Homologs in group_1186

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06420 FBDBKF_06420 100.0 Morganella morganii S1 carB carbamoyl-phosphate synthase large subunit
EHELCC_09465 EHELCC_09465 100.0 Morganella morganii S2 carB carbamoyl-phosphate synthase large subunit
LHKJJB_07910 LHKJJB_07910 100.0 Morganella morganii S3 carB carbamoyl-phosphate synthase large subunit
HKOGLL_07460 HKOGLL_07460 100.0 Morganella morganii S5 carB carbamoyl-phosphate synthase large subunit
F4V73_RS15505 F4V73_RS15505 97.4 Morganella psychrotolerans carB carbamoyl-phosphate synthase large subunit
PMI_RS00105 PMI_RS00105 90.3 Proteus mirabilis HI4320 carB carbamoyl-phosphate synthase large subunit

Distribution of the homologs in the orthogroup group_1186

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1186

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P14846 0.0 2041 91 0 1073 3 carB Carbamoyl phosphate synthase large chain Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P63738 0.0 2038 91 0 1073 3 carB Carbamoyl phosphate synthase large chain Shigella flexneri
Q8Z9L7 0.0 2038 91 0 1073 3 carB Carbamoyl phosphate synthase large chain Salmonella typhi
P63737 0.0 2038 91 0 1073 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O157:H7
Q8ZIL4 0.0 2038 91 0 1074 3 carB Carbamoyl phosphate synthase large chain Yersinia pestis
P00968 0.0 2036 91 0 1073 1 carB Carbamoyl phosphate synthase large chain Escherichia coli (strain K12)
Q8FLB0 0.0 2035 91 0 1073 3 carB Carbamoyl phosphate synthase large chain Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q9KPH9 0.0 1895 85 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87SF3 0.0 1891 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNU0 0.0 1884 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain YJ016)
Q8DEM2 0.0 1884 84 1 1073 3 carB Carbamoyl phosphate synthase large chain Vibrio vulnificus (strain CMCP6)
Q8K9Z7 0.0 1675 72 1 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P57244 0.0 1671 71 0 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P38100 0.0 1662 75 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q87WP4 0.0 1643 74 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88DU6 0.0 1636 73 1 1073 3 carB Carbamoyl phosphate synthase large chain Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8RSS3 0.0 1591 72 2 1073 3 carB Carbamoyl phosphate synthase large chain Halomonas eurihalina
P59448 0.0 1574 66 0 1073 3 carB Carbamoyl phosphate synthase large chain Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P58943 0.0 1523 69 4 1076 3 carB Carbamoyl phosphate synthase large chain Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P58942 0.0 1520 69 4 1076 3 carB Carbamoyl phosphate synthase large chain Xanthomonas axonopodis pv. citri (strain 306)
Q9CKV0 0.0 1514 68 4 1070 3 carB Carbamoyl phosphate synthase large chain Pasteurella multocida (strain Pm70)
Q9JXW8 0.0 1499 68 3 1076 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JW02 0.0 1497 68 3 1076 3 carB Carbamoyl phosphate synthase large chain Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q87EB8 0.0 1487 68 4 1076 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q8XZ83 0.0 1470 68 6 1085 3 carB Carbamoyl phosphate synthase large chain Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q9PEC1 0.0 1461 68 4 1076 3 carB Carbamoyl phosphate synthase large chain Xylella fastidiosa (strain 9a5c)
Q7VP67 0.0 1441 66 4 1070 3 carB Carbamoyl phosphate synthase large chain Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q59599 0.0 1431 65 3 1076 3 carB Carbamoyl phosphate synthase large chain Neisseria gonorrhoeae
Q8FZJ3 0.0 1314 60 8 1134 3 carB Carbamoyl phosphate synthase large chain Brucella suis biovar 1 (strain 1330)
Q8YIC2 0.0 1309 60 9 1134 3 carB Carbamoyl phosphate synthase large chain Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9A4D6 0.0 1304 62 10 1072 3 carB Carbamoyl phosphate synthase large chain Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q92PZ4 0.0 1284 59 11 1137 3 carB Carbamoyl phosphate synthase large chain Rhizobium meliloti (strain 1021)
Q98I87 0.0 1280 59 13 1149 3 carB Carbamoyl phosphate synthase large chain Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q1D6Y8 0.0 1275 59 5 1050 3 carB Carbamoyl phosphate synthase large chain Myxococcus xanthus (strain DK1622)
Q8UDE9 0.0 1271 58 11 1139 3 carB Carbamoyl phosphate synthase large chain Agrobacterium fabrum (strain C58 / ATCC 33970)
O28994 0.0 1269 57 7 1078 3 carB Carbamoyl phosphate synthase large chain Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q55756 0.0 1265 59 9 1066 3 carB Carbamoyl phosphate synthase large chain Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O50236 0.0 1262 60 10 1086 3 carB Carbamoyl phosphate synthase large chain Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8YQL2 0.0 1251 57 10 1105 3 carB Carbamoyl phosphate synthase large chain Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q7UJ58 0.0 1243 58 5 1053 3 carB Carbamoyl phosphate synthase large chain Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
C1A4I5 0.0 1238 58 6 1080 3 carB Carbamoyl phosphate synthase large chain Gemmatimonas aurantiaca (strain DSM 14586 / JCM 11422 / NBRC 100505 / T-27)
Q42601 0.0 1221 58 10 1068 1 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Arabidopsis thaliana
Q8F832 0.0 1201 54 7 1106 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NF1 0.0 1201 54 7 1106 3 carB Carbamoyl phosphate synthase large chain Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
C1F1S6 0.0 1200 57 9 1072 3 carB Carbamoyl phosphate synthase large chain Acidobacterium capsulatum (strain ATCC 51196 / DSM 11244 / BCRC 80197 / JCM 7670 / NBRC 15755 / NCIMB 13165 / 161)
Q1IPK2 0.0 1197 55 10 1096 3 carB Carbamoyl phosphate synthase large chain Koribacter versatilis (strain Ellin345)
B9EXM2 0.0 1195 57 10 1063 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
B9EXM2 2.73e-65 244 35 6 390 2 CARB Carbamoyl phosphate synthase arginine-specific large chain, chloroplastic Oryza sativa subsp. japonica
Q9PIL7 0.0 1195 53 8 1098 3 carB Carbamoyl phosphate synthase large chain Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B9KB91 0.0 1158 55 12 1085 3 carB Carbamoyl phosphate synthase large chain Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B1L8T8 0.0 1153 55 12 1083 3 carB Carbamoyl phosphate synthase large chain Thermotoga sp. (strain RQ2)
A5IJL8 0.0 1149 55 12 1083 3 carB Carbamoyl phosphate synthase large chain Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZ27 0.0 1148 55 12 1083 3 carB Carbamoyl phosphate synthase large chain Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q1IWM0 0.0 1140 60 5 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
Q9KXR6 0.0 1139 55 13 1076 3 carB Carbamoyl phosphate synthase large chain Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
B8H8U5 0.0 1139 54 9 1073 3 carB Carbamoyl phosphate synthase large chain Pseudarthrobacter chlorophenolicus (strain ATCC 700700 / DSM 12829 / CIP 107037 / JCM 12360 / KCTC 9906 / NCIMB 13794 / A6)
A1R6Z3 0.0 1139 54 9 1073 3 carB Carbamoyl phosphate synthase large chain Paenarthrobacter aurescens (strain TC1)
O25577 0.0 1138 53 12 1078 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain ATCC 700392 / 26695)
