Homologs in group_1186

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06420 FBDBKF_06420 97.4 Morganella morganii S1 carB carbamoyl-phosphate synthase large subunit
EHELCC_09465 EHELCC_09465 97.4 Morganella morganii S2 carB carbamoyl-phosphate synthase large subunit
NLDBIP_09845 NLDBIP_09845 97.4 Morganella morganii S4 carB carbamoyl-phosphate synthase large subunit
LHKJJB_07910 LHKJJB_07910 97.4 Morganella morganii S3 carB carbamoyl-phosphate synthase large subunit
HKOGLL_07460 HKOGLL_07460 97.4 Morganella morganii S5 carB carbamoyl-phosphate synthase large subunit
PMI_RS00105 PMI_RS00105 89.9 Proteus mirabilis HI4320 carB carbamoyl-phosphate synthase large subunit

Distribution of the homologs in the orthogroup group_1186

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1186

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q8ZIL4 0.0 2024 90 0 1074 3 carB Carbamoyl phosphate synthase large chain Yersinia pestis
P14846 0.0 2022 90 0 1074 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63738 0.0 2021 90 0 1073 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
Q8FLB0 0.0 2021 90 0 1073 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63737 0.0 2021 90 0 1073 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
Q8Z9L7 0.0 2020 90 0 1074 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
P00968 0.0 2018 90 0 1073 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
Q9KPH9 0.0 1889 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87SF3 0.0 1877 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNU0 0.0 1875 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q8DEM2 0.0 1875 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q8K9Z7 0.0 1688 73 1 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57244 0.0 1684 72 0 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P38100 0.0 1654 75 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87WP4 0.0 1637 74 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88DU6 0.0 1635 73 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8RSS3 0.0 1597 73 2 1072 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
P59448 0.0 1585 66 0 1074 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P58943 0.0 1536 70 4 1080 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P58942 0.0 1531 69 4 1080 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
Q9CKV0 0.0 1520 69 4 1073 3 carB Carbamoyl phosphate synthase large chain Pasteurella multocida (strain Pm70)
Q87EB8 0.0 1501 68 4 1080 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9JXW8 0.0 1500 68 3 1076 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW02 0.0 1498 68 3 1076 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9PEC1 0.0 1475 68 4 1080 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain 9a5c)
Q8XZ83 0.0 1473 68 6 1087 3 carB Carbamoyl phosphate synthase large chain Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7VP67 0.0 1445 66 4 1070 3 carB Carbamoyl phosphate synthase large chain Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q59599 0.0 1431 65 3 1076 3 carB Carbamoyl phosphate synthase large chain Neisseria gonorrhoeae
Q8FZJ3 0.0 1318 60 8 1134 3 carB Carbamoyl phosphate synthase large chain Brucella suis biovar 1 (strain 1330)
Q8YIC2 0.0 1312 60 9 1134 3 carB Carbamoyl phosphate synthase large chain Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9A4D6 0.0 1306 62 10 1072 3 carB Carbamoyl phosphate synthase large chain Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q92PZ4 0.0 1288 59 10 1136 3 carB Carbamoyl phosphate synthase large chain Rhizobium meliloti (strain 1021)
Q98I87 0.0 1285 58 11 1146 3 carB Carbamoyl phosphate synthase large chain Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1D6Y8 0.0 1284 60 5 1050 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
O28994 0.0 1281 58 7 1080 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q8UDE9 0.0 1280 58 11 1136 3 carB Carbamoyl phosphate synthase large chain Agrobacterium fabrum (strain C58 / ATCC 33970)
Q55756 0.0 1274 60 9 1066 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O50236 0.0 1263 60 11 1091 3 carB Carbamoyl phosphate synthase large chain Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8YQL2 0.0 1261 58 9 1102 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7UJ58 0.0 1253 59 6 1054 3 carB Carbamoyl phosphate synthase large chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C1A4I5 0.0 1244 59 6 1046 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q42601 0.0 1229 58 10 1068 1 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Arabidopsis thaliana
Q9PIL7 0.0 1210 54 8 1099 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B9EXM2 0.0 1209 57 8 1061 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
B9EXM2 7.48e-67 249 35 6 401 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
Q1IPK2 0.0 1206 56 11 1098 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
C1F1S6 0.0 1204 57 9 1072 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q8F832 0.0 1204 55 10 1109 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF1 0.0 1204 55 10 1109 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B9KB91 0.0 1160 54 12 1109 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B1L8T8 0.0 1156 55 12 1085 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
Q9KXR6 0.0 1152 56 12 1076 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9WZ27 0.0 1152 55 12 1085 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A5IJL8 0.0 1151 55 12 1085 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q1IWM0 0.0 1150 60 5 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
A1R6Z3 0.0 1149 54 8 1069 3 carB Carbamoyl phosphate synthase large chain Paenarthrobacter aurescens (strain TC1)
B8H8U5 0.0 1149 54 8 1069 3 carB Carbamoyl phosphate synthase large chain Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
O25577 0.0 1149 53 12 1078 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
Q9ZKT2 0.0 1147 53 15 1104 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
