Homologs in group_1124

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06420 FBDBKF_06420 90.3 Morganella morganii S1 carB carbamoyl-phosphate synthase large subunit
EHELCC_09465 EHELCC_09465 90.3 Morganella morganii S2 carB carbamoyl-phosphate synthase large subunit
NLDBIP_09845 NLDBIP_09845 90.3 Morganella morganii S4 carB carbamoyl-phosphate synthase large subunit
LHKJJB_07910 LHKJJB_07910 90.3 Morganella morganii S3 carB carbamoyl-phosphate synthase large subunit
HKOGLL_07460 HKOGLL_07460 90.3 Morganella morganii S5 carB carbamoyl-phosphate synthase large subunit
F4V73_RS15505 F4V73_RS15505 89.9 Morganella psychrotolerans carB carbamoyl-phosphate synthase large subunit

Distribution of the homologs in the orthogroup group_1124

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1124

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P14846 0.0 2036 90 0 1075 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z9L7 0.0 2033 90 0 1075 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
P00968 0.0 2026 90 0 1073 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
P63738 0.0 2024 90 0 1073 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
P63737 0.0 2024 90 0 1073 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
Q8FLB0 0.0 2022 90 0 1073 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8ZIL4 0.0 2017 89 0 1073 3 carB Carbamoyl phosphate synthase large chain Yersinia pestis
Q9KPH9 0.0 1898 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MNU0 0.0 1886 83 1 1075 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q8DEM2 0.0 1886 83 1 1075 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q87SF3 0.0 1881 83 1 1075 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8K9Z7 0.0 1703 74 1 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57244 0.0 1702 73 0 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P38100 0.0 1662 74 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87WP4 0.0 1645 73 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88DU6 0.0 1639 72 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P59448 0.0 1580 67 0 1075 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8RSS3 0.0 1571 71 2 1077 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
Q9CKV0 0.0 1522 69 4 1073 3 carB Carbamoyl phosphate synthase large chain Pasteurella multocida (strain Pm70)
Q9JXW8 0.0 1521 68 3 1074 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW02 0.0 1520 69 4 1074 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
P58943 0.0 1512 68 4 1080 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P58942 0.0 1508 68 4 1080 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
Q87EB8 0.0 1487 67 4 1080 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8XZ83 0.0 1483 68 7 1087 3 carB Carbamoyl phosphate synthase large chain Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9PEC1 0.0 1461 67 4 1080 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain 9a5c)
Q7VP67 0.0 1446 66 4 1070 3 carB Carbamoyl phosphate synthase large chain Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q59599 0.0 1445 66 3 1074 3 carB Carbamoyl phosphate synthase large chain Neisseria gonorrhoeae
Q9A4D6 0.0 1311 62 9 1072 3 carB Carbamoyl phosphate synthase large chain Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q8YIC2 0.0 1306 59 9 1134 3 carB Carbamoyl phosphate synthase large chain Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FZJ3 0.0 1306 59 9 1134 3 carB Carbamoyl phosphate synthase large chain Brucella suis biovar 1 (strain 1330)
Q1D6Y8 0.0 1285 60 5 1050 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
Q98I87 0.0 1281 58 11 1145 3 carB Carbamoyl phosphate synthase large chain Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q92PZ4 0.0 1276 58 12 1136 3 carB Carbamoyl phosphate synthase large chain Rhizobium meliloti (strain 1021)
O28994 0.0 1270 57 7 1078 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8UDE9 0.0 1270 57 11 1136 3 carB Carbamoyl phosphate synthase large chain Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8YQL2 0.0 1268 58 10 1105 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q55756 0.0 1267 58 10 1081 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q7UJ58 0.0 1255 59 5 1053 3 carB Carbamoyl phosphate synthase large chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
O50236 0.0 1248 59 11 1091 3 carB Carbamoyl phosphate synthase large chain Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
C1A4I5 0.0 1236 58 5 1045 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q42601 0.0 1225 57 9 1068 1 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Arabidopsis thaliana
B9EXM2 0.0 1211 57 12 1083 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
B9EXM2 1.83e-65 244 36 6 390 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
Q9PIL7 0.0 1206 55 11 1096 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q8F832 0.0 1204 54 7 1103 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF1 0.0 1204 54 7 1103 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q1IPK2 0.0 1199 55 10 1095 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
C1F1S6 0.0 1179 56 9 1072 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
B9KB91 0.0 1161 54 12 1085 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B8H8U5 0.0 1155 53 10 1103 3 carB Carbamoyl phosphate synthase large chain Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
Q9KXR6 0.0 1151 55 13 1076 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B1L8T8 0.0 1150 55 12 1083 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
A1R6Z3 0.0 1146 52 10 1103 3 carB Carbamoyl phosphate synthase large chain Paenarthrobacter aurescens (strain TC1)
Q9WZ27 0.0 1145 54 12 1083 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5IJL8 0.0 1145 54 12 1083 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
O25577 0.0 1143 53 12 1082 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
Q827Q7 0.0 1142 55 14 1077 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A9WSA8 0.0 1141 53 13 1103 3 carB Carbamoyl phosphate synthase large chain Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q9ZKT2 0.0 1141 53 12 1083 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
B1W463 0.0 1139 55 16 1077 3 carB Carbamoyl phosphate synthase large chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
A0JX72 0.0 1134 52 12 1104 3 carB Carbamoyl phosphate synthase large chain Arthrobacter sp. (strain FB24)
Q1IWM0 0.0 1134 59 5 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
C1CXR4 0.0 1131 60 6 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q1AVY9 0.0 1130 55 6 1038 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
B2GI87 0.0 1127 52 12 1103 3 carB Carbamoyl phosphate synthase large chain Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
