Homologs in group_3068

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_18735 FBDBKF_18735 100.0 Morganella morganii S1 lexA LexA family transcriptional regulator
EHELCC_15310 EHELCC_15310 100.0 Morganella morganii S2 lexA LexA family transcriptional regulator
LHKJJB_16000 LHKJJB_16000 100.0 Morganella morganii S3 lexA LexA family transcriptional regulator
HKOGLL_15120 HKOGLL_15120 100.0 Morganella morganii S5 lexA LexA family transcriptional regulator
PMI_RS11985 PMI_RS11985 38.0 Proteus mirabilis HI4320 - LexA family transcriptional regulator

Distribution of the homologs in the orthogroup group_3068

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_3068

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P69202 2.61e-51 167 43 2 203 1 C2 Repressor protein C2 Salmonella phage P22
Q79S39 1.06e-41 143 37 3 210 4 s087 HTH-type transcriptional regulator for conjugative element SXT Vibrio cholerae
Q8GJK1 1.06e-41 143 37 3 210 4 None HTH-type transcriptional regulator for conjugative element pMERPH Shewanella putrefaciens
Q79RI9 1.06e-41 143 37 3 210 4 ORF-96 HTH-type transcriptional regulator for conjugative element R391 Providencia rettgeri
P03034 4.81e-28 108 32 5 218 1 cI Repressor protein cI Escherichia phage lambda
P75974 7.85e-20 87 37 3 140 4 cohE Prophage repressor CohE Escherichia coli (strain K12)
Q83BT6 6.51e-13 68 24 4 199 1 CBU_1416 Uncharacterized HTH-type transcriptional regulator CBU_1416 Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q605V8 1.77e-07 53 32 5 131 3 lexA LexA repressor Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q2L247 1.39e-06 50 34 6 134 3 lexA LexA repressor Bordetella avium (strain 197N)
A4STB3 1.78e-06 50 31 6 141 3 lexA LexA repressor Aeromonas salmonicida (strain A449)
Q8PBM1 2.38e-06 49 34 4 128 3 lexA1 LexA repressor 1 Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B8CUX0 2.81e-06 49 34 6 135 3 lexA LexA repressor Shewanella piezotolerans (strain WP3 / JCM 13877)
B0TNT3 2.92e-06 49 35 6 135 3 lexA LexA repressor Shewanella halifaxensis (strain HAW-EB4)
P06966 4.35e-06 48 36 0 68 4 dicA HTH-type transcriptional regulator DicA Escherichia coli (strain K12)
A8H9S0 6.1e-06 48 35 6 135 3 lexA LexA repressor Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A1W897 1.02e-05 48 32 4 128 3 lexA LexA repressor Acidovorax sp. (strain JS42)
B9MI78 1.02e-05 48 32 4 128 3 lexA LexA repressor Acidovorax ebreus (strain TPSY)
Q44069 1.06e-05 48 31 6 141 3 lexA LexA repressor Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
B5EA68 1.17e-05 47 32 5 133 3 lexA LexA repressor Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
P23789 1.21e-05 46 32 1 73 1 xre HTH-type transcriptional regulator Xre Bacillus subtilis (strain 168)
C6DZY8 1.39e-05 47 32 5 133 3 lexA LexA repressor Geobacter sp. (strain M21)
A9IR25 1.43e-05 47 34 5 125 3 lexA LexA repressor Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
P61608 1.9e-05 47 33 5 130 3 lexA1 LexA repressor 1 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q7VRY0 2.59e-05 47 34 5 125 3 lexA LexA repressor Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7WCK0 2.59e-05 47 34 5 125 3 lexA LexA repressor Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
B0U1K7 3.08e-05 46 25 6 187 3 lexA LexA repressor Xylella fastidiosa (strain M12)
Q0A9N9 3.41e-05 46 30 4 129 3 lexA LexA repressor Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
A1WSJ3 4.66e-05 46 32 4 128 3 lexA LexA repressor Verminephrobacter eiseniae (strain EF01-2)
Q87F45 4.74e-05 46 29 4 132 3 lexA LexA repressor Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I679 4.74e-05 46 29 4 132 3 lexA LexA repressor Xylella fastidiosa (strain M23)
B5EJ91 5.18e-05 45 32 6 137 3 lexA LexA repressor Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7JBX0 5.18e-05 45 32 6 137 3 lexA LexA repressor Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A8F429 5.48e-05 45 32 5 130 3 lexA LexA repressor Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q3A3S5 6.31e-05 45 37 6 129 3 lexA LexA repressor Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q314F2 6.56e-05 45 33 5 130 3 lexA LexA repressor Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
C3LPT4 8.61e-05 45 31 4 129 3 lexA LexA repressor Vibrio cholerae serotype O1 (strain M66-2)
Q9KVP9 8.61e-05 45 31 4 129 3 lexA LexA repressor Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4F6 8.61e-05 45 31 4 129 3 lexA LexA repressor Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
B2UAG1 9.85e-05 45 33 5 120 3 lexA LexA repressor Ralstonia pickettii (strain 12J)
P0DOW5 9.89e-05 45 32 6 128 1 lexA LexA repressor Verrucomicrobium spinosum (strain ATCC 43997 / DSM 4136 / JCM 18804 / IFAM 1439)
A3Q951 0.000121 45 33 5 120 3 lexA LexA repressor Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A5GAQ4 0.000126 44 28 4 133 3 lexA LexA repressor Geotalea uraniireducens (strain Rf4)
P0A275 0.00015 43 34 4 98 3 mucA Protein MucA Salmonella typhimurium
P0A276 0.00015 43 34 4 98 3 mucA Protein MucA Escherichia coli
A5UQF5 0.00016 44 27 5 137 3 lexA LexA repressor Roseiflexus sp. (strain RS-1)
Q8PN77 0.000161 44 32 3 119 3 lexA1 LexA repressor 1 Xanthomonas axonopodis pv. citri (strain 306)
P57917 0.000167 44 30 4 132 3 lexA LexA repressor Pasteurella multocida (strain Pm70)
P59479 0.000182 44 34 3 114 3 lexA2 LexA repressor 2 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7W0T5 0.000184 44 34 5 119 3 lexA LexA repressor Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q8XZU1 0.000195 44 33 5 120 3 lexA LexA repressor Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q5QUP5 0.000196 44 31 3 114 3 lexA LexA repressor Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A9B5H8 0.000212 44 26 4 150 3 lexA LexA repressor Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q5GX75 0.000258 43 32 3 119 3 lexA1 LexA repressor 1 Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q9PH24 0.000293 43 30 3 117 3 lexA LexA repressor Xylella fastidiosa (strain 9a5c)
C1DQZ4 0.000346 43 30 5 120 3 lexA LexA repressor Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q9KAD3 0.000372 43 31 4 119 3 lexA LexA repressor Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q9AGM5 0.000505 43 31 5 124 3 lexA LexA repressor Cupriavidus necator
Q1LLW6 0.000505 43 31 5 124 3 lexA LexA repressor Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q0K9E3 0.000648 42 32 5 128 3 lexA LexA repressor Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9BWH9 0.000648 43 32 3 113 3 lexA LexA repressor Delftia acidovorans (strain DSM 14801 / SPH-1)
B3R2P9 0.000654 42 32 5 128 3 lexA LexA repressor Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q46ZR1 0.000779 42 32 7 128 3 lexA LexA repressor Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O32506 0.000802 42 27 3 115 3 lexA LexA repressor Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B6IST2 0.001 42 32 3 101 3 lexA LexA repressor Rhodospirillum centenum (strain ATCC 51521 / SW)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_15840
Feature type CDS
Gene lexA
Product LexA family transcriptional regulator
Location 26028 - 26660 (strand: 1)
Length 633 (nucleotides) / 210 (amino acids)