C1CXR4 0.0 1143 61 6 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q827Q7 0.0 1142 55 12 1076 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9RWK0 0.0 1142 60 6 957 3 carB Carbamoyl phosphate synthase large chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A6WCC6 0.0 1138 56 12 1059 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
A0JX72 0.0 1137 54 10 1071 3 carB Carbamoyl phosphate synthase large chain Arthrobacter sp. (strain FB24)
B2GI87 0.0 1136 53 12 1104 3 carB Carbamoyl phosphate synthase large chain Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A9WSA8 0.0 1133 54 12 1078 3 carB Carbamoyl phosphate synthase large chain Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
B1W463 0.0 1127 55 15 1078 3 carB Carbamoyl phosphate synthase large chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q8FT42 0.0 1124 53 16 1092 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A5CRX5 0.0 1118 55 12 1057 3 carB Carbamoyl phosphate synthase large chain Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
B0REV9 0.0 1116 54 12 1061 3 carB Carbamoyl phosphate synthase large chain Clavibacter sepedonicus
O27077 0.0 1112 54 9 1053 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q1AVY9 0.0 1111 55 5 1038 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
C5C687 0.0 1110 54 11 1061 3 carB Carbamoyl phosphate synthase large chain Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
C5CCF1 0.0 1109 53 11 1070 3 carB Carbamoyl phosphate synthase large chain Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
Q469Z7 0.0 1107 50 8 1084 3 carB Carbamoyl phosphate synthase large chain Methanosarcina barkeri (strain Fusaro / DSM 804)
A0B8K9 0.0 1105 52 8 1052 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
B8DTW3 0.0 1099 52 13 1124 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
P58939 0.0 1097 53 15 1092 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
B7GPW2 0.0 1097 51 13 1124 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
Q7U054 0.0 1095 52 15 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WPK3 0.0 1095 52 15 1118 1 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPK2 0.0 1095 52 15 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8G815 0.0 1093 51 14 1125 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain NCC 2705)
B3DQ32 0.0 1093 51 14 1125 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain DJO10A)
P58944 0.0 1090 50 11 1088 3 carB Carbamoyl phosphate synthase large chain Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A1A0T4 0.0 1088 51 14 1125 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
A8F453 0.0 1087 53 9 1038 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
A5UKG5 0.0 1084 52 8 1046 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 4.15e-63 237 34 7 411 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q8TNY4 0.0 1083 50 7 1052 3 carB Carbamoyl phosphate synthase large chain Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q1B9F9 0.0 1082 51 14 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 0.0 1082 51 14 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 0.0 1082 51 14 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
P46537 0.0 1080 52 8 1048 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
Q5SKN1 0.0 1078 55 11 1017 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A1T8H1 0.0 1075 51 14 1117 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q9CCR2 0.0 1074 51 14 1117 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
O50302 0.0 1072 52 8 1034 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
P96495 0.0 1071 55 11 1017 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A4TBY6 0.0 1071 51 15 1117 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)
B1YIR9 0.0 1069 52 8 1048 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q9K9V9 0.0 1050 51 10 1049 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P25994 0.0 1040 50 8 1048 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
Q74J34 0.0 1038 49 9 1060 3 carB Carbamoyl phosphate synthase large chain Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q1WVA9 0.0 1036 49 10 1060 3 carB Carbamoyl phosphate synthase large chain Ligilactobacillus salivarius (strain UCC118)
Q8RG86 0.0 1036 50 8 1048 3 carB Carbamoyl phosphate synthase large chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q38X24 0.0 1033 49 11 1078 3 carB Carbamoyl phosphate synthase large chain Latilactobacillus sakei subsp. sakei (strain 23K)
B1HQC1 0.0 1029 49 8 1048 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
Q732I3 0.0 1027 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
C4L5W3 0.0 1025 50 11 1038 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
B3WEF5 0.0 1025 49 11 1054 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
B1I4M8 0.0 1024 48 11 1066 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
Q636E0 0.0 1024 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ZK / E33L)
B9IVW3 0.0 1024 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain Q1)
B7HLM0 0.0 1024 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH187)
A7GRL1 0.0 1024 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A0AJU0 0.0 1023 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q6HES8 0.0 1023 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
C1EPQ0 0.0 1023 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain 03BB102)
B7JJX3 0.0 1023 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH820)
A0RHQ8 0.0 1023 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis (strain Al Hakam)
Q71YI1 0.0 1023 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain F2365)
A9VTC6 0.0 1023 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
Q81WF2 0.0 1022 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis
C3L740 0.0 1022 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P656 0.0 1022 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain A0248)
B8DDR7 0.0 1022 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4a (strain HCC23)
Q819S3 0.0 1022 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2YXG5 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