Q9RWK0 0.0 1123 59 6 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6WCC6 0.0 1115 52 12 1107 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A5CRX5 0.0 1113 53 13 1096 3 carB Carbamoyl phosphate synthase large chain Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B0REV9 0.0 1112 53 13 1096 3 carB Carbamoyl phosphate synthase large chain Clavibacter sepedonicus
O27077 0.0 1112 53 11 1075 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8FT42 0.0 1110 51 18 1121 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
C5CCF1 0.0 1106 52 13 1103 3 carB Carbamoyl phosphate synthase large chain Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q469Z7 0.0 1105 51 7 1052 3 carB Carbamoyl phosphate synthase large chain Methanosarcina barkeri (strain Fusaro / DSM 804)
C5C687 0.0 1103 54 11 1061 3 carB Carbamoyl phosphate synthase large chain Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
B8DTW3 0.0 1098 52 14 1123 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
A8F453 0.0 1097 53 8 1040 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q8TNY4 0.0 1093 50 7 1052 3 carB Carbamoyl phosphate synthase large chain Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P58939 0.0 1093 51 18 1120 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P58944 0.0 1092 50 11 1089 3 carB Carbamoyl phosphate synthase large chain Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q7U054 0.0 1091 51 16 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPK3 0.0 1091 51 16 1120 1 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPK2 0.0 1091 51 16 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P46537 0.0 1091 52 8 1048 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
Q9CCR2 0.0 1085 50 15 1121 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
B7GPW2 0.0 1085 51 14 1123 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
O50302 0.0 1084 52 8 1034 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
A5UKG5 0.0 1084 52 8 1053 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 1.02e-63 238 34 9 437 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 4.43e-63 236 35 5 385 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A1A0T4 0.0 1083 50 14 1126 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A0B8K9 0.0 1082 51 8 1052 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
A1T8H1 0.0 1080 51 16 1121 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q1B9F9 0.0 1080 50 15 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 0.0 1080 50 15 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 0.0 1080 50 15 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
Q8G815 0.0 1078 51 15 1124 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain NCC 2705)
B3DQ32 0.0 1078 51 15 1124 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain DJO10A)
Q5SKN1 0.0 1077 55 11 1017 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A4TBY6 0.0 1074 50 16 1118 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)
P96495 0.0 1072 55 11 1017 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B1YIR9 0.0 1053 51 8 1048 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
P25994 0.0 1048 50 9 1049 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
Q9K9V9 0.0 1047 51 10 1050 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0AJU0 0.0 1040 51 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q71YI1 0.0 1038 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain F2365)
B8DDR7 0.0 1037 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4a (strain HCC23)
B1HQC1 0.0 1036 49 8 1048 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
C1KWD4 0.0 1036 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8Y665 0.0 1035 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9A0C6 0.0 1034 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M1
Q732I3 0.0 1034 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1WVA9 0.0 1033 49 10 1054 3 carB Carbamoyl phosphate synthase large chain Ligilactobacillus salivarius (strain UCC118)
Q74J34 0.0 1033 49 10 1062 3 carB Carbamoyl phosphate synthase large chain Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B9IVW3 0.0 1032 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain Q1)
B7HLM0 0.0 1032 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH187)
A9VTC6 0.0 1032 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
Q636E0 0.0 1031 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ZK / E33L)
A8Z3P0 0.0 1031 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA10 0.0 1031 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MSSA476)
A6QGA4 0.0 1031 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Newman)
Q5HGM9 0.0 1031 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain COL)
Q2FZ72 0.0 1031 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHN5 0.0 1031 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300)
Q6HES8 0.0 1031 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
A2RF60 0.0 1030 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M5 (strain Manfredo)
Q2YXG5 0.0 1030 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
B7JJX3 0.0 1030 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH820)
P63740 0.0 1030 49 11 1057 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63739 0.0 1030 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS88 0.0 1030 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A6U122 0.0 1030 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A7X1F4 0.0 1030 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
C1EPQ0 0.0 1030 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain 03BB102)
A0RHQ8 0.0 1030 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis (strain Al Hakam)
Q5XCR6 0.0 1029 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q92AH3 0.0 1029 50 9 1048 3 carB Carbamoyl phosphate synthase large chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q819S3 0.0 1029 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6GHN2 0.0 1028 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MRSA252)
B7H6M2 0.0 1028 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain B4264)
P0DA14 0.0 1028 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q81WF2 0.0 1028 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis
C3L740 0.0 1028 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P656 0.0 1028 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain A0248)
B5XKW2 0.0 1028 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M49 (strain NZ131)
P58941 0.0 1028 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DA15 0.0 1026 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain SSI-1)
C4L5W3 0.0 1026 50 11 1050 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
Q8RG86 0.0 1025 49 9 1050 3 carB Carbamoyl phosphate synthase large chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q38X24 0.0 1025 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Latilactobacillus sakei subsp. sakei (strain 23K)