C1CXR4 0.0 1135 60 6 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus deserti (strain DSM 17065 / CIP 109153 / LMG 22923 / VCD115)
Q9ZKT2 0.0 1135 53 14 1082 3 carB Carbamoyl phosphate synthase large chain Helicobacter pylori (strain J99 / ATCC 700824)
Q827Q7 0.0 1132 55 12 1076 3 carB Carbamoyl phosphate synthase large chain Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
A9WSA8 0.0 1131 54 12 1078 3 carB Carbamoyl phosphate synthase large chain Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q9RWK0 0.0 1130 60 6 949 3 carB Carbamoyl phosphate synthase large chain Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A0JX72 0.0 1129 54 11 1073 3 carB Carbamoyl phosphate synthase large chain Arthrobacter sp. (strain FB24)
B2GI87 0.0 1127 53 12 1104 3 carB Carbamoyl phosphate synthase large chain Kocuria rhizophila (strain ATCC 9341 / DSM 348 / NBRC 103217 / DC2201)
A6WCC6 0.0 1125 56 11 1058 3 carB Carbamoyl phosphate synthase large chain Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216)
B1W463 0.0 1117 54 14 1076 3 carB Carbamoyl phosphate synthase large chain Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
O27077 0.0 1112 53 10 1053 3 carB Carbamoyl phosphate synthase large chain Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A5CRX5 0.0 1112 55 12 1057 3 carB Carbamoyl phosphate synthase large chain Clavibacter michiganensis subsp. michiganensis (strain NCPPB 382)
Q8FT42 0.0 1111 53 15 1090 3 carB Carbamoyl phosphate synthase large chain Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
B0REV9 0.0 1110 54 12 1061 3 carB Carbamoyl phosphate synthase large chain Clavibacter sepedonicus
C5C687 0.0 1109 54 11 1061 3 carB Carbamoyl phosphate synthase large chain Beutenbergia cavernae (strain ATCC BAA-8 / DSM 12333 / CCUG 43141 / JCM 11478 / NBRC 16432 / NCIMB 13614 / HKI 0122)
Q1AVY9 0.0 1107 55 6 1038 3 carB Carbamoyl phosphate synthase large chain Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q469Z7 0.0 1100 51 7 1052 3 carB Carbamoyl phosphate synthase large chain Methanosarcina barkeri (strain Fusaro / DSM 804)
C5CCF1 0.0 1095 53 12 1069 3 carB Carbamoyl phosphate synthase large chain Micrococcus luteus (strain ATCC 4698 / DSM 20030 / JCM 1464 / CCM 169 / CCUG 5858 / IAM 1056 / NBRC 3333 / NCIMB 9278 / NCTC 2665 / VKM Ac-2230)
A0B8K9 0.0 1094 51 9 1053 3 carB Carbamoyl phosphate synthase large chain Methanothrix thermoacetophila (strain DSM 6194 / JCM 14653 / NBRC 101360 / PT)
P58939 0.0 1086 51 16 1120 3 carB Carbamoyl phosphate synthase large chain Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
A8F453 0.0 1084 53 9 1040 3 carB Carbamoyl phosphate synthase large chain Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
B8DTW3 0.0 1084 52 14 1122 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium animalis subsp. lactis (strain AD011)
B7GPW2 0.0 1083 51 14 1122 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum subsp. infantis (strain ATCC 15697 / DSM 20088 / JCM 1222 / NCTC 11817 / S12)
P58944 0.0 1082 50 9 1055 3 carB Carbamoyl phosphate synthase large chain Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q7U054 0.0 1080 51 16 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A5UKG5 0.0 1080 52 8 1046 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 7.16e-64 239 35 8 436 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
A5UKG5 2.25e-61 231 35 5 385 3 carB Carbamoyl phosphate synthase large chain Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
P9WPK3 0.0 1080 51 16 1120 1 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPK2 0.0 1080 51 16 1120 3 carB Carbamoyl phosphate synthase large chain Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q8G815 0.0 1079 51 15 1123 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain NCC 2705)
B3DQ32 0.0 1079 51 15 1123 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium longum (strain DJO10A)
Q5SKN1 0.0 1078 55 12 1020 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A1A0T4 0.0 1077 51 15 1123 3 carB Carbamoyl phosphate synthase large chain Bifidobacterium adolescentis (strain ATCC 15703 / DSM 20083 / NCTC 11814 / E194a)
Q8TNY4 0.0 1076 50 7 1052 3 carB Carbamoyl phosphate synthase large chain Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P46537 0.0 1072 52 8 1048 3 carB Carbamoyl phosphate synthase large chain Bacillus caldolyticus
P96495 0.0 1071 55 12 1020 3 carB Carbamoyl phosphate synthase large chain Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
A1T8H1 0.0 1068 51 16 1121 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium vanbaalenii (strain DSM 7251 / JCM 13017 / BCRC 16820 / KCTC 9966 / NRRL B-24157 / PYR-1)
Q9CCR2 0.0 1064 50 15 1121 3 carB Carbamoyl phosphate synthase large chain Mycobacterium leprae (strain TN)
B1YIR9 0.0 1063 51 10 1052 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q1B9F9 0.0 1063 51 15 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain MCS)
A1UFK4 0.0 1063 51 15 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain KMS)
A3PZ65 0.0 1063 51 15 1118 3 carB Carbamoyl phosphate synthase large chain Mycobacterium sp. (strain JLS)
O50302 0.0 1062 52 8 1034 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Geobacillus stearothermophilus
A4TBY6 0.0 1059 50 17 1121 3 carB Carbamoyl phosphate synthase large chain Mycolicibacterium gilvum (strain PYR-GCK)
Q9K9V9 0.0 1046 51 9 1049 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q1WVA9 0.0 1042 49 10 1054 3 carB Carbamoyl phosphate synthase large chain Ligilactobacillus salivarius (strain UCC118)
P25994 0.0 1039 50 8 1048 1 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Bacillus subtilis (strain 168)
Q74J34 0.0 1033 49 9 1060 3 carB Carbamoyl phosphate synthase large chain Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q8RG86 0.0 1029 49 9 1052 3 carB Carbamoyl phosphate synthase large chain Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q38X24 0.0 1028 49 11 1080 3 carB Carbamoyl phosphate synthase large chain Latilactobacillus sakei subsp. sakei (strain 23K)
A2RF60 0.0 1028 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M5 (strain Manfredo)
Q9A0C6 0.0 1028 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M1
Q732I3 0.0 1025 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 10987 / NRS 248)
Q5XCR6 0.0 1025 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
C4L5W3 0.0 1025 50 11 1038 3 carB Carbamoyl phosphate synthase large chain Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
P58941 0.0 1023 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M18 (strain MGAS8232)
B1HQC1 0.0 1023 49 8 1048 3 carB Carbamoyl phosphate synthase large chain Lysinibacillus sphaericus (strain C3-41)
P0DA14 0.0 1022 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
B9IVW3 0.0 1022 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain Q1)
B7HLM0 0.0 1022 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH187)
B3WEF5 0.0 1021 50 10 1050 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus casei (strain BL23)
C1EPQ0 0.0 1021 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain 03BB102)
A0RHQ8 0.0 1021 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis (strain Al Hakam)
B1I4M8 0.0 1021 48 11 1066 3 carB Carbamoyl phosphate synthase large chain Desulforudis audaxviator (strain MP104C)