C1KWD4 0.0 1021 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain CLIP80459)
Q5FJC0 0.0 1021 49 9 1060 3 carB Carbamoyl phosphate synthase large chain Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B7H6M2 0.0 1021 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain B4264)
Q9A0C6 0.0 1021 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M1
A8Z3P0 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA10 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MSSA476)
A6QGA4 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Newman)
Q5HGM9 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain COL)
Q2FZ72 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHN5 0.0 1021 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300)
B7IUP6 0.0 1021 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
A8YVZ3 0.0 1020 49 10 1061 3 carB Carbamoyl phosphate synthase large chain Lactobacillus helveticus (strain DPC 4571)
A2RF60 0.0 1020 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M5 (strain Manfredo)
Q038Z2 0.0 1020 49 11 1054 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
P63740 0.0 1019 49 10 1055 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63739 0.0 1019 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS88 0.0 1019 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A6U122 0.0 1019 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A7X1F4 0.0 1019 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8Y665 0.0 1019 50 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6GHN2 0.0 1018 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MRSA252)
Q047M8 0.0 1018 49 10 1061 3 carB Carbamoyl phosphate synthase large chain Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q67Q54 0.0 1018 49 11 1077 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q5XCR6 0.0 1018 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q92AH3 0.0 1018 50 9 1048 3 carB Carbamoyl phosphate synthase large chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q03LT8 0.0 1017 50 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5F6 0.0 1017 50 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M0W9 0.0 1017 50 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain CNRZ 1066)
Q4L5Q5 0.0 1017 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus haemolyticus (strain JCSC1435)
P58941 0.0 1016 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DA14 0.0 1014 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q3K150 0.0 1013 49 12 1059 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
P0DA15 0.0 1013 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain SSI-1)
B8GEA3 0.0 1012 50 13 1053 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
A7I6J1 0.0 1012 51 11 1051 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
B5XKW2 0.0 1011 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M49 (strain NZ131)
Q8DZQ7 0.0 1011 49 12 1059 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
C1CEM9 0.0 1011 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain JJA)
Q8CPJ4 0.0 1011 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HPY8 0.0 1011 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8E5F5 0.0 1010 49 12 1059 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype III (strain NEM316)
B2GD06 0.0 1010 48 10 1069 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B1IC65 0.0 1010 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Hungary19A-6)
P58940 0.0 1010 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MW2)
B5E512 0.0 1009 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 19F (strain G54)
P77886 0.0 1009 49 11 1049 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
C1CL09 0.0 1009 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain P1031)
A3CU73 0.0 1008 50 12 1052 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
C1CR31 0.0 1008 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Taiwan19F-14)
Q8CWR0 0.0 1008 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q97QE4 0.0 1008 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04K48 0.0 1008 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
C1C7Q3 0.0 1008 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain 70585)
B2IQ67 0.0 1007 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain CGSP14)
B8ZJT9 0.0 1007 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B9DPN2 0.0 1006 48 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
Q8DUP3 0.0 1006 49 11 1051 3 carB Carbamoyl phosphate synthase large chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q03HB0 0.0 1003 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q834E2 0.0 1001 49 11 1051 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
B9EB69 0.0 1001 48 11 1066 3 carB Carbamoyl phosphate synthase large chain Macrococcus caseolyticus (strain JCSC5402)
A3CNI5 0.0 1000 50 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus sanguinis (strain SK36)
Q8XHB3 0.0 999 48 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
A8AX83 0.0 998 49 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q03WW7 0.0 997 47 11 1075 3 carB Carbamoyl phosphate synthase large chain Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
Q04H29 0.0 995 47 8 1048 3 carB Carbamoyl phosphate synthase large chain Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q0TM79 0.0 994 48 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q0SPY4 0.0 994 48 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
C0M756 0.0 993 48 9 1057 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. equi (strain 4047)
C0MEH1 0.0 991 48 9 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. zooepidemicus (strain H70)
Q49WY4 0.0 991 49 10 1055 3 carB Carbamoyl phosphate synthase large chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
A9KI94 0.0 985 48 8 1058 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B9DRV7 0.0 983 48 9 1038 3 carB Carbamoyl phosphate synthase large chain Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A2SQ53 0.0 983 48 11 1068 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