B3WEF5 0.0 1025 49 12 1067 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
A7GRL1 0.0 1025 50 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
B7IUP6 0.0 1025 49 10 1051 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
Q3K150 0.0 1024 49 12 1058 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q038Z2 0.0 1024 49 12 1067 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8DZQ7 0.0 1022 49 12 1058 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E5F5 0.0 1021 49 12 1058 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype III (strain NEM316)
Q03LT8 0.0 1021 49 11 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5F6 0.0 1021 49 11 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M0W9 0.0 1021 49 11 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain CNRZ 1066)
A8YVZ3 0.0 1020 49 11 1063 3 carB Carbamoyl phosphate synthase large chain Lactobacillus helveticus (strain DPC 4571)
Q03HB0 0.0 1019 50 10 1050 3 carB Carbamoyl phosphate synthase large chain Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
P58940 0.0 1018 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MW2)
Q047M8 0.0 1018 49 11 1063 3 carB Carbamoyl phosphate synthase large chain Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q67Q54 0.0 1018 49 12 1080 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5FJC0 0.0 1017 48 11 1064 3 carB Carbamoyl phosphate synthase large chain Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q8DUP3 0.0 1015 50 12 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q8CPJ4 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q4L5Q5 0.0 1014 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus haemolyticus (strain JCSC1435)
Q5HPY8 0.0 1013 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B9DPN2 0.0 1013 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
B8GEA3 0.0 1013 51 13 1052 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B1I4M8 0.0 1012 48 11 1066 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
B9EB69 0.0 1011 49 12 1052 3 carB Carbamoyl phosphate synthase large chain Macrococcus caseolyticus (strain JCSC5402)
C0M756 0.0 1010 49 10 1057 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. equi (strain 4047)
C1CEM9 0.0 1009 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain JJA)
B1IC65 0.0 1009 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Hungary19A-6)
Q03WW7 0.0 1008 48 12 1077 3 carB Carbamoyl phosphate synthase large chain Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
B5E512 0.0 1007 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 19F (strain G54)
P77886 0.0 1007 49 10 1049 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C1CL09 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain P1031)
C1CR31 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Taiwan19F-14)
Q8CWR0 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97QE4 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C1C7Q3 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain 70585)
Q04K48 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C0MEH1 0.0 1006 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. zooepidemicus (strain H70)
B2GD06 0.0 1006 49 11 1053 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B2IQ67 0.0 1005 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain CGSP14)
B8ZJT9 0.0 1005 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
A7I6J1 0.0 1001 51 11 1051 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
A3CNI5 0.0 1000 49 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus sanguinis (strain SK36)
Q49WY4 0.0 999 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2FLD9 0.0 999 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A8AX83 0.0 997 49 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q834E2 0.0 995 49 11 1051 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
A3CU73 0.0 995 50 13 1056 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
B9DRV7 0.0 994 48 10 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus uberis (strain ATCC BAA-854 / 0140J)
B9KXM5 0.0 991 48 13 1082 3 carB Carbamoyl phosphate synthase large chain Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B2G564 0.0 991 47 12 1074 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHN6 0.0 991 47 12 1074 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri (strain DSM 20016)
Q8XHB3 0.0 988 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
Q04H29 0.0 988 47 9 1050 3 carB Carbamoyl phosphate synthase large chain Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q0TM79 0.0 986 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SPY4 0.0 984 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
B2A170 0.0 984 46 9 1089 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B0K4D7 0.0 983 47 10 1050 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
Q9CFV2 0.0 982 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. lactis (strain IL1403)
A2SQ53 0.0 981 48 12 1074 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
B1MZ74 0.0 979 49 11 1051 3 carB Carbamoyl phosphate synthase large chain Leuconostoc citreum (strain KM20)
Q8RBK0 0.0 977 48 10 1050 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7GE89 0.0 976 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FNY3 0.0 976 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
O32771 0.0 975 48 10 1056 2 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain MG1363)
A9KI94 0.0 973 47 11 1075 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
Q02YG5 0.0 973 48 10 1056 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain SK11)
B0KBW4 0.0 967 48 10 1050 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
A5D508 0.0 966 48 10 1059 3 carB Carbamoyl phosphate synthase large chain Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q6A914 0.0 964 48 11 1059 3 carB Carbamoyl phosphate synthase large chain Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q97FT3 0.0 964 47 10 1036 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97FT3 6.2e-64 239 33 7 415 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B1KT07 0.0 962 46 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
A6LPD9 0.0 961 46 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
C4ZEK2 0.0 956 45 11 1079 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B2UX86 0.0 951 45 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
B2THH3 0.0 949 45 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
B8D1H3 0.0 942 47 13 1052 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
P07756 0.0 861 42 13 1057 1 Cps1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Rattus norvegicus
Q9K8V7 0.0 860 45 11 981 3 carB Carbamoyl phosphate synthase arginine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q8C196 0.0 856 42 13 1057 1 Cps1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Mus musculus
