 76 26 6 228 3 envZ Sensor histidine kinase EnvZ Salmonella typhi
A3Q5L8 7.99e-14 76 31 11 248 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain JLS)
Q8Z3P2 9.54e-14 76 31 9 228 3 qseC Sensor protein QseC Salmonella typhi
Q1B3X9 9.65e-14 76 31 11 248 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain MCS)
A1UL69 9.65e-14 76 31 11 248 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium sp. (strain KMS)
Q8ZLZ9 9.98e-14 76 32 8 205 3 qseC Sensor protein QseC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YZ23 1.16e-13 76 27 5 235 3 hssS Heme sensor protein HssS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q551X9 1.21e-13 77 30 9 266 3 dhkF Hybrid signal transduction histidine kinase F Dictyostelium discoideum
Q9C5U1 1.23e-13 76 28 9 276 1 AHK3 Histidine kinase 3 Arabidopsis thaliana
Q2JWK9 1.36e-13 75 25 6 226 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain JA-3-3Ab)
Q8X614 1.41e-13 75 24 3 221 3 zraS Sensor histidine kinase ZraS Escherichia coli O157:H7
P18392 1.41e-13 75 29 8 233 1 rstB Sensor protein RstB Escherichia coli (strain K12)
P08982 1.44e-13 75 26 6 228 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A0A0H3NIL4 1.44e-13 75 26 6 228 3 envZ Sensor histidine kinase EnvZ Salmonella typhimurium (strain SL1344)
P26762 1.82e-13 76 25 14 407 3 bvgS Virulence sensor protein BvgS Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q9SXL4 2.97e-13 75 24 9 300 1 AHK1 Histidine kinase 1 Arabidopsis thaliana
Q9Z5G7 3.25e-13 75 31 9 238 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium leprae (strain TN)
Q3S4A7 4.41e-13 75 27 9 256 1 AHK5 Histidine kinase 5 Arabidopsis thaliana
P42422 4.82e-13 73 24 6 231 3 yxdK Sensor histidine kinase YxdK Bacillus subtilis (strain 168)
Q44930 8.27e-13 72 26 7 247 4 gtcS Sensor protein GtcS Aneurinibacillus migulanus
A1TEL6 1.04e-12 73 30 11 248 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A0A4P7TSF2 1.07e-12 73 25 6 228 1 envZ Sensor histidine kinase EnvZ Shigella flexneri serotype 5a (strain M90T)
P0AEJ5 1.07e-12 73 25 6 228 1 envZ Sensor histidine kinase EnvZ Shigella flexneri
P0AEJ4 1.07e-12 73 25 6 228 1 envZ Sensor histidine kinase EnvZ Escherichia coli (strain K12)
Q06904 1.09e-12 72 26 8 230 1 sasA Adaptive-response sensory kinase SasA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45336 1.1e-12 73 28 5 210 1 qseC Sensor protein QseC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7A6Z3 1.56e-12 72 25 8 236 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain N315)
Q99VW1 1.56e-12 72 25 8 236 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQL3 1.56e-12 72 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH9)
A6TZD7 1.56e-12 72 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain JH1)
A7WZC5 1.56e-12 72 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Mu3 / ATCC 700698)
P06218 1.72e-12 71 25 15 351 3 ntrB Sensory histidine kinase/phosphatase NtrB Klebsiella oxytoca
Q9P7Q7 2.05e-12 73 27 6 236 3 mak1 Peroxide stress-activated histidine kinase mak1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P08401 2.08e-12 72 29 6 199 1 creC Sensor protein CreC Escherichia coli (strain K12)
Q8CTI3 2.12e-12 71 26 5 235 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR29 2.12e-12 71 26 5 235 3 saeS Histidine protein kinase SaeS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P19906 2.17e-12 71 25 12 274 3 ntrB Sensory histidine kinase/phosphatase NtrB Vibrio alginolyticus
A1KHB8 2.21e-12 72 31 10 231 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain BCG / Pasteur 1173P2)