Q9CFV2 0.0 983 50 8 1021 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. lactis (strain IL1403)
B9KXM5 0.0 980 49 12 1066 3 carB Carbamoyl phosphate synthase large chain Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
B2G564 0.0 980 48 12 1054 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHN6 0.0 980 48 12 1054 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri (strain DSM 20016)
B0K4D7 0.0 979 47 9 1048 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
Q2FLD9 0.0 978 48 10 1063 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
B1MZ74 0.0 977 47 11 1073 3 carB Carbamoyl phosphate synthase large chain Leuconostoc citreum (strain KM20)
A6LPD9 0.0 975 46 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
A5D508 0.0 975 48 11 1058 3 carB Carbamoyl phosphate synthase large chain Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
O32771 0.0 975 50 8 1021 2 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain MG1363)
Q02YG5 0.0 973 50 8 1021 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain SK11)
Q8RBK0 0.0 971 48 9 1048 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A7GE89 0.0 971 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B2A170 0.0 969 45 12 1112 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
C1FNY3 0.0 969 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
C4ZEK2 0.0 969 46 10 1060 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
Q6A914 0.0 966 47 10 1058 3 carB Carbamoyl phosphate synthase large chain Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q97FT3 0.0 960 47 10 1036 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97FT3 1.63e-65 244 34 7 406 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B2UX86 0.0 959 45 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
B2THH3 0.0 957 46 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
B0KBW4 0.0 956 47 9 1048 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B1KT07 0.0 956 46 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
B8D1H3 0.0 940 46 12 1056 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9K8V7 0.0 870 45 10 981 3 carB Carbamoyl phosphate synthase arginine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9ZB63 0.0 847 46 9 950 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
Q9HP43 0.0 843 47 14 995 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q9HP43 8.79e-56 214 33 7 417 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P18185 0.0 842 46 10 937 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
P18185 3.11e-65 243 36 6 402 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
P07756 0.0 840 41 13 1057 1 Cps1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Rattus norvegicus
Q8C196 0.0 838 41 13 1057 1 Cps1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Mus musculus
Q9RLS9 0.0 835 46 12 946 3 carB1 Carbamoyl phosphate synthase arginine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P31327 0.0 833 41 13 1057 1 CPS1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Homo sapiens
O93937 0.0 833 44 8 986 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O93937 6.96e-54 210 32 9 473 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
P07259 0.0 815 41 15 1088 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P07259 4.5e-54 211 32 9 477 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HK17 0.0 811 44 18 1038 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q09794 0.0 810 43 8 982 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q09794 4.54e-53 207 35 6 402 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7S8A6 0.0 801 43 10 996 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7S8A6 3.63e-58 223 36 9 426 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q91293 0.0 795 40 11 1046 2 None Carbamoyl-phosphate synthase [ammonia], mitochondrial Aquarana catesbeiana
P27708 0.0 791 43 7 982 1 CAD Multifunctional protein CAD Homo sapiens
Q91437 0.0 790 40 11 1026 2 CAD Multifunctional protein CAD Squalus acanthias
Q91437 7.56e-50 197 31 12 458 2 CAD Multifunctional protein CAD Squalus acanthias
A2BJL3 0.0 784 44 12 947 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
Q8U085 0.0 782 42 14 1002 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P08955 0.0 781 41 10 1019 1 CAD Multifunctional protein CAD Mesocricetus auratus
B2RQC6 0.0 781 41 9 1019 1 Cad Multifunctional protein CAD Mus musculus
Q97AJ3 0.0 780 41 21 1079 3 carB Carbamoyl phosphate synthase large chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
P20054 0.0 773 39 15 1070 1 pyr1-3 Multifunctional protein pyr1-3 Dictyostelium discoideum
O94313 0.0 770 42 11 971 3 arg4 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94313 2.06e-54 210 32 9 434 3 arg4 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q18990 0.0 767 40 9 1049 1 pyr-1 Multifunctional protein pyr-1 Caenorhabditis elegans
P46056 0.0 759 40 17 1053 3 argA Carbamoyl phosphate synthase arginine-specific large chain Cutaneotrichosporon cutaneum
P46056 1.33e-55 214 31 10 448 3 argA Carbamoyl phosphate synthase arginine-specific large chain Cutaneotrichosporon cutaneum
Q7SH52 0.0 753 40 12 981 1 arg-3 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P05990 0.0 750 40 11 1020 1 r Multifunctional protein r Drosophila melanogaster
Q970U7 0.0 741 39 17 1049 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q75D66 0.0 740 41 13 987 3 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q4J8E8 0.0 739 41 11 961 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
C3NH23 0.0 738 41 16 979 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3NEM0 0.0 738 41 16 979 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MQE3 0.0 738 41 16 979 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MW21 0.0 736 41 16 979 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3N664 0.0 736 41 16 979 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
C4KHM7 0.0 736 41 16 979 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