P31327 0.0 850 42 13 1057 1 CPS1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Homo sapiens
Q9HP43 0.0 848 47 18 1002 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9HP43 1.29e-56 217 33 7 415 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9ZB63 0.0 848 47 10 956 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
Q9ZB63 2.52e-59 225 33 12 448 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
P18185 0.0 846 46 12 949 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
O93937 0.0 831 44 9 987 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O93937 4.8e-56 217 34 8 424 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9RLS9 0.0 828 46 11 943 3 carB1 Carbamoyl phosphate synthase arginine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P07259 0.0 818 41 13 1074 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P07259 1.42e-55 215 31 10 514 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q09794 0.0 816 43 8 983 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q09794 8.44e-54 209 34 8 422 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q91293 0.0 809 40 11 1046 2 None Carbamoyl-phosphate synthase [ammonia], mitochondrial Aquarana catesbeiana
Q7S8A6 0.0 803 43 10 996 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7S8A6 3.17e-59 226 35 7 422 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P27708 0.0 796 43 10 984 1 CAD Multifunctional protein CAD Homo sapiens
Q9HK17 0.0 795 44 21 1040 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q91437 0.0 791 40 13 1054 2 CAD Multifunctional protein CAD Squalus acanthias
Q91437 4.38e-50 198 30 11 458 2 CAD Multifunctional protein CAD Squalus acanthias
P08955 0.0 790 42 13 1022 1 CAD Multifunctional protein CAD Mesocricetus auratus
B2RQC6 0.0 790 42 13 1023 1 Cad Multifunctional protein CAD Mus musculus
Q8U085 0.0 780 43 14 1002 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A2BJL3 0.0 779 43 9 942 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
O94313 0.0 777 42 11 970 3 arg4 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P20054 0.0 774 39 17 1074 1 pyr1-3 Multifunctional protein pyr1-3 Dictyostelium discoideum
Q97AJ3 0.0 766 40 24 1084 3 carB Carbamoyl phosphate synthase large chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
P05990 0.0 766 40 11 1020 1 r Multifunctional protein r Drosophila melanogaster
Q970U7 0.0 764 42 11 957 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
C3NH23 0.0 759 42 11 972 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3NEM0 0.0 758 42 11 972 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MQE3 0.0 758 42 11 972 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
Q18990 0.0 756 40 13 1033 1 pyr-1 Multifunctional protein pyr-1 Caenorhabditis elegans
Q18990 3.6e-57 220 35 6 393 1 pyr-1 Multifunctional protein pyr-1 Caenorhabditis elegans
C3MW21 0.0 756 42 11 972 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3N664 0.0 756 42 11 972 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
Q7SH52 0.0 756 40 12 982 1 arg-3 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
C4KHM7 0.0 755 42 11 972 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q75D66 0.0 747 40 20 1061 3 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q59969 0.0 745 42 9 950 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q4J8E8 0.0 743 41 11 954 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P46056 0.0 742 39 17 1053 3 argA Carbamoyl phosphate synthase arginine-specific large chain Cutaneotrichosporon cutaneum
P46056 2.03e-56 217 31 10 448 3 argA Carbamoyl phosphate synthase arginine-specific large chain Cutaneotrichosporon cutaneum
P03965 0.0 736 41 11 944 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O67869 0.0 684 61 4 550 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
O67869 4.68e-71 250 37 6 393 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
Q8ZY48 0.0 679 41 15 973 3 carB Carbamoyl phosphate synthase large chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q58776 0.0 585 50 7 609 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58776 1.36e-67 242 35 6 399 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O67233 0.0 561 54 2 506 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
O67233 2.73e-66 236 36 7 391 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
Q8TWX0 0.0 555 52 7 558 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TWX0 3.88e-64 231 38 5 389 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q58773 1.61e-172 517 55 4 468 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58773 7.26e-62 222 36 7 390 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TUT7 7.5e-167 505 53 5 492 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TUT7 1.48e-78 271 36 6 429 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P13258 2.22e-125 391 51 0 362 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
P13258 2.05e-33 137 32 7 301 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
A6Q186 8.81e-14 78 26 6 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
A6Q186 1.87e-07 58 27 5 160 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
Q58626 5.31e-13 76 26 10 325 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58626 2.41e-10 68 23 5 243 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9KWU4 5.32e-13 77 24 8 321 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q9KWU4 7.06e-08 60 23 9 266 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
D3DJ42 7.39e-12 72 27 6 240 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
D3DJ42 4.94e-07 57 25 6 244 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
O27939 1.71e-11 71 24 6 273 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27939 4.49e-07 57 26 12 282 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q5LUF3 1.91e-11 72 24 6 273 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUF3 1.04e-05 53 23 12 334 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A2CE36 3.05e-11 70 31 9 231 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
A2CE36 0.000248 48 24 8 203 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
Q7V3S4 3.49e-11 70 31 9 231 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
Q7V3S4 0.000248 48 23 10 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
Q7VBB3 8.44e-11 68 26 6 202 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7VBB3 0.000105 49 22 13 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
O30019 1.01e-10 69 22 7 320 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O30019 4.08e-06 54 23 5 240 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A5GX22 1.41e-10 68 25 12 271 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
A5GX22 8.82e-08 59 26 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
O17732 3.28e-10 68 26 10 308 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