Contig

Accession ZDB_532
Length 116685 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_3068
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF00717 Peptidase S24-like
PF01381 Helix-turn-helix

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1974 Transcription (K)
Signal transduction mechanisms (T)		 KT SOS-response transcriptional repressor LexA (RecA-mediated autopeptidase)

Protein Sequence

MDTVGSRIKRLRSLTKTTQNDLGKYCGVSGVAVGYWEKDLNLPNGDALIKLAQFFNTSEAYILHGISSKQADSVVTTMQRLPVISYVQAGKFTESIPSEIYDEATEYLETSIKVSPNSFALIVQGDSMTNPTGTPSIPEGVMVIVDPSAEATHGKIVVARLNGTNDVTIKKLVIDGPNRFLSPLNPRYPNIAINGNCEIVGVVKGVQYEL

Flanking regions ( +/- flanking 50bp)

TATCAACAAAAACTAAGATAACTTAGCTTTTAACTAACTCTGGGATTCACATGGATACTGTAGGAAGCAGGATTAAGCGGCTTCGAAGCCTGACAAAGACGACTCAAAATGACCTGGGAAAGTATTGCGGTGTGTCTGGTGTTGCTGTTGGGTATTGGGAGAAAGATCTAAACCTACCAAATGGTGACGCCCTGATTAAATTAGCTCAGTTTTTTAACACCTCTGAGGCCTATATTTTACATGGTATTTCCTCAAAACAAGCTGATAGCGTTGTTACTACAATGCAGCGATTGCCGGTAATTTCCTATGTACAGGCAGGTAAATTCACAGAAAGTATCCCTTCTGAAATATATGATGAAGCTACCGAATATTTAGAGACTTCCATTAAAGTGTCTCCGAATAGTTTTGCGCTTATAGTTCAGGGTGATTCCATGACAAACCCAACTGGAACGCCCTCCATTCCGGAAGGAGTTATGGTTATTGTCGATCCGTCTGCAGAAGCCACCCACGGCAAAATAGTTGTTGCCAGACTAAACGGGACTAATGACGTTACCATTAAAAAATTGGTTATAGATGGCCCCAATAGATTTTTGTCCCCACTGAATCCTCGTTATCCGAATATTGCAATTAACGGCAACTGCGAAATTGTTGGCGTTGTCAAAGGCGTACAGTACGAACTCTAATCCTTTCAGCATGCAAATCTAATAATTCTTAGATTTGTGTTGACATAAAA