Q636E0 0.0 1021 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ZK / E33L)
P0DA15 0.0 1021 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M3 (strain SSI-1)
B7JJX3 0.0 1021 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain AH820)
Q6HES8 0.0 1020 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus thuringiensis subsp. konkukian (strain 97-27)
A7GRL1 0.0 1020 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A9VTC6 0.0 1019 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus mycoides (strain KBAB4)
Q81WF2 0.0 1019 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis
C3L740 0.0 1019 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P656 0.0 1019 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus anthracis (strain A0248)
Q819S3 0.0 1019 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7H6M2 0.0 1019 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain B4264)
B5XKW2 0.0 1018 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Streptococcus pyogenes serotype M49 (strain NZ131)
B7IUP6 0.0 1018 50 10 1049 3 carB Carbamoyl phosphate synthase large chain Bacillus cereus (strain G9842)
A8YVZ3 0.0 1017 48 10 1061 3 carB Carbamoyl phosphate synthase large chain Lactobacillus helveticus (strain DPC 4571)
Q038Z2 0.0 1017 50 10 1050 3 carB Carbamoyl phosphate synthase large chain Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q2YXG5 0.0 1016 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5FJC0 0.0 1016 48 9 1060 3 carB Carbamoyl phosphate synthase large chain Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
Q67Q54 0.0 1015 49 11 1077 3 carB Carbamoyl phosphate synthase large chain Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
A8Z3P0 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA10 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MSSA476)
A6QGA4 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Newman)
Q5HGM9 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain COL)
Q2FZ72 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHN5 0.0 1015 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain USA300)
Q047M8 0.0 1015 48 10 1061 3 carB Carbamoyl phosphate synthase large chain Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
P63740 0.0 1014 49 11 1057 1 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain N315)
P63739 0.0 1014 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS88 0.0 1014 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH9)
A6U122 0.0 1014 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain JH1)
A7X1F4 0.0 1014 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q71YI1 0.0 1014 49 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain F2365)
Q4L5Q5 0.0 1013 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus haemolyticus (strain JCSC1435)
A0AJU0 0.0 1013 49 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q03LT8 0.0 1013 50 12 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5M5F6 0.0 1013 50 12 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5M0W9 0.0 1013 50 12 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus thermophilus (strain CNRZ 1066)
Q6GHN2 0.0 1013 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MRSA252)
B8DDR7 0.0 1013 49 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4a (strain HCC23)
Q03WW7 0.0 1013 48 11 1074 3 carB Carbamoyl phosphate synthase large chain Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
C1KWD4 0.0 1013 49 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serotype 4b (strain CLIP80459)
Q3K150 0.0 1011 49 12 1058 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
C1CEM9 0.0 1010 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain JJA)
Q8Y665 0.0 1010 49 9 1050 3 carB Carbamoyl phosphate synthase large chain Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q92AH3 0.0 1010 49 9 1048 3 carB Carbamoyl phosphate synthase large chain Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8GEA3 0.0 1009 50 13 1053 3 carB Carbamoyl phosphate synthase large chain Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
B1IC65 0.0 1009 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Hungary19A-6)
B5E512 0.0 1008 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 19F (strain G54)
Q8DZQ7 0.0 1008 49 12 1058 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E5F5 0.0 1008 49 12 1058 3 carB Carbamoyl phosphate synthase large chain Streptococcus agalactiae serotype III (strain NEM316)
C1CL09 0.0 1007 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain P1031)
C1C7Q3 0.0 1007 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain 70585)
C1CR31 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain Taiwan19F-14)
Q97QE4 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q04K48 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8CWR0 0.0 1006 49 9 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q5HPY8 0.0 1006 49 11 1059 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
B2GD06 0.0 1006 48 9 1060 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B2IQ67 0.0 1005 49 10 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain CGSP14)
B8ZJT9 0.0 1005 49 10 1049 3 carB Carbamoyl phosphate synthase large chain Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
P58940 0.0 1005 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus aureus (strain MW2)
P77886 0.0 1005 49 11 1049 3 pyrAB Carbamoyl phosphate synthase pyrimidine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8CPJ4 0.0 1004 49 11 1057 3 carB Carbamoyl phosphate synthase large chain Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q03HB0 0.0 1003 49 10 1050 3 carB Carbamoyl phosphate synthase large chain Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
Q8DUP3 0.0 1003 49 11 1051 3 carB Carbamoyl phosphate synthase large chain Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A3CU73 0.0 1001 50 11 1052 3 carB Carbamoyl phosphate synthase large chain Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
A7I6J1 0.0 1000 50 11 1052 3 carB Carbamoyl phosphate synthase large chain Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
B9DPN2 0.0 999 48 11 1059 3 carB Carbamoyl phosphate synthase large chain Staphylococcus carnosus (strain TM300)
A3CNI5 0.0 997 49 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus sanguinis (strain SK36)
Q04H29 0.0 997 47 9 1050 3 carB Carbamoyl phosphate synthase large chain Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
C0M756 0.0 995 48 10 1057 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. equi (strain 4047)
B9EB69 0.0 995 48 12 1068 3 carB Carbamoyl phosphate synthase large chain Macrococcus caseolyticus (strain JCSC5402)
A8AX83 0.0 994 49 11 1055 3 carB Carbamoyl phosphate synthase large chain Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
C0MEH1 0.0 994 49 10 1053 3 carB Carbamoyl phosphate synthase large chain Streptococcus equi subsp. zooepidemicus (strain H70)
Q8XHB3 0.0 993 48 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain 13 / Type A)
Q834E2 0.0 992 49 12 1051 3 carB Carbamoyl phosphate synthase large chain Enterococcus faecalis (strain ATCC 700802 / V583)
Q0TM79 0.0 991 48 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B1MZ74 0.0 990 48 12 1075 3 carB Carbamoyl phosphate synthase large chain Leuconostoc citreum (strain KM20)