O17732 4.22e-06 55 23 6 234 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
Q7M8I0 4.9e-10 66 24 6 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M8I0 1.82e-07 58 26 4 157 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P0DTA4 5.36e-10 67 27 7 269 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
P0DTA4 5.77e-08 60 24 10 331 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
A8ACE0 8.65e-10 65 26 9 243 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q0CLK1 1.12e-09 66 25 6 279 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CLK1 0.000344 48 24 8 235 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O93918 1.26e-09 66 25 6 279 2 pyc Pyruvate carboxylase Aspergillus terreus
O93918 0.000335 48 24 8 235 2 pyc Pyruvate carboxylase Aspergillus terreus
Q5LD90 2.44e-09 64 24 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P32528 2.9e-09 65 24 8 307 1 DUR1,2 Urea amidolyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q0I600 4.24e-09 63 28 6 199 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9311)
P37798 4.61e-09 63 25 6 248 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37798 7.25e-07 56 23 9 328 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A5GPT7 5.15e-09 63 29 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain WH7803)
B8GRA4 5.2e-09 63 26 11 308 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q30UL7 6.65e-09 62 24 10 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A6L404 6.89e-09 62 24 10 302 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A3N7B6 8.91e-09 62 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 668)
A3N7B6 0.000319 48 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 668)
Q63VY4 9.64e-09 62 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain K96243)
Q63VY4 0.000297 48 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUJ4 9.64e-09 62 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1710b)
Q3JUJ4 0.000297 48 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT04 9.64e-09 62 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1106a)
A3NT04 0.000297 48 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1106a)
Q64UB2 9.67e-09 62 24 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain YCH46)
Q8A9W1 9.76e-09 62 24 7 234 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P05165 1.21e-08 63 25 12 335 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
P05165 1.77e-08 62 26 7 272 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
A5H0J2 1.35e-08 63 25 7 269 3 DUR1,2 Urea amidolyase Lachancea kluyveri
P39771 1.75e-08 61 29 6 184 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus subtilis (strain 168)
P39771 2.42e-05 51 23 5 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus subtilis (strain 168)
Q142Q7 2.47e-08 61 24 9 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paraburkholderia xenovorans (strain LB400)
Q142Q7 0.000765 47 24 5 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paraburkholderia xenovorans (strain LB400)
A1V2C2 2.47e-08 61 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain SAVP1)
A1V2C2 0.000432 47 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain SAVP1)
Q62IF4 2.47e-08 61 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain ATCC 23344)
Q62IF4 0.000432 47 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4F3 2.47e-08 61 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10229)
A2S4F3 0.000432 47 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI07 2.47e-08 61 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10247)
A3MI07 0.000432 47 22 5 193 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10247)
Q91ZA3 3e-08 61 24 11 331 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q91ZA3 9.76e-07 56 25 8 277 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q4JC46 3.22e-08 60 24 8 231 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q4JC46 5.83e-05 50 29 5 122 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q9HES8 4.63e-08 61 23 13 443 3 pyc Pyruvate carboxylase Aspergillus niger
Q39E61 5.43e-08 60 24 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
B9FK36 6.28e-08 61 23 7 241 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
B9FK36 0.000115 50 23 5 190 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
Q3AUF2 8.41e-08 59 23 14 310 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
Q3AUF2 1.02e-05 52 26 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
Q3AG69 1e-07 59 29 11 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
Q3AG69 9.07e-06 53 22 12 302 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
P52873 1.05e-07 60 23 10 325 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
P52873 5.59e-05 51 21 10 348 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
A1SWW0 1.19e-07 58 29 9 234 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q42523 1.21e-07 59 25 6 208 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Arabidopsis thaliana
P32327 1.3e-07 59 23 6 283 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32327 1.2e-05 53 23 6 234 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8FMB3 1.34e-07 58 26 6 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q9KDS9 1.35e-07 58 22 6 244 3 accC Biotin carboxylase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A0A0H3JRU9 1.51e-07 59 23 5 243 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0H3JRU9 1.15e-05 53 24 8 266 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q06862 1.54e-07 58 22 5 244 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q06862 4.49e-05 50 22 7 241 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P78820 1.64e-07 59 21 7 247 1 cut6 Acetyl-CoA carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q46KI4 1.65e-07 58 26 4 149 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
Q3M8Q4 1.8e-07 58 28 6 160 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M8Q4 3.49e-05 51 24 7 203 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q05920 1.9e-07 59 23 10 325 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q05920 7.59e-05 50 22 12 352 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
P11154 2.16e-07 59 24 8 325 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P11154 0.000161 49 23 6 234 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q96Y60 2.33e-07 58 29 3 118 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q96Y60 3.57e-07 57 25 7 228 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
A1U3I4 2.48e-07 58 26 8 236 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4JXR6 2.5e-07 58 29 2 169 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium jeikeium (strain K411)
B9N843 2.72e-07 58 22 10 274 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
B9N843 1.59e-05 52 22 6 240 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