Q7U0X3 2.21e-12 72 31 10 231 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A8Z182 2.63e-12 71 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300 / TCH1516)
A6QEW9 2.63e-12 71 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain Newman)
Q5HI08 2.63e-12 71 25 8 236 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain COL)
Q2G0D9 2.63e-12 71 25 8 236 1 graS Sensor histidine kinase GraS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIX9 2.63e-12 71 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain USA300)
Q2YSS1 2.68e-12 71 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q9I4N4 2.97e-12 71 24 11 366 3 fleS Sensor protein kinase FleS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P0A4I8 3.1e-12 71 28 9 239 3 cutS Sensor protein CutS Streptomyces lividans
P0A4I7 3.1e-12 71 28 9 239 3 cutS Sensor protein CutS Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q8NXR5 3.1e-12 70 25 8 236 1 graS Sensor protein kinase GraS Staphylococcus aureus (strain MW2)
Q6GBH0 3.1e-12 70 25 8 236 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MSSA476)
Q7V6P7 3.15e-12 71 28 10 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9313)
P9WGL1 3.15e-12 71 31 10 231 1 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL0 3.15e-12 71 31 10 231 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5U124 3.15e-12 71 31 10 231 3 mprB Signal transduction histidine-protein kinase/phosphatase MprB Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
A7HD43 4.65e-12 70 24 2 217 1 gchK Globin-coupled histidine kinase Anaeromyxobacter sp. (strain Fw109-5)
Q9M7M1 5.08e-12 71 24 5 242 2 ETR1 Ethylene receptor Prunus persica
Q02541 5.37e-12 70 25 4 205 3 copS Sensor protein CopS Pseudomonas syringae pv. tomato
Q9P896 6.17e-12 71 25 13 347 3 tcsA Two-component system protein A Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P33639 7.43e-12 70 26 7 225 1 pilS Sensor protein kinase PilS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q44007 1.02e-11 70 24 4 228 2 czcS Sensor protein CzcS Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
A2C884 1.07e-11 69 28 10 231 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9303)
Q03069 1.13e-11 69 21 6 222 3 degM Sensor protein DegM Bacillus sp. (strain B21-2)
Q9XH57 1.2e-11 70 25 7 258 2 ETR2 Ethylene receptor 2 Pelargonium hortorum
P76339 1.58e-11 69 28 5 199 1 hprS Sensor histidine kinase HprS Escherichia coli (strain K12)
Q6GJ10 2.11e-11 68 24 8 250 3 graS Sensor protein kinase GraS Staphylococcus aureus (strain MRSA252)
Q9KLK7 3.18e-11 69 23 6 261 1 luxQ Autoinducer 2 sensor kinase/phosphatase LuxQ Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q55168 3.24e-11 68 26 10 236 1 cph1 Phytochrome-like protein Cph1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q70FG9 3.43e-11 68 28 8 213 3 pmrB Sensor histidine kinase PmrB Pectobacterium parmentieri
P39453 3.96e-11 68 28 7 238 1 torS Sensor protein TorS Escherichia coli (strain K12)
P58356 4.72e-11 68 27 6 237 3 torS Sensor protein TorS Escherichia coli O157:H7
P21865 6.42e-11 68 25 6 237 1 kdpD Sensor protein KdpD Escherichia coli (strain K12)
Q0IBF4 6.46e-11 67 30 2 117 3 sasA Adaptive-response sensory kinase SasA Synechococcus sp. (strain CC9311)
Q8Z332 7.26e-11 67 24 5 217 3 zraS Sensor histidine kinase ZraS Salmonella typhi
Q840P7 7.47e-11 67 25 8 251 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Newman)
P0AFB7 8.15e-11 66 25 15 351 3 glnL Sensory histidine kinase/phosphatase NtrB Shigella flexneri
P0AFB5 8.15e-11 66 25 15 351 1 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli (strain K12)
P0AFB6 8.15e-11 66 25 15 351 3 glnL Sensory histidine kinase/phosphatase NtrB Escherichia coli O157:H7