P03965 0.0 728 41 12 941 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P03965 1.92e-51 201 32 11 424 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P03965 3e-49 194 30 5 392 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59969 0.0 722 41 13 943 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O67869 0.0 694 62 4 550 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
O67869 1.29e-70 249 36 7 418 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
Q8ZY48 0.0 674 40 14 974 3 carB Carbamoyl phosphate synthase large chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q58776 0.0 582 50 7 611 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58776 9.7e-68 243 35 6 399 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O67233 0.0 563 54 2 506 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
O67233 2.07e-68 242 37 6 400 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
Q8TWX0 0.0 557 53 6 557 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TWX0 1.29e-65 235 39 5 389 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q58773 9.51e-170 510 55 5 468 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58773 2.6e-65 232 37 7 390 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8TUT7 3.19e-169 511 53 4 492 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TUT7 9.55e-79 271 38 4 389 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
P13258 1.32e-123 387 51 0 362 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
P13258 2.3e-34 140 34 5 261 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
Q0CLK1 2.72e-13 78 27 8 284 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CLK1 6.69e-06 54 26 9 236 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O93918 2.98e-13 78 27 8 284 2 pyc Pyruvate carboxylase Aspergillus terreus
O93918 6.36e-06 54 26 9 236 2 pyc Pyruvate carboxylase Aspergillus terreus
Q9KWU4 4.72e-12 74 23 10 321 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q9KWU4 6.9e-07 57 23 9 266 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q58626 9.66e-12 72 23 6 250 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58626 2.72e-11 71 25 11 325 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A6L404 1.72e-11 70 24 10 302 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
A8ACE0 2.05e-11 70 24 14 361 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
Q9UUE1 4.02e-11 71 26 8 281 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UUE1 1.98e-07 59 25 6 236 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5GX22 1.13e-10 68 26 12 272 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
A5GX22 4.21e-05 50 25 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
Q5LD90 1.61e-10 68 23 10 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P32327 1.73e-10 69 24 8 283 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32327 4.49e-05 51 23 6 234 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P37798 1.79e-10 68 24 4 244 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37798 9.83e-06 53 23 9 328 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HES8 1.82e-10 69 25 10 330 3 pyc Pyruvate carboxylase Aspergillus niger
A0A0H3JRU9 3.07e-10 68 24 6 271 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0H3JRU9 1.56e-05 53 25 5 230 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q64UB2 6.31e-10 66 23 10 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain YCH46)
O30019 8.33e-10 66 24 11 324 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O30019 0.000529 47 22 5 240 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6Q186 1.42e-09 65 25 5 228 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
A6Q186 1.04e-06 55 26 5 162 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
D3DJ42 1.72e-09 65 27 6 240 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
D3DJ42 2.65e-09 64 25 6 243 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
Q8A9W1 2.94e-09 63 23 10 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q9KDS9 3.52e-09 64 23 8 268 3 accC Biotin carboxylase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O17732 4.11e-09 64 25 9 304 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
P0DTA4 4.89e-09 64 24 6 267 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
P0DTA4 8.33e-07 57 23 10 331 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
O27939 4.97e-09 63 23 4 243 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27939 1.46e-05 52 25 8 240 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q5LUF3 6.12e-09 63 22 7 280 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUF3 0.000575 47 23 13 338 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P32528 6.15e-09 64 22 9 309 1 DUR1,2 Urea amidolyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7VBB3 7.01e-09 62 26 6 202 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7VBB3 4.29e-05 50 24 9 237 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P05165 1.64e-08 62 25 12 335 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
P05165 4.54e-08 61 25 8 270 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
P11154 2.48e-08 62 23 10 325 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P11154 0.000681 47 23 6 234 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7V3S4 3.01e-08 60 29 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
Q7V3S4 0.000166 48 23 10 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
P49787 4.68e-08 60 24 8 316 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
P49787 0.000137 49 24 6 244 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
Q3M8Q4 5.84e-08 60 28 6 160 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
P52873 1.07e-07 60 22 9 325 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
P52873 2.96e-05 52 22 12 354 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
Q8EYF0 1.07e-07 59 24 11 304 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72LY0 1.07e-07 59 24 11 304 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q05920 1.11e-07 60 22 9 325 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q05920 3.04e-05 52 22 12 354 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q8X1T3 1.14e-07 60 25 6 254 3 PYC Pyruvate carboxylase Pichia angusta