Q9UUE1 2.98e-07 58 24 6 236 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UUE1 3.73e-05 52 25 7 280 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A2C2S8 5.21e-07 57 26 4 149 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
A4T9D5 5.59e-07 57 26 12 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycolicibacterium gilvum (strain PYR-GCK)
B9HBA8 6.07e-07 57 22 7 237 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
B9HBA8 7.33e-07 57 22 6 240 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
Q7U3B3 6.56e-07 56 27 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parasynechococcus marenigrum (strain WH8102)
Q7V179 6.67e-07 56 25 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q29RK2 6.89e-07 57 23 10 325 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
Q29RK2 8.26e-05 50 21 10 348 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
Q5E4R4 6.99e-07 56 23 9 290 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q0W4L8 8.17e-07 56 25 3 137 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q0W4L8 0.000344 48 25 3 138 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
A4JGK4 8.45e-07 56 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q0SEI4 1.04e-06 56 27 10 233 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q0SEI4 0.000297 48 26 2 104 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q8YXB6 1.12e-06 55 29 3 115 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q8YXB6 0.000111 49 24 7 203 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A6LHW2 1.17e-06 55 27 9 269 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A6LHW2 0.000837 47 31 4 115 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
P11498 1.25e-06 56 23 10 325 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
P11498 0.00011 50 21 10 348 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
A6Q6K6 1.28e-06 55 23 5 226 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
A6Q6K6 3.19e-06 54 26 5 160 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
Q1BUU4 1.28e-06 55 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia orbicola (strain AU 1054)
A0K993 1.28e-06 55 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia cenocepacia (strain HI2424)
Q0BD59 1.34e-06 55 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q8EYF0 1.45e-06 55 25 9 278 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72LY0 1.45e-06 55 25 9 278 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q54J08 1.95e-06 56 22 3 189 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
Q54J08 0.000142 50 22 4 190 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
A2BWY5 2.68e-06 54 24 11 264 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9515)
A1S9F3 2.79e-06 54 24 8 293 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q58881 2.91e-06 54 22 8 293 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58881 1.31e-05 52 28 4 121 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A6VJ27 3.13e-06 54 24 18 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q0BP50 3.5e-06 54 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. holarctica (strain OSU18)
Q2A5V8 3.5e-06 54 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. holarctica (strain LVS)
A7N9C6 3.5e-06 54 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
P14882 3.5e-06 55 24 10 331 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
P14882 0.000175 49 24 8 277 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
Q8NM23 4.03e-06 54 24 5 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q8NM23 0.000626 47 26 2 117 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A4QHG1 4.03e-06 54 24 5 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium glutamicum (strain R)
A4QHG1 0.000626 47 26 2 117 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium glutamicum (strain R)
A6URA6 4.08e-06 54 31 5 119 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6URA6 9.68e-05 49 22 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q8S6N5 4.45e-06 55 26 3 164 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
Q8S6N5 5.49e-06 54 21 7 226 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
A0Q8N2 4.67e-06 53 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. novicida (strain U112)
B1Y650 5.38e-06 53 26 14 311 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
Q31AM1 5.9e-06 53 23 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9312)
C4XMB3 6.3e-06 53 25 6 221 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
C4XMB3 0.000177 48 31 3 112 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
O04983 6.31e-06 53 22 10 274 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
O04983 8.07e-05 50 24 6 205 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
Q2SJZ8 6.54e-06 53 24 9 273 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Hahella chejuensis (strain KCTC 2396)
C1DDZ2 6.58e-06 53 25 4 195 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
C1DDZ2 8.98e-05 50 30 3 116 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q6M079 6.71e-06 53 24 18 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q0HS20 6.9e-06 53 26 5 224 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain MR-7)
Q612F5 7.23e-06 53 23 6 246 3 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis briggsae
A4VIT1 7.44e-06 53 34 4 106 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stutzerimonas stutzeri (strain A1501)
Q2SZW6 7.8e-06 53 24 9 292 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A9A6Q7 7.91e-06 53 24 18 319 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
P49787 8.43e-06 53 24 6 244 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
P49787 1.57e-05 52 23 9 325 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
A6VIB2 1e-05 52 31 4 108 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A6VIB2 1.74e-05 52 23 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
O34544 1.02e-05 53 22 8 242 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
O34544 7.24e-05 50 22 7 246 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
Q2N8K3 1.04e-05 52 23 4 161 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Erythrobacter litoralis (strain HTCC2594)
A4IVS8 1.06e-05 52 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. tularensis (strain WY96-3418)
Q5NE84 1.08e-05 52 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14FN7 1.08e-05 52 23 2 171 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Francisella tularensis subsp. tularensis (strain FSC 198)
A4G068 1.09e-05 52 31 4 108 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A4G068 3.56e-05 51 22 5 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
C6BV99 1.15e-05 52 32 4 106 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
C6BV99 5.19e-05 50 25 10 291 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q19842 1.2e-05 53 22 6 246 1 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis elegans
B8DJ34 1.31e-05 52 25 4 195 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