Q5HHW5 8.79e-11 66 25 8 251 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain COL)
Q2G2U1 8.79e-11 66 25 8 251 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIT5 8.79e-11 66 25 8 251 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain USA300)
P0A2D9 9.17e-11 66 25 15 349 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2E0 9.17e-11 66 25 15 349 3 glnL Sensory histidine kinase/phosphatase NtrB Salmonella typhi
Q8CTL4 1.01e-10 66 25 7 214 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HR80 1.01e-10 66 25 7 214 3 graS Sensor histidine kinase GraS Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q6GIT7 1.05e-10 66 25 7 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MRSA252)
Q7A1J2 1.12e-10 66 25 7 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MW2)
Q6GBC5 1.12e-10 66 25 7 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain MSSA476)
Q7A6V4 1.12e-10 66 25 7 246 1 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain N315)
Q99VR8 1.12e-10 66 25 7 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YSM6 1.12e-10 66 25 7 246 3 saeS Histidine protein kinase SaeS Staphylococcus aureus (strain bovine RF122 / ET3-1)
P37461 1.47e-10 66 24 5 217 2 zraS Sensor histidine kinase ZraS Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O81122 2.03e-10 66 24 6 246 2 ETR1 Ethylene receptor Malus domestica
Q9R6X3 2.35e-10 66 27 12 231 3 bphB Cyanobacterial phytochrome B Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
O82436 4.68e-10 65 24 7 250 2 ETR1 Ethylene receptor 1 Cucumis melo var. cantalupensis
Q49VK4 6.41e-10 63 24 9 258 3 graS Sensor histidine kinase GraS Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q54RP6 6.87e-10 65 24 16 373 3 dhkL Hybrid signal transduction histidine kinase L Dictyostelium discoideum
Q9XH58 7.92e-10 64 23 6 250 2 ETR1 Ethylene receptor 1 Pelargonium hortorum
Q8DMC5 9.64e-10 63 25 7 232 1 hik2 Sensor histidine kinase Hik2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
P18540 1.29e-09 63 27 11 254 3 virA Wide host range VirA protein Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8E3C7 1.32e-09 63 24 6 199 3 dltS Sensor protein DltS Streptococcus agalactiae serotype III (strain NEM316)
P59341 1.41e-09 63 24 13 352 3 dcuS Sensor histidine kinase DcuS Shigella flexneri
P59340 1.42e-09 63 24 13 352 3 dcuS Sensor histidine kinase DcuS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEC8 1.61e-09 63 24 13 352 1 dcuS Sensor histidine kinase DcuS Escherichia coli (strain K12)
P0AEC9 1.61e-09 63 24 13 352 3 dcuS Sensor histidine kinase DcuS Escherichia coli O157:H7
P9WGL3 1.73e-09 63 23 9 270 1 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGL2 1.81e-09 63 23 9 270 3 kdpD Sensor protein KdpD Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8DXQ8 2.16e-09 62 24 6 199 3 dltS Sensor protein DltS Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q9SSY6 2.27e-09 63 23 7 257 2 ETR1 Ethylene receptor 1 Cucumis sativus
P44578 2.88e-09 61 29 8 210 3 arcB Aerobic respiration control sensor protein ArcB homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZPP5 2.94e-09 63 27 8 235 1 ssrA Sensor histidine kinase SsrA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P10955 3.33e-09 62 22 14 375 1 fixL Sensor protein FixL Rhizobium meliloti (strain 1021)
P45675 4.17e-09 62 25 7 291 3 None Nitrogen regulation protein NtrY homolog Azospirillum brasilense
P49333 4.53e-09 62 23 5 218 1 ETR1 Ethylene receptor 1 Arabidopsis thaliana