A2CE36 1.7e-07 58 29 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
A2CE36 0.000263 48 23 10 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
B9HBA8 1.76e-07 58 22 7 236 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
B9HBA8 2.42e-06 55 22 6 240 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
Q3AUF2 1.85e-07 58 22 14 309 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
Q3AUF2 0.0004 47 27 9 226 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
B9N843 1.92e-07 58 23 10 273 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
B9N843 9.31e-05 50 22 6 240 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
Q7M8I0 2.54e-07 57 22 10 294 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M8I0 7.01e-07 56 25 9 208 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q96Y60 2.75e-07 57 29 3 117 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q31AM1 3.23e-07 57 24 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9312)
A5H0J2 4.47e-07 58 23 5 231 3 DUR1,2 Urea amidolyase Lachancea kluyveri
Q8YXB6 5.23e-07 57 29 3 115 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q30UL7 6.48e-07 56 24 11 297 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q06862 7.94e-07 56 22 7 234 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P78820 8.44e-07 57 20 4 229 1 cut6 Acetyl-CoA carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O04983 9.52e-07 56 23 10 273 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
O04983 0.000341 48 24 6 205 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
Q19842 9.84e-07 56 22 6 246 1 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis elegans
Q7V179 9.88e-07 56 24 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
I3R7G3 1.01e-06 56 24 7 248 1 pccA Propionyl-CoA carboxylase, biotin carboxylase and biotin-carboxyl carrier subunit Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q91ZA3 1.1e-06 56 23 11 331 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q91ZA3 1.14e-06 56 23 7 275 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q3AG69 1.16e-06 55 28 10 233 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
Q3AG69 6.8e-06 53 22 14 303 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
Q8KDJ0 1.25e-06 55 26 6 186 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A2BWY5 1.33e-06 55 24 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9515)
P39771 1.36e-06 55 27 5 183 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus subtilis (strain 168)
Q54J08 1.49e-06 56 22 3 184 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
Q612F5 1.8e-06 55 23 6 246 3 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis briggsae
P78992 1.81e-06 56 26 5 249 3 PYC1 Pyruvate carboxylase Komagataella pastoris
P43873 1.89e-06 55 25 5 240 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q0I600 2.16e-06 55 26 6 199 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9311)
Q3A2G9 2.21e-06 54 25 8 231 3 ddl D-alanine--D-alanine ligase Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
O25817 2.52e-06 55 22 4 177 3 purD Phosphoribosylamine--glycine ligase Helicobacter pylori (strain ATCC 700392 / 26695)
Q29RK2 2.58e-06 55 21 9 325 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
Q29RK2 8.84e-05 50 22 12 354 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
O52058 2.68e-06 55 22 6 249 3 accC Biotin carboxylase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
A3N7B6 3.41e-06 54 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 668)
P11498 3.98e-06 55 21 9 325 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
P11498 0.000121 50 22 12 354 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
Q63VY4 4.03e-06 54 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUJ4 4.03e-06 54 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT04 4.03e-06 54 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1106a)
Q8S6N5 4.05e-06 55 22 12 314 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
Q8S6N5 3.64e-05 52 25 3 164 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
Q4JC46 6.39e-06 53 31 5 122 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q4JC46 1.12e-05 52 24 10 236 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P24182 6.66e-06 53 25 4 187 1 accC Biotin carboxylase Escherichia coli (strain K12)
Q981B9 6.9e-06 53 21 14 346 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q8X9B6 7.2e-06 53 25 4 187 3 accC Biotin carboxylase Escherichia coli O157:H7
C6BV99 7.7e-06 53 32 3 105 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
A1V2C2 9.29e-06 53 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain SAVP1)
Q62IF4 9.29e-06 53 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4F3 9.29e-06 53 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI07 9.29e-06 53 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10247)
Q0W4L8 1.18e-05 52 25 3 137 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
Q39E61 1.35e-05 52 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q46KI4 1.38e-05 52 25 4 150 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
P38095 1.39e-05 53 20 7 306 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q9ZK07 1.39e-05 52 21 4 177 3 purD Phosphoribosylamine--glycine ligase Helicobacter pylori (strain J99 / ATCC 700824)
B9FK36 1.44e-05 53 22 4 197 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
Q81IU1 1.48e-05 52 23 11 259 3 ddlB D-alanine--D-alanine ligase B Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q2N8K3 1.58e-05 52 25 7 180 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Erythrobacter litoralis (strain HTCC2594)
A6Q6K6 1.86e-05 52 22 5 226 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
A6Q6K6 4.11e-05 50 23 4 160 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
Q6M0Z5 1.95e-05 52 33 4 107 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6M0Z5 2.81e-05 51 22 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A7GKE0 2.16e-05 51 25 7 222 3 ddl D-alanine--D-alanine ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A7GKE0 0.000288 48 24 9 205 3 ddl D-alanine--D-alanine ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A6VIB2 2.18e-05 52 32 4 107 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A6VIB2 9.11e-05 49 23 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q8D2R3 2.47e-05 51 25 3 116 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wigglesworthia glossinidia brevipalpis