B8DJ34 0.000674 47 33 4 106 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q2QMG2 1.31e-05 53 22 6 231 2 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Oryza sativa subsp. japonica
Q1LMC7 1.41e-05 52 26 14 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q6M0Z5 1.47e-05 52 32 4 108 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6M0Z5 7.58e-05 50 22 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q5JFN8 1.52e-05 52 24 12 254 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
A1RMT4 1.74e-05 52 25 5 220 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain W3-18-1)
A7Z0Z2 1.77e-05 52 33 4 109 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q38970 1.87e-05 53 24 5 190 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
Q38970 5.41e-05 51 20 7 225 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
F4I1L3 1.89e-05 52 22 8 286 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
F4I1L3 4.29e-05 51 21 5 197 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
Q9JSZ9 1.91e-05 51 25 8 260 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q5SH23 2.46e-05 50 37 1 83 1 lysX Alpha-aminoadipate--LysW ligase LysX Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q9K0Y0 3.12e-05 50 25 7 244 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0HFS6 3.31e-05 51 26 5 224 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain MR-4)
Q8KDJ0 3.41e-05 51 26 6 186 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
B4RQC3 3.9e-05 50 26 8 235 3 ddl D-alanine--D-alanine ligase Neisseria gonorrhoeae (strain NCCP11945)
Q5F6M0 3.9e-05 50 26 8 235 3 ddl D-alanine--D-alanine ligase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
A7GKE0 4.06e-05 50 24 9 205 3 ddl D-alanine--D-alanine ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q470L8 4.08e-05 50 26 14 300 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q12FU8 4.27e-05 50 25 13 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q65N65 4.46e-05 50 23 14 263 3 ddl D-alanine--D-alanine ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A0L052 4.57e-05 50 25 5 224 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella sp. (strain ANA-3)
Q81IU1 5.45e-05 50 22 7 199 3 ddlB D-alanine--D-alanine ligase B Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8X1T3 5.45e-05 51 24 5 254 3 PYC Pyruvate carboxylase Pichia angusta
Q8D2R3 5.65e-05 50 26 3 118 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wigglesworthia glossinidia brevipalpis
Q8D2R3 0.000189 48 21 12 302 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wigglesworthia glossinidia brevipalpis
P32874 7.03e-05 51 21 7 229 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32874 0.000115 50 20 4 202 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8U3M7 7.35e-05 50 25 7 166 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A1KVL1 7.46e-05 49 25 7 244 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
A6ZMR9 7.65e-05 50 21 7 229 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
A6ZMR9 0.00012 50 20 4 202 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
B1JDF0 7.88e-05 50 23 7 226 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas putida (strain W619)
A6US04 8.09e-05 50 22 16 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
C8ZF72 8.11e-05 50 20 4 202 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C8ZF72 0.000172 49 20 7 229 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C7GRE4 8.46e-05 50 20 4 202 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
C7GRE4 0.000172 49 20 7 229 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
Q8EBB7 8.56e-05 50 25 5 220 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
B3LM95 8.75e-05 50 20 4 202 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
B3LM95 0.000178 49 20 7 229 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
Q3SKP9 8.86e-05 50 25 6 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thiobacillus denitrificans (strain ATCC 25259)
B1MKI7 9.33e-05 49 26 10 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q9UY67 9.37e-05 50 25 7 166 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pyrococcus abyssi (strain GE5 / Orsay)
A0A4P8DJE6 9.45e-05 50 23 5 225 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
A0A4P8DJE6 0.000407 48 20 4 225 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
Q9HXP3 9.8e-05 49 23 6 221 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02RM4 9.8e-05 49 23 6 221 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas aeruginosa (strain UCBPP-PA14)
B7UYK0 9.8e-05 49 23 6 221 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas aeruginosa (strain LESB58)
A1ANT6 9.99e-05 49 20 10 318 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q897P8 0.000107 49 24 7 230 3 ddlA D-alanine--D-alanine ligase A Clostridium tetani (strain Massachusetts / E88)
O58056 0.000108 49 24 12 254 1 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
A1TE53 0.000111 49 25 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
A9BNI6 0.000121 49 25 12 306 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Delftia acidovorans (strain DSM 14801 / SPH-1)
Q8PN36 0.000128 49 26 8 222 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Xanthomonas axonopodis pv. citri (strain 306)
A4Y447 0.000132 49 25 5 224 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0KRH6 0.00014 49 23 7 222 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas putida (strain GB-1)
P24182 0.000164 49 23 6 245 1 accC Biotin carboxylase Escherichia coli (strain K12)
Q55336 0.000169 48 25 6 188 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q981B9 0.000172 48 29 6 122 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A7MVH5 0.000175 48 25 6 190 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio campbellii (strain ATCC BAA-1116)
P38095 0.000177 49 21 10 317 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P38095 0.000253 49 23 5 194 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q8X9B6 0.000199 48 23 6 245 3 accC Biotin carboxylase Escherichia coli O157:H7
Q88MW1 0.000232 48 23 7 222 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q0I203 0.000238 48 24 8 186 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Histophilus somni (strain 129Pt)
Q3A2G9 0.000242 48 28 11 237 3 ddl D-alanine--D-alanine ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A6UUH1 0.000252 48 29 4 106 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
E9Q4Z2 0.000264 49 21 6 237 1 Acacb Acetyl-CoA carboxylase 2 Mus musculus
Q5N3J5 0.000284 48 25 5 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31QP9 0.000284 48 25 5 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
A6WK72 0.000307 48 25 5 224 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella baltica (strain OS185)
A3D1A0 0.00031 48 25 5 224 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q7W006 0.000373 48 25 15 301 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