P73276 4.84e-09 61 25 8 239 1 hik2 Sensor histidine kinase Hik2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A2BRQ6 5.4e-09 61 27 12 247 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain AS9601)
A8G5E7 5.55e-09 61 24 9 245 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9215)
Q9HZ47 5.7e-09 61 26 9 233 1 gtrS Sensor histidine kinase GtrS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9K620 6.04e-09 60 25 8 229 3 bceS Sensor protein BceS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q31AE8 6.23e-09 61 25 10 248 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9312)
A3PDI2 7.19e-09 60 25 9 245 3 sasA Adaptive-response sensory kinase SasA Prochlorococcus marinus (strain MIT 9301)
Q7V113 7.94e-09 60 23 6 232 3 sasA Adaptive-response sensory-kinase SasA Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q9LCC2 8.42e-09 61 27 9 235 3 aphA Cyanobacterial phytochrome A Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P26489 8.49e-09 61 23 16 396 3 fixL Sensor protein FixL Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P96601 1.09e-08 60 30 2 115 3 dctS Probable C4-dicarboxylate sensor kinase Bacillus subtilis (strain 168)
P23222 1.43e-08 60 21 13 385 1 fixL Sensor protein FixL Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q9HWR3 1.43e-08 60 23 4 222 1 bphP Bacteriophytochrome Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q41342 1.63e-08 60 25 8 249 1 ETR1 Ethylene receptor 1 Solanum lycopersicum
Q9ZWL6 1.7e-08 60 24 7 251 2 ETR1 Ethylene receptor Passiflora edulis
A3BE68 2.15e-08 60 37 0 78 2 HK1 Probable histidine kinase 1 Oryza sativa subsp. japonica
A2YFR6 2.17e-08 60 37 0 78 3 HK1 Probable histidine kinase 1 Oryza sativa subsp. indica
Q9RC53 3.58e-08 59 22 10 339 3 citS Sensor protein CitS Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O49230 3.86e-08 59 23 6 235 2 ETR1 Ethylene receptor 1 Brassica oleracea
Q5A872 4.37e-08 59 30 3 135 1 SLN1 Histidine protein kinase SLN1 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q9KM66 6.06e-08 58 22 8 276 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P07168 6.59e-08 58 26 10 250 3 virA Wide host range VirA protein Rhizobium radiobacter
P10799 7.51e-08 58 26 10 250 1 virA Wide host range VirA protein Agrobacterium tumefaciens (strain 15955)
Q04804 9.16e-08 57 25 8 237 1 pfeS Sensor protein PfeS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P28788 9.86e-08 57 26 11 276 3 ntrB Sensory histidine kinase/phosphatase NtrB Proteus hauseri
P0DOA0 1.24e-07 57 25 11 282 1 cckA Sensor kinase CckA Brucella abortus (strain 2308)
Q53RH0 1.32e-07 57 24 5 243 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. japonica
A2XL32 1.32e-07 57 24 5 243 2 ERS1 Probable ethylene response sensor 1 Oryza sativa subsp. indica
O49187 1.35e-07 57 23 8 258 2 ETR2 Ethylene receptor 2 Solanum lycopersicum
Q9I4F8 1.77e-07 57 26 5 215 3 phoQ Two-component sensor PhoQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P10047 1.82e-07 57 25 11 246 3 dctB C4-dicarboxylate transport sensor protein DctB Rhizobium leguminosarum
Q54W36 1.83e-07 57 40 0 76 3 dhkH Hybrid signal transduction histidine kinase H Dictyostelium discoideum
P0DM80 2.44e-07 56 24 6 228 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
F5ZP94 2.44e-07 56 24 6 228 2 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain ATCC 68169 / UK-1)
E1WFA0 2.44e-07 56 24 6 228 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain SL1344)
D0ZV89 2.44e-07 56 24 6 228 1 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhimurium (strain 14028s / SGSC 2262)
Q5PMJ0 2.44e-07 56 24 6 228 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57QC4 2.44e-07 56 24 6 228 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella choleraesuis (strain SC-B67)