Q0SPY4 0.0 989 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium perfringens (strain SM101 / Type A)
Q49WY4 0.0 987 48 11 1059 3 carB Carbamoyl phosphate synthase large chain Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
B9DRV7 0.0 983 48 10 1052 3 carB Carbamoyl phosphate synthase large chain Streptococcus uberis (strain ATCC BAA-854 / 0140J)
Q9CFV2 0.0 981 50 8 1027 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. lactis (strain IL1403)
A9KI94 0.0 981 48 11 1061 3 carB Carbamoyl phosphate synthase large chain Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
B9KXM5 0.0 979 49 12 1066 3 carB Carbamoyl phosphate synthase large chain Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q2FLD9 0.0 979 48 10 1063 3 carB Carbamoyl phosphate synthase large chain Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
B2G564 0.0 979 48 12 1054 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VHN6 0.0 979 48 12 1054 3 carB Carbamoyl phosphate synthase large chain Limosilactobacillus reuteri (strain DSM 20016)
A2SQ53 0.0 978 48 11 1055 3 carB Carbamoyl phosphate synthase large chain Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
B0K4D7 0.0 976 46 12 1082 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter sp. (strain X514)
O32771 0.0 976 48 10 1056 2 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain MG1363)
A6LPD9 0.0 973 47 8 1039 3 carB Carbamoyl phosphate synthase large chain Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q02YG5 0.0 973 49 9 1029 3 carB Carbamoyl phosphate synthase large chain Lactococcus lactis subsp. cremoris (strain SK11)
Q8RBK0 0.0 973 47 12 1082 3 carB Carbamoyl phosphate synthase large chain Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
A5D508 0.0 972 48 12 1062 3 carB Carbamoyl phosphate synthase large chain Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
A7GE89 0.0 969 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
C1FNY3 0.0 968 47 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Kyoto / Type A2)
Q6A914 0.0 965 47 10 1058 3 carB Carbamoyl phosphate synthase large chain Cutibacterium acnes (strain DSM 16379 / KPA171202)
B2A170 0.0 965 45 11 1103 3 carB Carbamoyl phosphate synthase large chain Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
C4ZEK2 0.0 964 45 9 1061 3 carB Carbamoyl phosphate synthase large chain Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
B2UX86 0.0 960 45 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Alaska E43 / Type E3)
B2THH3 0.0 957 46 8 1049 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Eklund 17B / Type B)
B1KT07 0.0 955 46 9 1051 3 carB Carbamoyl phosphate synthase large chain Clostridium botulinum (strain Loch Maree / Type A3)
B0KBW4 0.0 952 46 12 1082 3 carB Carbamoyl phosphate synthase large chain Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q97FT3 0.0 952 45 10 1071 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97FT3 1.79e-63 238 33 7 417 3 carB Carbamoyl phosphate synthase large chain Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
B8D1H3 0.0 936 46 12 1051 3 carB Carbamoyl phosphate synthase large chain Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q9K8V7 0.0 870 45 10 981 3 carB Carbamoyl phosphate synthase arginine-specific large chain Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9ZB63 0.0 854 47 9 950 3 carB Carbamoyl phosphate synthase arginine-specific large chain Geobacillus stearothermophilus
P18185 0.0 842 46 10 937 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
P18185 2.78e-65 243 37 6 402 3 carB Carbamoyl phosphate synthase arginine-specific large chain Bacillus subtilis (strain 168)
Q9HP43 0.0 840 46 16 999 3 carB Carbamoyl phosphate synthase large chain Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
P07756 0.0 837 41 12 1056 1 Cps1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Rattus norvegicus
Q8C196 0.0 835 41 12 1056 1 Cps1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Mus musculus
Q9RLS9 0.0 833 46 12 943 3 carB1 Carbamoyl phosphate synthase arginine-specific large chain Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
P31327 0.0 830 41 13 1057 1 CPS1 Carbamoyl-phosphate synthase [ammonia], mitochondrial Homo sapiens
O93937 0.0 825 44 8 986 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O93937 1.65e-53 209 34 6 399 3 pyrABCN Multifunctional protein pyrABCN Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q09794 0.0 806 43 7 981 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q09794 7.6e-53 207 35 6 402 1 ura1 Multifunctional protein ura1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P07259 0.0 804 41 14 1050 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P07259 4.42e-54 211 32 9 477 1 URA2 Multifunctional protein URA2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9HK17 0.0 800 44 19 1040 3 carB Carbamoyl phosphate synthase large chain Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
Q7S8A6 0.0 793 42 10 993 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q7S8A6 2.6e-58 224 36 9 426 1 pyr-3 Multifunctional protein pyr-3 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q91293 0.0 788 39 11 1046 2 None Carbamoyl-phosphate synthase [ammonia], mitochondrial Aquarana catesbeiana
Q91437 0.0 782 39 14 1093 2 CAD Multifunctional protein CAD Squalus acanthias
Q91437 1.54e-49 196 31 12 458 2 CAD Multifunctional protein CAD Squalus acanthias
P27708 0.0 780 42 8 981 1 CAD Multifunctional protein CAD Homo sapiens
P27708 1.94e-51 202 34 7 389 1 CAD Multifunctional protein CAD Homo sapiens
Q8U085 0.0 776 42 14 1002 3 carB Carbamoyl phosphate synthase large chain Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
A2BJL3 0.0 774 44 13 949 3 carB Carbamoyl phosphate synthase large chain Hyperthermus butylicus (strain DSM 5456 / JCM 9403 / PLM1-5)
O94313 0.0 772 42 11 970 3 arg4 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P08955 0.0 771 41 10 1018 1 CAD Multifunctional protein CAD Mesocricetus auratus
P08955 2.85e-51 202 34 7 389 1 CAD Multifunctional protein CAD Mesocricetus auratus
B2RQC6 0.0 769 41 10 1018 1 Cad Multifunctional protein CAD Mus musculus
B2RQC6 4.03e-52 204 34 7 389 1 Cad Multifunctional protein CAD Mus musculus
Q97AJ3 0.0 769 41 24 1080 3 carB Carbamoyl phosphate synthase large chain Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
P20054 0.0 766 39 15 1070 1 pyr1-3 Multifunctional protein pyr1-3 Dictyostelium discoideum
Q18990 0.0 764 40 9 1026 1 pyr-1 Multifunctional protein pyr-1 Caenorhabditis elegans
Q18990 1.52e-57 221 36 6 389 1 pyr-1 Multifunctional protein pyr-1 Caenorhabditis elegans
Q18990 6.72e-43 175 29 9 411 1 pyr-1 Multifunctional protein pyr-1 Caenorhabditis elegans
P46056 0.0 755 40 16 1053 3 argA Carbamoyl phosphate synthase arginine-specific large chain Cutaneotrichosporon cutaneum
P46056 3.36e-54 210 31 10 448 3 argA Carbamoyl phosphate synthase arginine-specific large chain Cutaneotrichosporon cutaneum
Q75D66 0.0 747 40 18 1060 3 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q7SH52 0.0 745 40 12 981 1 arg-3 Carbamoyl phosphate synthase arginine-specific large chain, mitochondrial Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P05990 0.0 742 40 11 1018 1 r Multifunctional protein r Drosophila melanogaster