O25817 0.00039 47 24 6 172 3 purD Phosphoribosylamine--glycine ligase Helicobacter pylori (strain ATCC 700392 / 26695)
Q465Q9 0.000397 47 22 13 307 3 purD Phosphoribosylamine--glycine ligase Methanosarcina barkeri (strain Fusaro / DSM 804)
C3LLS4 0.000418 47 22 8 281 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio cholerae serotype O1 (strain M66-2)
Q39QR8 0.000421 47 24 8 233 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q9KSM8 0.000446 47 22 8 281 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A1VFP6 0.000452 47 33 3 106 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain DP4)
Q72E56 0.000452 47 33 3 106 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q7W3K5 0.000453 47 25 13 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WEY0 0.000465 47 25 13 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
P43873 0.000508 47 23 11 360 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P43873 0.000631 47 23 5 240 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A6GWP9 0.000521 47 23 7 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q3KHJ9 0.000735 47 22 5 220 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pseudomonas fluorescens (strain Pf0-1)
Q54KE6 0.000776 47 24 14 327 3 mccA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Dictyostelium discoideum
Q8KWS8 0.000837 47 24 7 229 1 bacD Alanine--anticapsin ligase Bacillus amyloliquefaciens
I3R7G3 0.000839 47 23 7 251 1 pccA Propionyl-CoA carboxylase, biotin carboxylase and biotin-carboxyl carrier subunit Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q18K60 0.000881 46 23 5 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Haloquadratum walsbyi (strain DSM 16790 / HBSQ001)
A4FZB0 0.001 47 24 18 319 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS00105
Feature type CDS
Gene carB
Product carbamoyl-phosphate synthase large subunit
Location 33316 - 36543 (strand: 1)
Length 3228 (nucleotides) / 1075 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1124
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02142 MGS-like domain
PF02786 Carbamoyl-phosphate synthase L chain, ATP binding domain
PF02787 Carbamoyl-phosphate synthetase large chain, oligomerisation domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0458 Amino acid transport and metabolism (E)
Nucleotide transport and metabolism (F)		 EF Carbamoylphosphate synthase large subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MAKRTDIKTILILGAGPIVIGQACEFDYSGAQACKALREEGYRVVLVNSNPATIMTDPEMADATYIEPIHWQVVRKIIEKERPDAILPTMGGQTALNCALELERQGVLAEFGVTMIGATADAIDKAEDRQRFDKAMKKIGLDTARSGIAHTMDEAFAVAEQVGFPCIIRPSFTMGGTGGGIAYNREEFEEICTRGLDLSPTNELLIDESLIGWKEYEMEVVRDKNDNCIIVCSIENFDAMGIHTGDSITVAPAQTLTDKEYQIMRNASMAVLREIGVETGGSNVQFAVDPKTGRLIVIEMNPRVSRSSALASKATGFPIAKVAAKLAVGYTLDELMNDITGGRTPASFEPSIDYVVTKIPRFNFEKFAGTNDRLTTQMKSVGEVMAIGRTQQESMQKALRGLEVGATGFDPKVNLDDPEALTKIRRELKEAGSDRIWYIADAFRAGMSVDGVFNLTNIDRWFLVQIEEIVRLEEQVAQLGLAGLNADFLRQLKRKGFADARLANILNVKEQAIRQLREQYQLHPVYKRVDTCAAEFATDTAYMYSTYEEECESDPNQDKPKVMVLGGGPNRIGQGIEFDYCCVHAALALREDGYETIMVNCNPETVSTDYDTSDRLYFEPVTLEDVLEIVRIEKPQGVIVQYGGQTPLKLARALEAEGVPVIGTSPDAIDKAEDRERFQKAVDKLGLKQPENATVTTLEEAVDKAKSIGYPLVVRPSYVLGGRAMEIVYDEIDLRRYFQTAVSVSNDAPVLLDRFLDDAIEVDVDAICDGQQVVIGGIMEHIEQAGVHSGDSACSLPAYTLSQDIQDIMRKQVRELAFELGVKGLMNVQFAVKGNDVYLIEVNPRAARTVPFVSKATGVPLAKVAARVMIGQSLEQQGVTKEVIPPYYSVKEVVLPFNKFSGVDPILGPEMRSTGEVMGVGATFAQAFAKAMLGSNSTMKKKGRALLSVREGDKKRVVDLATKLLKNGFELDATHGTAIVLGEAGINPRLVNKVHEGRPHIQDRIKNGEYDYIVNTTAGRQAIEDSKLIRRSALQYKVHYDTTLNGGFATTLSLSADPTIDVISVQEMHAKIKKS

Flanking regions ( +/- flanking 50bp)

TCGTCAAAACCTGCAATCAGTGACAAACAAATAAATCAGGAGTGAAAAAAATGGCTAAAAGAACAGATATTAAAACAATCCTGATTTTAGGTGCAGGCCCGATTGTGATTGGTCAAGCGTGTGAATTTGATTATTCAGGCGCACAAGCGTGTAAGGCATTGCGCGAAGAGGGATATCGTGTTGTTTTGGTAAATTCAAATCCTGCTACCATTATGACAGATCCTGAAATGGCAGATGCCACTTATATTGAGCCTATTCATTGGCAAGTGGTCAGAAAGATTATTGAGAAAGAGCGCCCTGATGCCATATTACCGACAATGGGCGGACAAACGGCATTAAACTGTGCCTTAGAATTAGAGCGTCAAGGGGTGTTAGCTGAATTTGGCGTAACAATGATAGGTGCAACGGCTGATGCTATTGATAAAGCGGAAGATAGACAACGCTTTGATAAAGCGATGAAAAAAATTGGTCTGGATACGGCTCGTTCAGGCATCGCTCATACTATGGACGAAGCATTTGCAGTGGCTGAGCAAGTGGGTTTCCCTTGTATTATTCGCCCTTCATTTACTATGGGGGGAACGGGAGGCGGGATCGCCTATAATCGTGAAGAATTTGAAGAAATTTGTACTCGAGGTTTAGATTTATCACCGACAAATGAACTATTAATTGATGAATCATTAATTGGCTGGAAAGAGTATGAAATGGAAGTGGTGCGCGATAAAAATGATAACTGTATTATCGTTTGCTCCATTGAAAACTTTGATGCGATGGGGATCCATACCGGTGACTCTATCACGGTTGCTCCAGCGCAAACGCTAACAGACAAAGAATATCAAATTATGCGTAATGCCTCGATGGCAGTATTACGCGAGATTGGGGTTGAAACTGGTGGCTCCAATGTGCAATTTGCCGTTGATCCTAAAACAGGGCGTTTAATTGTTATTGAAATGAATCCTCGTGTTTCTCGCTCATCAGCATTAGCGTCAAAAGCAACAGGTTTCCCAATTGCAAAAGTCGCGGCCAAACTTGCAGTAGGTTATACCCTCGATGAGTTGATGAATGATATCACTGGAGGAAGAACCCCAGCCTCTTTTGAACCTTCTATTGATTATGTAGTGACTAAAATCCCTCGCTTTAACTTTGAAAAATTTGCCGGTACCAATGACCGTTTAACCACGCAAATGAAATCTGTTGGTGAGGTGATGGCTATTGGGCGCACTCAACAAGAGTCAATGCAAAAAGCATTACGCGGACTAGAGGTTGGTGCAACTGGGTTTGATCCTAAAGTAAACCTCGACGATCCTGAAGCGCTCACCAAAATTCGTCGTGAATTAAAAGAAGCCGGATCGGATCGCATTTGGTATATCGCGGATGCTTTCCGCGCTGGAATGTCGGTTGATGGGGTGTTTAATCTCACCAATATCGATCGTTGGTTCTTAGTGCAAATAGAAGAGATTGTTCGCCTAGAAGAGCAAGTGGCACAACTTGGTTTAGCAGGTCTAAATGCTGATTTCTTGCGTCAATTAAAACGTAAAGGTTTTGCTGATGCGCGCCTAGCTAATATCTTGAATGTGAAAGAGCAAGCCATTCGCCAATTACGAGAACAATATCAATTACACCCAGTTTATAAACGGGTTGATACTTGTGCGGCAGAATTTGCTACGGATACCGCTTATATGTACTCCACTTATGAAGAAGAGTGTGAGTCGGATCCAAATCAAGACAAACCTAAAGTGATGGTCTTAGGTGGTGGTCCAAATCGTATCGGTCAGGGGATAGAGTTTGATTATTGTTGTGTTCATGCCGCTCTAGCATTACGGGAAGATGGGTATGAAACCATTATGGTCAATTGTAATCCAGAAACGGTTTCAACGGATTATGATACCTCCGATAGACTTTATTTTGAGCCAGTCACCCTTGAAGATGTATTAGAAATAGTACGGATCGAAAAACCACAAGGCGTGATTGTGCAATATGGTGGTCAAACGCCATTAAAATTAGCAAGAGCTTTAGAAGCTGAAGGGGTGCCTGTTATCGGTACCAGTCCTGATGCAATCGATAAAGCAGAAGACAGAGAACGTTTCCAAAAGGCCGTGGATAAGTTAGGGTTAAAACAACCAGAAAATGCCACAGTGACGACATTAGAAGAAGCGGTAGATAAGGCAAAATCTATTGGTTACCCGCTGGTGGTACGTCCATCTTATGTCCTTGGTGGACGAGCAATGGAAATTGTTTACGATGAAATTGATTTACGTCGTTATTTCCAAACGGCGGTCAGTGTTTCTAATGATGCTCCCGTACTGTTAGACCGATTCCTAGATGATGCCATTGAAGTGGATGTTGATGCGATTTGTGACGGTCAACAAGTGGTGATAGGCGGTATTATGGAGCATATCGAACAAGCGGGTGTTCACTCTGGAGACTCAGCTTGCTCTCTACCTGCTTATACTTTAAGCCAAGATATTCAAGATATAATGCGCAAGCAAGTACGTGAACTCGCTTTTGAATTAGGCGTTAAAGGGTTGATGAACGTACAGTTTGCGGTGAAAGGTAATGATGTTTATCTTATCGAAGTGAATCCTCGTGCCGCACGTACAGTGCCTTTTGTCTCTAAAGCAACCGGTGTGCCATTAGCAAAAGTTGCTGCTCGAGTGATGATAGGACAAAGTCTTGAACAGCAAGGCGTTACCAAAGAGGTGATCCCTCCTTACTACTCGGTTAAAGAGGTGGTACTTCCCTTTAATAAATTCTCAGGTGTCGACCCTATTTTAGGGCCTGAAATGCGATCTACCGGTGAAGTGATGGGGGTTGGTGCTACTTTTGCACAAGCTTTTGCTAAAGCGATGTTAGGTAGCAATTCCACCATGAAGAAAAAAGGAAGAGCGCTACTTTCGGTTCGTGAAGGTGATAAAAAACGTGTCGTTGATTTAGCAACTAAGCTATTGAAAAATGGTTTTGAGTTAGATGCAACACATGGTACTGCCATTGTCTTGGGGGAAGCCGGTATCAATCCTCGCCTAGTGAATAAAGTGCATGAAGGGCGACCTCATATTCAAGATAGAATTAAAAATGGTGAGTATGACTATATTGTCAATACGACTGCCGGTCGCCAAGCTATTGAGGATTCAAAATTGATCCGCCGTAGTGCATTACAATATAAAGTTCACTATGACACCACATTAAATGGCGGATTTGCGACAACACTGTCATTGAGTGCTGATCCTACTATTGATGTTATTTCAGTCCAAGAGATGCATGCAAAGATAAAAAAATCTTAATTTTTTAGTTGTTGTTATAACAATCCCGAATGGGTATTAATTACCTATTC