Q9I0I2 2.46e-07 56 24 6 221 3 carS Sensor protein kinase CarS Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A1A699 2.47e-07 57 21 7 300 1 HK6 Probable histidine kinase 6 Oryza sativa subsp. japonica
Q8Z7H3 2.55e-07 56 24 6 228 3 phoQ Virulence sensor histidine kinase PhoQ Salmonella typhi
Q9P4U6 2.73e-07 56 23 6 313 1 tcsB Two-component system protein B Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q95PI2 2.84e-07 56 25 10 274 1 dhkC Hybrid signal transduction histidine kinase C Dictyostelium discoideum
Q86AT9 3.01e-07 56 35 0 82 3 dhkI-1 Hybrid signal transduction histidine kinase I Dictyostelium discoideum
O34971 4.01e-07 56 25 8 244 3 kdpD Sensor protein KdpD Rathayibacter rathayi
P39928 4.42e-07 56 39 0 69 1 SLN1 Osmosensing histidine protein kinase SLN1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7N6S2 4.79e-07 55 23 6 258 1 cqsS CAI-1 autoinducer sensor kinase/phosphatase CqsS Vibrio campbellii (strain ATCC BAA-1116)
Q82EB2 4.8e-07 55 29 9 197 3 cseC Sensor protein CseC Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
P37739 5.72e-07 55 24 7 232 3 dctS C4-dicarboxylate transport sensor protein DctS Rhodobacter capsulatus
O48929 6.05e-07 55 23 7 246 2 ETR1 Ethylene receptor Nicotiana tabacum
Q8THF6 8.25e-07 55 28 0 113 1 msmS Methyl sulfide methyltransferase-associated sensor Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q92H24 9.17e-07 54 31 2 103 3 RC0948 Putative sensor histidine kinase NtrY-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q7D9K1 9.95e-07 54 28 3 181 3 MT0630 Probable sensor histidine kinase HK Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P07167 1.63e-06 54 24 12 281 3 virA Limited host range VirA protein Rhizobium radiobacter
Q4L482 1.68e-06 53 22 7 217 3 graS Sensor histidine kinase GraS Staphylococcus haemolyticus (strain JCSC1435)
O35044 1.69e-06 53 21 7 228 1 bceS Sensor protein BceS Bacillus subtilis (strain 168)
O22267 1.9e-06 53 24 10 297 1 CKI1 Histidine kinase CKI1 Arabidopsis thaliana
A1A698 2.11e-06 53 36 0 80 2 HK4 Probable histidine kinase 4 Oryza sativa subsp. japonica
Q8DN03 2.22e-06 53 24 8 232 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
A0A0H2ZM62 2.22e-06 53 24 8 232 3 hk06 Sensor histidine protein kinase HK06 Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q83RR1 3.49e-06 52 22 4 226 3 phoQ Virulence sensor protein PhoQ Shigella flexneri
Q8FIB8 3.49e-06 52 22 4 226 3 phoQ Sensor protein PhoQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P23837 3.55e-06 52 22 4 226 1 phoQ Sensor protein PhoQ Escherichia coli (strain K12)
Q68WC5 3.95e-06 52 28 3 122 3 RT0603 Putative sensor histidine kinase NtrY-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q8X739 3.98e-06 52 22 4 226 3 phoQ Sensor protein PhoQ Escherichia coli O157:H7
Q9RZA4 4.18e-06 52 24 6 250 1 bphP Bacteriophytochrome Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9ZEP3 4.42e-06 52 28 9 198 1 cseC Sensor protein CseC Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P0C0Z0 1.06e-05 51 23 6 208 3 regB Sensor histidine kinase RegB Cereibacter sphaeroides
Q4UMD4 1.08e-05 51 29 2 110 3 RF_0427 Putative sensor histidine kinase NtrY-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P41503 2.63e-05 49 25 9 239 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhizobium leguminosarum bv. phaseoli
Q9ZCU7 2.83e-05 50 25 8 219 3 RP614 Putative sensor histidine kinase NtrY-like Rickettsia prowazekii (strain Madrid E)