P05990 4.47e-52 204 33 6 389 1 r Multifunctional protein r Drosophila melanogaster
Q970U7 0.0 738 40 12 996 3 carB Carbamoyl phosphate synthase large chain Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
C3NH23 0.0 734 41 12 970 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3NH23 5.71e-62 233 35 6 390 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3NH23 6.31e-47 186 31 7 391 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.N.15.51 / Yellowstone #2)
C3NEM0 0.0 733 41 12 970 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NEM0 9.86e-62 233 35 6 390 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3NEM0 7.07e-47 186 31 7 391 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain Y.G.57.14 / Yellowstone #1)
C3MQE3 0.0 733 41 12 970 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MQE3 9.86e-62 233 35 6 390 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MQE3 7.07e-47 186 31 7 391 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C3MW21 0.0 733 41 12 970 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MW21 6.2e-62 233 35 6 390 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3MW21 1.49e-46 185 31 7 391 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3N664 0.0 733 41 12 970 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
C3N664 6.2e-62 233 35 6 390 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
C3N664 1.49e-46 185 31 7 391 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.27)
C4KHM7 0.0 732 41 12 970 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C4KHM7 6.09e-62 233 35 6 390 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
C4KHM7 3.63e-46 184 31 7 391 3 carB Carbamoyl phosphate synthase large chain Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q4J8E8 0.0 731 41 11 964 3 carB Carbamoyl phosphate synthase large chain Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
P03965 0.0 730 41 12 941 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P03965 1.05e-50 199 32 9 397 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P03965 2.01e-48 191 31 5 392 1 CPA2 Carbamoyl phosphate synthase arginine-specific large chain Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q59969 0.0 719 41 12 936 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q59969 2.91e-62 234 36 6 390 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q59969 1.72e-43 176 31 7 391 3 carB Carbamoyl phosphate synthase large chain Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
O67869 0.0 688 61 4 550 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
O67869 1.18e-70 249 36 7 419 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Aquifex aeolicus (strain VF5)
Q8ZY48 0.0 673 40 14 974 3 carB Carbamoyl phosphate synthase large chain Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q58776 0.0 579 49 7 611 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58776 5.58e-65 235 35 6 399 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
O67233 0.0 565 54 2 506 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
O67233 2.48e-65 234 36 6 389 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Aquifex aeolicus (strain VF5)
Q8TWX0 0.0 553 52 5 558 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TWX0 2.1e-66 237 39 5 389 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TUT7 1.7e-168 509 53 4 492 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q8TUT7 1.63e-78 271 37 6 428 3 carB2 Carbamoyl phosphate synthase large chain, C-terminal section Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q58773 7.37e-168 505 54 4 468 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58773 1.75e-64 229 37 7 390 3 carB1 Carbamoyl phosphate synthase large chain, N-terminal section Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P13258 5.72e-124 387 51 0 362 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
P13258 9.73e-33 135 34 5 250 3 carB Carbamoyl phosphate synthase large chain (Fragment) Methanosarcina barkeri
Q0CLK1 2.12e-13 79 27 8 284 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
Q0CLK1 0.00016 49 25 9 236 3 pyc Pyruvate carboxylase Aspergillus terreus (strain NIH 2624 / FGSC A1156)
O93918 2.52e-13 78 27 8 284 2 pyc Pyruvate carboxylase Aspergillus terreus
O93918 0.000163 49 25 9 236 2 pyc Pyruvate carboxylase Aspergillus terreus
Q9KWU4 4.92e-12 74 23 10 321 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q9KWU4 1.89e-06 56 24 11 268 1 pyc Pyruvate carboxylase Bacillus subtilis (strain 168)
Q58626 2.45e-11 71 24 10 325 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58626 9.93e-11 69 22 6 250 1 pycA Pyruvate carboxylase subunit A Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9UUE1 3.06e-11 71 26 8 281 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9UUE1 7.02e-07 57 24 6 236 3 pyr1 Pyruvate carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
A5GX22 9.9e-11 68 25 12 272 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
A5GX22 3.36e-05 51 23 10 333 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain RCC307)
Q9HES8 1.24e-10 69 25 10 330 3 pyc Pyruvate carboxylase Aspergillus niger
P32327 1.6e-10 69 24 8 283 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32327 0.000203 49 23 6 234 1 PYC2 Pyruvate carboxylase 2 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A8ACE0 2.13e-10 67 24 14 361 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A0A0H3JRU9 3e-10 68 24 6 271 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
A0A0H3JRU9 1.66e-05 53 23 6 236 1 pycA Pyruvate carboxylase Staphylococcus aureus (strain Mu50 / ATCC 700699)
D3DJ42 3.46e-10 67 27 6 240 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
D3DJ42 2.79e-09 64 25 6 243 1 cfiB 2-oxoglutarate carboxylase small subunit Hydrogenobacter thermophilus (strain DSM 6534 / IAM 12695 / TK-6)
O30019 5.59e-10 67 24 11 324 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
O30019 0.000379 48 22 5 240 3 pycA Pyruvate carboxylase subunit A Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A6L404 6.93e-10 65 24 10 300 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Phocaeicola vulgatus (strain ATCC 8482 / DSM 1447 / JCM 5826 / CCUG 4940 / NBRC 14291 / NCTC 11154)
Q5LD90 9.65e-10 65 24 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6Q186 1.53e-09 65 25 5 228 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
A6Q186 1.89e-07 58 26 4 162 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nitratiruptor sp. (strain SB155-2)
Q64UB2 2.12e-09 64 24 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides fragilis (strain YCH46)
P37798 2.34e-09 64 23 4 244 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P37798 5.14e-06 53 23 9 328 1 accC Biotin carboxylase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9KDS9 5.26e-09 63 23 8 268 3 accC Biotin carboxylase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P32528 7.93e-09 63 22 9 309 1 DUR1,2 Urea amidolyase Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
O17732 8.24e-09 63 25 9 304 1 pyc-1 Pyruvate carboxylase 1 Caenorhabditis elegans
Q7VBB3 8.89e-09 62 26 6 202 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7VBB3 1.44e-05 52 23 9 236 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q5LUF3 1.56e-08 62 22 7 280 1 pccA Propionyl-CoA carboxylase alpha chain Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P0DTA4 1.75e-08 62 24 6 267 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