Q9JSZ9 2.47e-05 51 24 8 260 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A4JGK4 2.53e-05 51 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A4G068 2.53e-05 51 32 4 107 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A4G068 3.81e-05 51 22 5 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q58881 2.7e-05 51 21 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58881 0.000124 49 26 4 122 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A5UK38 2.93e-05 51 20 12 325 1 Msm_0361 Carbamoyl-phosphate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
Q9K0Y0 3.2e-05 50 24 8 258 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
A5GPT7 4.51e-05 50 27 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain WH7803)
A2C2S8 4.77e-05 50 24 4 150 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
Q65N65 4.99e-05 50 23 12 259 3 ddl D-alanine--D-alanine ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
O34544 5.35e-05 50 21 6 246 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
A6US04 5.77e-05 50 22 16 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A6ZMR9 6.46e-05 51 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
A6ZMR9 0.000431 48 19 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
P32874 6.8e-05 51 23 4 182 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32874 0.000477 48 19 3 200 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q2IJJ5 7.18e-05 50 27 1 113 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
A1KVL1 7.27e-05 49 24 8 258 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q142Q7 7.61e-05 50 22 11 300 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paraburkholderia xenovorans (strain LB400)
B9KFX8 8.69e-05 49 23 5 203 3 ddl D-alanine--D-alanine ligase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
F4I1L3 8.78e-05 50 21 4 197 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
C4XMB3 8.9e-05 50 32 3 111 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
A0A4P8DJE6 8.99e-05 50 23 3 184 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
A0A4P8DJE6 0.000239 49 20 4 225 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
P14882 9.97e-05 50 23 10 331 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
P14882 0.000236 48 22 7 275 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
Q38970 0.00011 50 21 5 189 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
Q38970 0.000233 49 23 4 190 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
A1ANT6 0.00011 49 21 14 322 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q1I5C0 0.000118 49 28 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas entomophila (strain L48)
A9A6Q7 0.000118 49 22 18 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6GWP9 0.000119 49 23 7 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q5HUZ4 0.000126 49 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni (strain RM1221)
A1VZE6 0.000126 49 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
C8ZF72 0.000138 50 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C8ZF72 0.000283 48 19 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
B3LM95 0.000142 50 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
B3LM95 0.000283 48 19 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
Q0SEI4 0.000144 49 30 3 110 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q0SEI4 0.000438 47 24 7 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
A6URA6 0.000144 49 31 6 121 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
C7GRE4 0.000145 50 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
C7GRE4 0.00031 48 19 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
Q31DQ3 0.000159 48 28 4 121 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A6UUH1 0.000176 48 30 5 110 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A7Z0Z2 0.000187 48 32 3 108 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8FLL1 0.000191 48 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q55336 0.000194 48 23 6 191 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A1SWW0 0.000246 48 25 7 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
A7H451 0.000247 48 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A6VJ27 0.000251 48 22 18 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
B8GRA4 0.000252 48 24 10 306 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q897P8 0.000269 48 25 8 236 3 ddlA D-alanine--D-alanine ligase A Clostridium tetani (strain Massachusetts / E88)
Q2SZW6 0.000273 48 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q9PPC2 0.000284 48 20 2 169 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q1BUU4 0.000285 48 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia orbicola (strain AU 1054)
A0K993 0.000285 48 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia cenocepacia (strain HI2424)
Q0BD59 0.00031 48 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q88N74 0.000311 47 27 1 103 3 ddlB D-alanine--D-alanine ligase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
B0KFS4 0.00032 47 27 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas putida (strain GB-1)
Q5SH23 0.00032 47 33 1 83 1 lysX Alpha-aminoadipate--LysW ligase LysX Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
C1DDZ2 0.000351 48 29 3 116 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q3K746 0.000367 47 28 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas fluorescens (strain Pf0-1)
A4VIT1 0.000404 47 31 3 105 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stutzerimonas stutzeri (strain A1501)
Q7U3B3 0.000414 47 26 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parasynechococcus marenigrum (strain WH8102)
Q42523 0.000477 48 23 8 212 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Arabidopsis thaliana