P09431 5.16e-05 48 23 9 234 3 ntrB Sensory histidine kinase/phosphatase NtrB Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q3J6C1 5.17e-05 48 23 6 208 1 regB Sensor histidine kinase RegB Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
P30663 6.07e-05 48 24 10 239 1 nifL Nitrogen fixation regulatory protein Azotobacter vinelandii
P10578 8.05e-05 48 22 15 359 3 ntrB Sensory histidine kinase/phosphatase NtrB Bradyrhizobium sp. (strain RP501 Parasponia)
Q38846 8.2e-05 48 22 4 220 1 ERS1 Ethylene response sensor 1 Arabidopsis thaliana
Q9C5U0 0.000108 48 36 0 68 1 AHK4 Histidine kinase 4 Arabidopsis thaliana
P15939 0.000167 47 27 3 119 4 nodV Nodulation protein V Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1RJB3 0.000178 47 24 8 221 3 RBE_0470 Putative sensor histidine kinase NtrY-like Rickettsia bellii (strain RML369-C)
Q54Q69 0.000195 47 26 5 146 3 dhkG Hybrid signal transduction histidine kinase G Dictyostelium discoideum

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_17800
Feature type CDS
Gene phoR
Product phosphate regulon sensor histidine kinase PhoR
Location 24194 - 25489 (strand: 1)
Length 1296 (nucleotides) / 431 (amino acids)
In genomic island -

Contig

Accession ZDB_702
Length 42793 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2301
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00512 His Kinase A (phospho-acceptor) domain
PF00989 PAS fold
PF02518 Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
PF11808 Phosphate regulon sensor protein PhoR

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG5002 Signal transduction mechanisms (T) T Sensor histidine kinase WalK

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K07636 two-component system, OmpR family, phosphate regulon sensor histidine kinase PhoR [EC:2.7.13.3] Two-component system -

Protein Sequence

MLERLSWKKIVLELLVFCLPALFLSLFFGYTGWFLAGALFAAAVWHSYNLLKLSDWLWLDRSMLPPPGRSSWEPIFYGIYQLQQRNRKRRRELATLIKRFRSGAESLPDAVVMMTEDGNIFWCNKHAQHLLGFRWPDDNGQHIFNLLRYPDFSRYLTAGDYTLPLTLELNNGSMMELRIMPYSEGQLLMVARDVTEKRRLENSRRDFFANVSHELRTPLTVLQGYLEMLADQDFDNPMNKKAILTMQEQTRRMDGMVKQLLQLSKIEVAVKSGLDQVVDVPGMLIMLQQEAVTLSRGNHDIRFAVDDKLKIFGDEEELRSAMSNLVYNAVNHTPENTRIEVSWALRNGNAVFSVKDNGPGIPAEHLSRLTERFYRVDKSRSRQTGGSGLGLAIVKHALQHHHTHLDITSKPGQGTEFSFTIPARLIAKSSH

Flanking regions ( +/- flanking 50bp)

GCTTCTCTGTCCGTTACTGATAATAATGTTAAACCGCAAGAGGATCGCGCGTGCTTGAGCGTCTTTCGTGGAAAAAAATTGTACTGGAATTACTGGTTTTCTGCCTGCCGGCACTCTTTTTGTCACTTTTTTTCGGCTATACCGGCTGGTTTCTTGCCGGTGCCCTGTTTGCCGCTGCCGTCTGGCACAGCTATAACTTACTGAAATTGTCTGACTGGCTGTGGCTGGATCGCAGTATGCTGCCACCGCCCGGCCGCAGCAGCTGGGAGCCGATTTTTTACGGTATCTACCAGCTTCAGCAGCGTAACCGCAAGCGCCGCCGTGAACTCGCCACCCTGATCAAACGCTTTCGCAGCGGGGCAGAATCCCTGCCGGATGCGGTGGTGATGATGACAGAAGACGGCAATATTTTCTGGTGTAACAAACATGCCCAGCACCTTCTCGGTTTCCGCTGGCCGGATGATAACGGGCAGCACATCTTTAACCTTCTGCGTTACCCGGATTTCAGCCGTTATCTGACTGCAGGTGACTATACCCTGCCGCTGACGCTGGAACTGAATAACGGCAGCATGATGGAATTGCGCATCATGCCGTATTCAGAAGGGCAGTTGCTGATGGTTGCCCGCGATGTGACGGAAAAACGCCGTCTTGAAAACTCGCGGCGTGATTTCTTTGCCAATGTCAGTCACGAACTGCGCACGCCGCTGACGGTTTTGCAGGGCTATCTGGAGATGCTCGCGGATCAGGATTTTGATAATCCGATGAATAAAAAAGCGATTCTGACCATGCAGGAGCAGACCCGCCGTATGGACGGCATGGTTAAACAGCTTTTGCAGCTCTCAAAAATTGAAGTGGCTGTCAAAAGCGGGCTGGATCAGGTTGTGGATGTGCCGGGGATGCTGATAATGCTTCAGCAGGAAGCCGTGACGCTCAGCCGGGGTAACCATGACATCCGCTTTGCGGTGGATGACAAACTGAAGATTTTCGGGGATGAGGAAGAGCTGCGCAGCGCCATGTCGAACCTGGTGTATAACGCGGTAAATCATACTCCGGAAAATACACGGATTGAGGTCAGCTGGGCGCTGCGTAACGGTAACGCGGTGTTCAGTGTGAAAGATAACGGTCCGGGCATTCCGGCGGAACATCTGTCCCGCCTGACTGAACGTTTTTACCGCGTGGATAAATCCCGTTCGCGGCAGACCGGCGGCTCCGGTCTGGGGCTGGCGATAGTGAAACACGCTTTACAGCATCACCACACCCATCTGGATATTACCAGCAAACCCGGGCAGGGAACGGAGTTCAGTTTTACCATTCCTGCGCGGCTTATCGCTAAGTCTTCTCATTAAAGCGGCTTTTGCCGCTTTCTTTATTTAATCGCTGCTAATTTCAGCAGATT