P0DTA4 5.48e-07 57 23 10 331 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Sus scrofa
Q8A9W1 2.03e-08 61 24 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P11154 2.06e-08 62 23 10 325 1 PYC1 Pyruvate carboxylase 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7V3S4 2.53e-08 61 29 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
Q7V3S4 0.000111 49 23 10 235 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9313)
P05165 2.93e-08 61 24 11 335 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
P05165 1.27e-07 59 25 8 270 1 PCCA Propionyl-CoA carboxylase alpha chain, mitochondrial Homo sapiens
O27939 4.47e-08 60 22 8 314 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27939 6.46e-06 53 25 8 240 1 pycA Pyruvate carboxylase subunit A Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
P49787 5.92e-08 60 24 8 316 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
P49787 0.000191 48 24 6 244 3 accC1 Biotin carboxylase 1 Bacillus subtilis (strain 168)
Q3M8Q4 8.02e-08 59 28 6 160 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q8X1T3 9.97e-08 60 25 6 254 3 PYC Pyruvate carboxylase Pichia angusta
Q96Y60 1.2e-07 58 29 3 117 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q3AUF2 1.42e-07 58 22 14 308 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
Q3AUF2 0.000702 47 27 9 226 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9902)
A2CE36 1.46e-07 58 29 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
A2CE36 0.000133 49 25 8 203 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9303)
Q31AM1 1.91e-07 58 24 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9312)
P52873 2.95e-07 58 22 9 325 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
P52873 1.8e-05 52 23 11 321 1 Pc Pyruvate carboxylase, mitochondrial Rattus norvegicus
B9HBA8 3.07e-07 58 22 7 236 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
B9HBA8 3e-06 55 22 6 240 2 POPTRDRAFT_831870 Biotin carboxylase 1, chloroplastic Populus trichocarpa
Q05920 3.13e-07 58 22 9 325 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q05920 1.83e-05 52 23 11 321 1 Pc Pyruvate carboxylase, mitochondrial Mus musculus
Q8YXB6 3.62e-07 57 29 3 115 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A5H0J2 3.93e-07 58 23 5 231 3 DUR1,2 Urea amidolyase Lachancea kluyveri
B9N843 4.84e-07 57 23 8 238 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
B9N843 0.000104 50 22 6 240 2 POPTR_0018s14250g Biotin carboxylase 2, chloroplastic Populus trichocarpa
Q7M8I0 5.99e-07 56 22 10 294 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q7M8I0 3.16e-06 54 24 4 162 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q4JC46 7.03e-07 56 32 4 120 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q4JC46 0.000122 49 23 10 236 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q30UL7 7.14e-07 56 24 11 299 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q54J08 7.19e-07 57 22 3 184 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
Q54J08 0.000502 48 22 4 190 3 accA Acetyl-CoA carboxylase Dictyostelium discoideum
P78820 8.02e-07 57 21 6 231 1 cut6 Acetyl-CoA carboxylase Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q7V179 8.82e-07 56 24 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
P39771 1.05e-06 55 23 13 330 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus subtilis (strain 168)
Q06862 1.08e-06 56 22 7 234 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q06862 0.000139 49 22 7 241 3 accC Biotin carboxylase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q91ZA3 1.14e-06 56 23 10 331 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
Q91ZA3 3.25e-06 55 23 7 275 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Mus musculus
O04983 1.29e-06 56 23 8 238 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
O04983 0.000347 48 24 6 205 1 CAC2 Biotin carboxylase, chloroplastic Arabidopsis thaliana
P78992 1.34e-06 56 26 5 249 3 PYC1 Pyruvate carboxylase Komagataella pastoris
A2BWY5 1.47e-06 55 24 7 205 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain MIT 9515)
P43873 1.75e-06 55 25 5 240 1 accC Biotin carboxylase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3AG69 1.88e-06 55 28 10 233 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
Q3AG69 1.61e-05 52 22 12 301 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9605)
I3R7G3 2.77e-06 55 24 7 248 1 pccA Propionyl-CoA carboxylase, biotin carboxylase and biotin-carboxyl carrier subunit Haloferax mediterranei (strain ATCC 33500 / DSM 1411 / JCM 8866 / NBRC 14739 / NCIMB 2177 / R-4)
Q19842 3.19e-06 55 22 6 246 1 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis elegans
Q8S6N5 3.95e-06 55 26 3 164 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
Q8S6N5 1.92e-05 52 22 12 314 3 ACC1 Acetyl-CoA carboxylase 1 Oryza sativa subsp. japonica
Q8EYF0 4.48e-06 53 24 9 276 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72LY0 4.48e-06 53 24 9 276 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q612F5 6.26e-06 54 23 6 246 3 pcca-1 Propionyl-CoA carboxylase alpha chain, mitochondrial Caenorhabditis briggsae
A3N7B6 6.33e-06 53 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 668)
Q29RK2 6.56e-06 54 21 9 325 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
Q29RK2 4.93e-05 51 23 11 321 2 PC Pyruvate carboxylase, mitochondrial Bos taurus
Q981B9 7.39e-06 53 21 14 346 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
P24182 7.45e-06 53 25 4 187 1 accC Biotin carboxylase Escherichia coli (strain K12)
Q63VY4 7.73e-06 53 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain K96243)
Q3JUJ4 7.73e-06 53 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1710b)
A3NT04 7.73e-06 53 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia pseudomallei (strain 1106a)
Q8X9B6 7.85e-06 53 25 4 187 3 accC Biotin carboxylase Escherichia coli O157:H7
O52058 9.58e-06 53 22 6 249 3 accC Biotin carboxylase Allochromatium vinosum (strain ATCC 17899 / DSM 180 / NBRC 103801 / NCIMB 10441 / D)
Q0I600 1.14e-05 52 26 6 199 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain CC9311)
Q2N8K3 1.28e-05 52 25 7 180 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Erythrobacter litoralis (strain HTCC2594)
P11498 1.34e-05 53 21 9 325 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
P11498 7.92e-05 50 22 11 321 1 PC Pyruvate carboxylase, mitochondrial Homo sapiens
A1V2C2 1.52e-05 52 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain SAVP1)
Q62IF4 1.52e-05 52 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain ATCC 23344)
A2S4F3 1.52e-05 52 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10229)
A3MI07 1.52e-05 52 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia mallei (strain NCTC 10247)
P38095 1.64e-05 53 20 7 306 2 lamA Putative urea carboxylase Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
A6Q6K6 1.75e-05 52 22 5 226 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
A6Q6K6 6.41e-05 50 22 6 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Sulfurovum sp. (strain NBC37-1)
Q38970 1.87e-05 53 27 6 192 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