P9WPQ3 0.000486 48 25 5 191 1 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ2 0.000486 48 25 5 191 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A509 0.000486 48 25 5 191 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A6LHW2 0.000529 47 27 7 166 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A7MVH5 0.000564 47 25 6 189 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q2SJZ8 0.000638 47 22 9 299 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Hahella chejuensis (strain KCTC 2396)
B5XQ21 0.00069 47 30 7 133 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Klebsiella pneumoniae (strain 342)
A4XQS6 0.000777 46 30 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas mendocina (strain ymp)
Q8KWS8 0.000788 47 22 6 229 1 bacD Alanine--anticapsin ligase Bacillus amyloliquefaciens
Q4JXR6 0.00089 46 25 2 166 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium jeikeium (strain K411)
Q8FMB3 0.001 46 23 6 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15505
Feature type CDS
Gene carB
Product carbamoyl-phosphate synthase large subunit
Location 90926 - 94153 (strand: 1)
Length 3228 (nucleotides) / 1075 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000005
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1186
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02142 MGS-like domain
PF02786 Carbamoyl-phosphate synthase L chain, ATP binding domain
PF02787 Carbamoyl-phosphate synthetase large chain, oligomerisation domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0458 Amino acid transport and metabolism (E)
Nucleotide transport and metabolism (F)
EF Carbamoylphosphate synthase large subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MAKRTDIKSILILGAGPIVIGQACEFDYSGAQACKALREEGYRVVLVNSNPATIMTDPEMADATYIEPIHWEVVRKIIEKERPDAVLPTMGGQTALNCALELERHGVLAEFGVEMIGATADAIDKAEDRRRFDIAMKKIGLDTARSGIAHTMEEAFAVTDEVGFPCIIRPSFTMGGTGGGIAYNREEFEEICTRGLDLSPTNELLIDESLIGWKEYEMEVVRDKNDNCIIVCAIENFDAMGIHTGDSITVAPAQTLTDKEYQIMRDASMAVLREIGVETGGSNVQFSVNPKNGRLIVIEMNPRVSRSSALASKATGFPIAKIAAKLAVGYTLDELSNDITGGLTPASFEPSIDYVVTKIPRFNFEKFAGTNDRLTTQMKSVGEVMAIGRTFQESLQKALRGLEVGAAGFDPKVNPDEPDALTKIRRELKEAGAERIWYIADAFRAGLSVDGVFNLTNIDRWFLVQIEELVRLEEQVAEVGVNGLTPEFLRHLKRKGFADARLATLVGVAETEIRKLRDSYQLWPVYKRVDTCAAEFATDTAYLYSTYEEECEAQPNDDKPKIMILGGGPNRIGQGIEFDYCCVHAAMALREDGYETIMVNCNPETVSTDYDTSDRLYFEPVTLEDVLEIVRVEKPAGVIVQYGGQTPLKLARSLEAAGVPVIGTSPDAIDRAEDRERFQQAVVRLGLKQPANATVSNIEQAVERAKEIGYPLVVRPSYVLGGRAMEIVYDETDLRRYFQNAVSVSNDAPVLLDRFLDDAIEVDVDAICDGEQVLIGGIMEHIEQAGVHSGDSACSLPAYTLSQEIQDVMRDQVRKLAMELRVRGLMNTQFAVKDNEVYLIEVNPRAARTVPFVSKATGVPLAKVAARVMAGQTLAQQGVTKEVIPPYYSVKEVVLPFNKFQGVDPILGPEMRSTGEVMGVGRTFAEAFAKAMLGSSSSLKKKGRALLSVREGDKARVVDLAAKLLKQGFELDATHGTAIVLGEAGINPRLVNKVHEGRPHIQDRIKNGEYDYIVNTTEGRQAIEDSKVIRRSALRYKVHYDTTMNGGFATTLSLNMDPTDRVISVQEMHRQIKNK

Flanking regions ( +/- flanking 50bp)

ACTTTATTGAGTTGATGAAAAACGCCCGTCACTAATCAGGAGCAGGAAAAATGGCAAAACGTACTGATATTAAAAGCATCCTGATTTTAGGCGCTGGTCCGATTGTTATCGGTCAGGCGTGTGAATTTGACTACTCCGGCGCGCAGGCATGTAAAGCGCTGCGCGAAGAAGGCTACCGTGTTGTGCTGGTGAACTCCAATCCGGCGACCATTATGACTGACCCTGAAATGGCGGACGCGACATATATCGAACCTATCCATTGGGAAGTCGTGCGCAAAATTATCGAGAAAGAGCGCCCTGATGCGGTGCTGCCGACCATGGGCGGACAGACGGCACTGAACTGTGCGCTGGAACTGGAACGTCATGGTGTGCTGGCGGAGTTTGGCGTCGAAATGATTGGCGCTACTGCCGATGCGATTGATAAAGCAGAAGATCGCCGCCGTTTTGACATCGCAATGAAAAAAATCGGGCTGGACACTGCGCGCTCCGGTATCGCACACACGATGGAAGAAGCCTTCGCGGTGACTGATGAAGTTGGTTTTCCGTGCATTATCCGCCCGTCATTTACGATGGGCGGCACCGGCGGCGGTATTGCTTACAACCGTGAAGAATTTGAAGAAATCTGTACGCGCGGACTGGATCTCTCTCCTACCAATGAATTGCTGATTGATGAATCACTGATTGGCTGGAAAGAGTATGAAATGGAAGTGGTGCGCGATAAAAACGATAACTGCATTATCGTCTGTGCCATTGAAAATTTTGATGCGATGGGGATTCATACCGGCGACTCCATCACGGTAGCACCGGCGCAGACACTGACAGATAAAGAATATCAAATCATGCGCGATGCCTCGATGGCGGTGCTGCGTGAGATTGGTGTTGAAACCGGCGGCTCAAATGTTCAGTTTTCGGTAAACCCGAAAAACGGACGTTTAATTGTTATCGAGATGAACCCGCGTGTTTCCCGCTCGTCGGCGCTGGCATCAAAAGCGACCGGTTTCCCGATTGCAAAAATCGCGGCAAAACTGGCGGTTGGTTATACTCTCGATGAATTGTCGAATGACATTACCGGCGGGCTGACACCGGCGTCGTTTGAGCCTTCCATCGACTATGTTGTGACAAAAATCCCGCGCTTTAATTTTGAAAAATTTGCCGGTACCAATGACCGTCTTACCACCCAGATGAAATCTGTCGGTGAAGTGATGGCAATCGGGCGCACGTTTCAGGAATCGCTGCAAAAAGCCCTGCGTGGTCTGGAAGTCGGTGCTGCCGGGTTTGATCCGAAAGTGAATCCGGATGAGCCGGATGCACTGACAAAAATTCGCCGCGAACTGAAAGAAGCGGGCGCTGAGCGTATCTGGTATATCGCGGATGCCTTCCGTGCCGGGCTGTCTGTCGATGGTGTCTTTAATCTGACCAATATTGACCGCTGGTTCCTGGTACAAATCGAAGAACTGGTGCGCCTGGAAGAGCAGGTGGCAGAAGTGGGTGTTAACGGGCTGACGCCGGAATTTCTGCGTCACCTGAAACGCAAAGGCTTTGCGGATGCCCGCCTGGCAACGCTGGTCGGTGTCGCGGAAACTGAAATCCGCAAACTGCGTGACAGCTATCAGCTCTGGCCGGTGTACAAGCGTGTAGACACCTGCGCGGCAGAATTTGCAACAGATACGGCCTATCTTTACTCGACTTATGAAGAAGAGTGCGAAGCACAGCCGAATGATGATAAACCGAAAATCATGATCCTCGGCGGCGGACCTAACCGGATCGGTCAGGGAATTGAATTTGACTACTGCTGTGTCCACGCCGCCATGGCGCTGCGCGAAGACGGCTATGAAACTATCATGGTGAACTGCAACCCGGAAACCGTTTCCACGGACTATGACACCTCGGACCGTCTCTATTTTGAGCCGGTAACCCTGGAAGATGTGCTGGAAATTGTACGGGTTGAAAAACCGGCCGGTGTGATTGTTCAGTACGGCGGACAAACTCCGCTGAAACTGGCGCGCAGCCTTGAAGCGGCAGGTGTGCCGGTTATCGGTACCAGTCCGGATGCGATTGACCGCGCTGAAGACCGTGAGCGTTTTCAGCAGGCGGTGGTTCGCTTAGGGCTGAAGCAGCCGGCGAATGCGACCGTTTCCAATATTGAGCAGGCAGTTGAACGTGCAAAAGAGATTGGTTATCCGCTGGTGGTGCGTCCTTCTTATGTGCTGGGCGGGCGGGCGATGGAAATCGTCTATGATGAAACCGACCTGCGTCGTTACTTTCAGAACGCAGTGAGTGTGTCAAATGATGCACCGGTGCTGCTCGACCGCTTCCTGGATGATGCGATTGAAGTCGATGTGGATGCTATCTGTGACGGTGAACAGGTGTTGATTGGCGGTATTATGGAGCATATCGAGCAGGCGGGTGTTCACTCAGGTGACTCTGCATGCTCTTTACCGGCTTACACACTGAGTCAGGAGATTCAGGATGTAATGCGCGACCAGGTCAGAAAGTTGGCGATGGAACTGCGTGTGCGCGGGCTGATGAATACTCAGTTTGCGGTAAAAGATAACGAAGTTTATCTGATAGAAGTAAACCCGCGTGCGGCGCGTACTGTCCCGTTTGTCTCAAAAGCCACCGGTGTGCCGCTGGCAAAAGTAGCAGCACGCGTAATGGCAGGACAAACACTGGCACAGCAGGGCGTAACAAAAGAAGTTATCCCGCCATACTATTCGGTTAAAGAAGTGGTTCTGCCGTTTAATAAATTCCAGGGTGTTGACCCGATTTTAGGACCGGAAATGCGCTCAACGGGTGAAGTGATGGGCGTGGGGCGCACCTTTGCGGAAGCCTTTGCCAAAGCAATGCTCGGCAGTTCCTCATCCCTGAAAAAGAAAGGTCGTGCGCTGCTCTCTGTCCGCGAAGGGGATAAAGCTCGGGTGGTAGATCTTGCGGCGAAGTTGCTGAAACAGGGCTTTGAACTGGATGCGACTCACGGCACGGCAATTGTGCTGGGCGAAGCGGGCATTAATCCGCGCCTGGTTAACAAAGTGCATGAAGGGCGCCCGCATATTCAGGACAGAATTAAAAACGGCGAATACGATTACATCGTGAATACAACGGAAGGTCGTCAGGCAATTGAAGACTCTAAAGTTATCCGCCGCAGTGCCCTGAGATACAAAGTGCATTATGACACCACGATGAACGGTGGTTTTGCCACAACCTTGTCACTGAATATGGATCCGACAGACAGGGTTATTTCAGTACAGGAAATGCACCGCCAGATTAAAAATAAATAAAGTGATTAAGTGAAATAAGAAACCCGCCACCGGCGGGTTTCTTATTTTAT