Q38970 0.000337 48 21 5 189 1 ACC1 Acetyl-CoA carboxylase 1 Arabidopsis thaliana
Q39E61 1.91e-05 52 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A7GKE0 2.07e-05 51 25 7 222 3 ddl D-alanine--D-alanine ligase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q46KI4 2.08e-05 52 25 4 150 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL2A)
Q0W4L8 2.1e-05 52 25 3 137 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
O25817 2.6e-05 51 22 4 177 3 purD Phosphoribosylamine--glycine ligase Helicobacter pylori (strain ATCC 700392 / 26695)
Q8KDJ0 2.94e-05 51 24 6 185 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q6M0Z5 3.04e-05 51 22 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6M0Z5 5.89e-05 50 32 4 107 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
A4G068 3.71e-05 51 22 5 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
A4G068 6.54e-05 50 31 4 107 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q9ZK07 4.04e-05 51 21 4 177 3 purD Phosphoribosylamine--glycine ligase Helicobacter pylori (strain J99 / ATCC 700824)
A6US04 4.26e-05 51 22 16 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A4JGK4 4.33e-05 50 23 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A6ZMR9 4.38e-05 51 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
A6ZMR9 0.0001 50 20 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain YJM789)
Q58881 4.55e-05 50 27 4 122 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58881 0.000103 49 21 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A7Z0Z2 4.57e-05 50 25 11 262 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P32874 4.69e-05 51 23 4 182 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P32874 0.000107 50 20 3 200 1 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
B9FK36 4.7e-05 51 22 4 197 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
B9FK36 0.000117 50 23 5 190 3 ACC2 Acetyl-CoA carboxylase 2 Oryza sativa subsp. japonica
C6BV99 5.47e-05 50 30 3 105 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
P14882 5.78e-05 51 23 10 331 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
P14882 0.00075 47 22 7 275 1 Pcca Propionyl-CoA carboxylase alpha chain, mitochondrial Rattus norvegicus
A6VIB2 5.94e-05 50 31 4 107 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A6VIB2 9.43e-05 49 23 4 201 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A5GPT7 6.12e-05 50 27 7 227 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain WH7803)
A5UK38 6.73e-05 50 21 10 280 1 Msm_0361 Carbamoyl-phosphate synthase Methanobrevibacter smithii (strain ATCC 35061 / DSM 861 / OCM 144 / PS)
B3LM95 6.8e-05 51 20 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
B3LM95 9.93e-05 50 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain RM11-1a)
A2C2S8 6.87e-05 50 24 4 150 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Prochlorococcus marinus (strain NATL1A)
Q9JSZ9 7.01e-05 49 24 8 260 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
C7GRE4 7.09e-05 51 20 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
C7GRE4 0.0001 50 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain JAY291)
C8ZF72 7.46e-05 50 20 3 200 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
C8ZF72 0.000117 50 23 4 182 3 HFA1 Acetyl-CoA carboxylase, mitochondrial Saccharomyces cerevisiae (strain Lalvin EC1118 / Prise de mousse)
O34544 7.62e-05 50 21 6 246 3 accC2 Biotin carboxylase 2 Bacillus subtilis (strain 168)
Q9K0Y0 8.38e-05 49 24 7 244 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
F4I1L3 8.56e-05 50 22 8 286 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
F4I1L3 0.000304 48 21 4 197 2 ACC2 Acetyl-CoA carboxylase 2 Arabidopsis thaliana
A0A4P8DJE6 0.0001 50 23 3 184 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
A0A4P8DJE6 0.000144 50 21 4 225 3 dmxL1 Acetyl-CoA carboxylase dmxL1 Cryptosporiopsis sp. (strain 8999)
B9KFX8 0.000115 49 23 5 203 3 ddl D-alanine--D-alanine ligase Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
A9A6Q7 0.000118 49 22 18 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
Q65N65 0.000122 49 23 12 259 3 ddl D-alanine--D-alanine ligase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
C4XMB3 0.000125 49 32 3 111 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
Q1I5C0 0.000129 48 28 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas entomophila (strain L48)
Q42523 0.000138 49 22 7 238 1 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Arabidopsis thaliana
A6VJ27 0.000158 49 22 18 317 3 purD Phosphoribosylamine--glycine ligase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
Q81IU1 0.00016 48 22 11 259 3 ddlB D-alanine--D-alanine ligase B Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q5HUZ4 0.000182 48 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni (strain RM1221)
A1VZE6 0.000182 48 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
A1KVL1 0.000185 48 24 7 244 3 ddl D-alanine--D-alanine ligase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B8GRA4 0.000212 48 23 10 292 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
Q142Q7 0.000216 48 23 11 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Paraburkholderia xenovorans (strain LB400)
Q5SH23 0.00022 48 33 1 83 1 lysX Alpha-aminoadipate--LysW ligase LysX Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
A1SWW0 0.000233 48 25 7 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q3K746 0.000236 48 28 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas fluorescens (strain Pf0-1)
C1DDZ2 0.000238 48 29 3 116 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q8D2R3 0.000239 48 23 3 118 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Wigglesworthia glossinidia brevipalpis
A1ANT6 0.000249 48 26 6 162 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
Q55336 0.000258 48 24 6 187 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A6UUH1 0.000265 48 30 5 110 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
A8FLL1 0.000277 48 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
A6GWP9 0.000283 48 23 7 229 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Flavobacterium psychrophilum (strain ATCC 49511 / DSM 21280 / CIP 103535 / JIP02/86)
Q31DQ3 0.000288 48 28 4 121 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B5XQ21 0.000292 48 26 8 195 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Klebsiella pneumoniae (strain 342)
Q2IJJ5 0.00031 48 26 1 113 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q2QMG2 0.000328 48 22 7 233 2 MCCA Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial Oryza sativa subsp. japonica
Q897P8 0.000345 47 25 8 236 3 ddlA D-alanine--D-alanine ligase A Clostridium tetani (strain Massachusetts / E88)
B0KFS4 0.000349 47 27 1 103 3 ddl D-alanine--D-alanine ligase Pseudomonas putida (strain GB-1)
A7H451 0.000357 47 19 3 226 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
Q88N74 0.000371 47 27 1 103 3 ddlB D-alanine--D-alanine ligase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q1BUU4 0.000382 47 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia orbicola (strain AU 1054)
A0K993 0.000382 47 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia cenocepacia (strain HI2424)
A4VIT1 0.000383 47 31 3 105 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Stutzerimonas stutzeri (strain A1501)
Q9PPC2 0.00041 47 20 2 169 3 ddl D-alanine--D-alanine ligase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q2SZW6 0.000417 47 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A6URA6 0.000428 47 31 6 121 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
Q8FMB3 0.000494 47 23 6 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
Q7U3B3 0.000514 47 26 7 225 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parasynechococcus marenigrum (strain WH8102)
Q0SEI4 0.000589 47 24 7 230 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q0SEI4 0.000847 47 29 3 110 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Rhodococcus jostii (strain RHA1)
Q0BD59 0.000595 47 22 9 295 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
P9WPQ3 0.000607 47 25 5 191 1 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WPQ2 0.000607 47 25 5 191 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A509 0.000607 47 25 5 191 3 accA1 Biotin-dependent 3-methylcrotonyl-coenzyme A carboxylase alpha1 subunit Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
A7MVH5 0.000615 47 25 8 192 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Vibrio campbellii (strain ATCC BAA-1116)
Q4JXR6 0.00063 47 25 2 166 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Corynebacterium jeikeium (strain K411)
Q0K6M6 0.000712 46 23 8 237 3 ddl D-alanine--D-alanine ligase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q1LIM8 0.000712 46 23 7 237 3 ddl D-alanine--D-alanine ligase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q8KWS8 0.000816 47 22 6 229 1 bacD Alanine--anticapsin ligase Bacillus amyloliquefaciens
A6LHW2 0.000845 46 27 7 166 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
A4VII0 0.000891 46 30 1 103 3 ddl D-alanine--D-alanine ligase Stutzerimonas stutzeri (strain A1501)
Q65VI3 0.000898 46 22 7 187 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5N3J5 0.001 46 27 4 133 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31QP9 0.001 46 27 4 133 3 purT Formate-dependent phosphoribosylglycinamide formyltransferase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_09845
Feature type CDS
Gene carB
Product carbamoyl-phosphate synthase large subunit
Location 120214 - 123441 (strand: -1)
Length 3228 (nucleotides) / 1075 (amino acids)
In genomic island -

Contig

Accession ZDB_524
Length 215957 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1186
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF02142 MGS-like domain
PF02786 Carbamoyl-phosphate synthase L chain, ATP binding domain
PF02787 Carbamoyl-phosphate synthetase large chain, oligomerisation domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0458 Amino acid transport and metabolism (E)
Nucleotide transport and metabolism (F)
EF Carbamoylphosphate synthase large subunit

Kegg Ortholog Annotation(s)

Protein Sequence

MAKRTDISSILILGAGPIVIGQACEFDYSGAQACKALREEGYRVILVNSNPATIMTDPEMADATYIEPIHWEVVRKIIEKERPDAVLPTMGGQTALNCALDLERHGVLAEFGVEMIGATADAIDKAEDRRRFDIAMKKIGLDTARSGIAHTMEEAFAVADDVGFPCIIRPSFTMGGTGGGIAYNREEFEEICTRGLDLSPTNELLIDESLIGWKEYEMEVVRDKNDNCIIVCSIENFDAMGIHTGDSITVAPAQTLTDKEYQIMRNASMAVLREIGVETGGSNVQFSVNPKTGRLIVIEMNPRVSRSSALASKATGFPIAKIAAKLAVGYTLDELSNDITGGLTPASFEPSIDYVVTKIPRFNFEKFAGTNDRLTTQMKSVGEVMAIGRTQQESLQKALRGLEVGATGFDPKVNLDDPDALTRIRRELKEAGGERIWYIADAFRAGLSVDGVFNLTNVDRWFLVQIEELVRLEEQVAEVGINGLTPEFLRHLKRKGFADARLAKLVGVAEAEIRKLRDSYQLWPVYKRVDTCAAEFATDTAYLYSTYEEECEAQPNNDKPKIMVLGGGPNRIGQGIEFDYCCVHAAMALREDGYETIMVNCNPETVSTDYDTSDRLYFEPVTLEDVLEIVRVEKPAGVIVQYGGQTPLKLARSLEAAGVPVIGTSPDAIDRAEDRERFQQAVVRLGLKQPANATVSNIEQAVERAKEIGYPLVVRPSYVLGGRAMEIVCDETDLRRYFQNAVSVSNDAPVLLDRFLDDAIEVDVDAICDGEQVLIGGIMEHIEQAGVHSGDSACSLPAYTLSQEIQDVMRDQVRKLAMELRVRGLMNTQFAVKDNEVYLIEVNPRAARTVPFVSKATGVPLAKVAARVMAGQTLAQQGVTKEVIPPYYSVKEVVLPFNKFPGVDPILGPEMRSTGEVMGVGRTFAEAFAKAMLGSSSSLKKKGRALLSVREGDKARVVDLAAKLLKQGFELDATHGTAIVLGEAGINPRLVNKVHEGRPHIQDRIKNGEYDYIVNTTAGRQAIEDSKVIRRSALQYKVHYDTTMNGGFATTLSLNMDPTERVISVQEMHSLIKDK

Flanking regions ( +/- flanking 50bp)

CACTTTATTGAACTGATGAAAAACGCCCGTCACTGATCAGGAGCAGAAAAATGGCAAAACGTACAGATATCAGCAGCATCCTGATTTTAGGCGCCGGTCCGATTGTTATCGGCCAGGCCTGTGAATTTGACTACTCCGGCGCCCAGGCGTGTAAAGCCCTGCGCGAAGAAGGCTACCGCGTTATCCTCGTTAACTCTAACCCGGCAACCATTATGACCGACCCGGAAATGGCGGATGCGACTTACATCGAGCCGATTCACTGGGAAGTGGTGCGCAAAATCATCGAAAAAGAGCGCCCGGATGCCGTTCTGCCGACCATGGGCGGACAAACCGCGCTGAACTGTGCGCTGGATCTGGAACGTCACGGCGTGCTGGCAGAGTTCGGTGTCGAAATGATTGGCGCGACAGCGGATGCGATTGATAAAGCAGAAGATCGCCGCCGTTTCGATATCGCGATGAAAAAAATCGGTCTGGATACAGCGCGTTCCGGTATCGCACACACCATGGAAGAAGCGTTTGCGGTCGCCGATGATGTCGGTTTCCCGTGCATTATCCGCCCGTCATTCACCATGGGCGGCACTGGCGGCGGTATCGCGTATAACCGCGAAGAGTTTGAGGAAATCTGTACCCGCGGCCTGGATCTCTCCCCGACCAATGAACTGCTGATTGATGAATCACTGATTGGCTGGAAAGAGTATGAAATGGAAGTGGTGCGGGACAAAAATGATAACTGCATCATTGTCTGCTCCATCGAAAACTTCGACGCGATGGGGATCCACACCGGTGACTCTATCACCGTTGCCCCGGCACAGACCCTGACCGACAAAGAATACCAAATCATGCGTAACGCCTCGATGGCGGTGCTGCGTGAAATCGGCGTGGAAACCGGCGGCTCCAACGTGCAGTTCTCGGTGAACCCGAAAACCGGCCGTCTGATTGTTATCGAAATGAACCCGCGTGTATCACGCTCCTCTGCGCTGGCCTCCAAAGCGACCGGTTTCCCGATTGCCAAAATCGCGGCCAAACTGGCAGTCGGCTACACGCTGGATGAGCTGTCAAACGACATCACCGGCGGCCTGACACCGGCCTCCTTTGAGCCGTCCATCGACTATGTTGTGACAAAAATCCCGCGCTTTAACTTTGAAAAATTTGCCGGCACCAATGACCGTCTGACCACACAGATGAAATCCGTCGGTGAAGTGATGGCTATCGGCCGCACTCAGCAGGAATCCCTGCAAAAAGCGCTGCGTGGCCTCGAAGTGGGCGCGACCGGTTTTGATCCGAAAGTGAATTTAGATGACCCGGATGCACTGACCCGCATCCGCCGTGAGCTGAAAGAAGCGGGCGGCGAGCGGATCTGGTATATCGCGGACGCATTCCGCGCCGGACTGTCAGTTGACGGCGTATTTAACCTGACCAACGTTGATCGCTGGTTCCTGGTGCAGATTGAAGAGCTGGTGCGTCTGGAAGAGCAGGTGGCGGAAGTCGGGATTAACGGCCTGACCCCGGAATTCCTGCGTCACCTGAAACGTAAAGGTTTTGCGGATGCGCGGCTGGCAAAACTGGTCGGCGTGGCGGAAGCTGAAATCCGCAAACTGCGCGACAGCTACCAGCTGTGGCCGGTTTACAAGCGCGTGGATACCTGTGCGGCGGAATTTGCCACTGACACCGCCTATCTTTACTCCACCTATGAAGAAGAGTGTGAAGCGCAGCCGAACAACGACAAACCGAAAATTATGGTGCTCGGCGGCGGGCCGAACCGTATCGGCCAGGGCATTGAGTTTGACTACTGCTGCGTACACGCGGCGATGGCGCTGCGTGAAGACGGCTACGAAACCATCATGGTCAACTGCAACCCGGAAACGGTTTCCACTGACTACGACACCTCTGACCGCCTCTATTTCGAGCCGGTGACTCTGGAAGATGTGCTGGAAATCGTGCGTGTCGAAAAACCGGCGGGTGTGATTGTTCAGTACGGCGGCCAGACTCCGCTGAAACTGGCGCGCAGCCTGGAAGCGGCCGGTGTGCCGGTTATCGGTACCAGCCCGGATGCGATTGACCGCGCGGAAGACCGCGAGCGTTTCCAGCAGGCGGTCGTCCGCCTCGGCCTGAAACAACCGGCAAACGCCACCGTCTCTAATATTGAGCAGGCGGTTGAGCGGGCAAAAGAAATTGGTTATCCGCTGGTGGTGCGTCCTTCTTATGTGCTGGGCGGTCGCGCGATGGAAATCGTCTGCGACGAAACCGACCTGCGCCGTTACTTCCAGAATGCAGTCAGTGTCTCCAATGACGCACCGGTACTGCTTGACCGCTTCCTCGACGATGCGATTGAGGTGGATGTCGATGCTATCTGCGACGGCGAACAGGTGCTGATTGGCGGCATTATGGAGCACATCGAACAGGCGGGGGTTCACTCCGGGGATTCTGCCTGCTCGTTACCGGCTTACACGCTGAGTCAGGAAATCCAGGATGTGATGCGCGACCAGGTGAGAAAACTGGCGATGGAACTGCGTGTGCGCGGTCTGATGAACACCCAGTTTGCGGTCAAAGACAACGAAGTGTATCTGATTGAAGTTAACCCGCGTGCGGCGCGTACGGTGCCGTTTGTCTCCAAAGCCACCGGGGTGCCGCTGGCGAAAGTCGCAGCGCGCGTGATGGCCGGTCAGACACTGGCGCAGCAGGGTGTGACAAAAGAAGTCATCCCGCCGTACTACTCGGTGAAAGAAGTGGTGCTGCCATTCAACAAATTCCCGGGCGTTGACCCGATTTTAGGGCCGGAAATGCGCTCTACCGGGGAAGTGATGGGCGTGGGACGCACCTTTGCGGAAGCCTTTGCCAAAGCCATGCTCGGCAGCTCTTCCTCACTGAAGAAGAAAGGCCGTGCGCTGCTCTCTGTCCGCGAAGGTGATAAAGCGCGGGTGGTGGATCTGGCGGCAAAACTGCTGAAACAGGGTTTTGAGCTGGATGCGACACACGGTACTGCGATTGTGCTGGGTGAGGCGGGTATTAACCCGCGCCTGGTGAATAAGGTGCACGAAGGTCGCCCTCACATTCAGGACAGAATTAAAAACGGCGAATACGATTACATTGTGAATACTACCGCCGGTCGTCAGGCGATTGAGGATTCCAAAGTGATCCGCCGCAGCGCCCTGCAATATAAAGTGCATTACGACACCACCATGAACGGCGGCTTTGCCACCACACTGTCTCTGAATATGGATCCGACAGAGAGAGTGATTTCAGTACAGGAAATGCACAGCCTGATTAAAGATAAATAATCACGTTTGTTAAAATAAAAAATCCGCTGCGGCGGATTTTTTATTTCTCC