Homologs in group_786

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03640 FBDBKF_03640 100.0 Morganella morganii S1 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
EHELCC_06895 EHELCC_06895 100.0 Morganella morganii S2 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
LHKJJB_06755 LHKJJB_06755 100.0 Morganella morganii S3 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
HKOGLL_04175 HKOGLL_04175 100.0 Morganella morganii S5 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
F4V73_RS11225 F4V73_RS11225 94.6 Morganella psychrotolerans - sigma 54-interacting transcriptional regulator
PMI_RS17810 PMI_RS17810 70.9 Proteus mirabilis HI4320 - sigma 54-interacting transcriptional regulator

Distribution of the homologs in the orthogroup group_786

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_786

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P71229 0.0 586 56 9 539 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P19323 0.0 550 57 7 529 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
E1WAA4 0.0 543 57 7 519 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P0CL46 0.0 542 57 8 522 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P12626 1.76e-90 290 42 9 408 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q9APD9 3.21e-86 276 45 3 346 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q06065 3.43e-86 276 45 4 348 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
O87455 7.93e-86 278 39 8 460 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
P14375 6.3e-85 273 47 6 315 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P09570 7.92e-84 272 42 7 379 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
Q8X613 9.79e-84 270 45 5 339 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
P25852 9.89e-84 270 47 3 315 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26047 3.11e-83 274 45 4 331 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
P12627 1.58e-82 269 42 5 381 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
Q53206 2.15e-82 271 55 1 237 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8Z333 2.85e-82 266 46 3 315 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P54930 2.09e-81 266 46 4 327 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P27713 2.03e-80 264 45 2 317 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
A6TCX4 3.62e-80 263 42 4 363 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
P03027 4.59e-80 263 46 5 324 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
P56266 6.72e-80 262 46 5 324 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
B5XVA2 3.42e-79 260 42 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
P05407 8.05e-79 261 55 1 237 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
A4WDR5 1.6e-78 258 37 6 443 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
P24426 2.35e-78 253 50 1 242 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
Q7MFY9 6.89e-78 256 35 7 448 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P09828 2.47e-77 255 38 8 415 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
A4STH5 2.52e-77 255 48 2 274 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
Q8D4F9 7.21e-77 254 35 7 448 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
P10577 1.75e-76 252 43 6 343 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
A0KEJ0 1.83e-76 253 51 1 251 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
G3XCV0 1.86e-76 252 43 5 346 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54931 4.29e-76 254 51 1 245 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9I4N3 5.42e-76 250 51 1 248 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54929 6.29e-76 254 55 1 236 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 1.53e-75 253 55 1 236 1 nifA Nif-specific regulatory protein Azospirillum brasilense
C0PWN2 7.58e-75 248 40 4 367 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5F363 8.25e-75 248 40 4 367 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
B5FSZ0 9.46e-75 248 39 5 384 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
Q3K999 1.39e-74 243 47 2 268 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
P54529 1.74e-74 252 53 1 236 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
Q5E3W8 2.96e-74 247 39 5 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q6D8R9 3e-74 247 40 3 356 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P0AFB8 3.06e-74 246 38 9 443 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 3.06e-74 246 38 9 443 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
P28787 3.26e-74 246 41 4 342 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
A8GG93 3.41e-74 247 48 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
B4T3B0 5.88e-74 246 51 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
Q8Z4C6 6.67e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 6.67e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 6.67e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 6.67e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
Q8ZMJ8 7.41e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 7.41e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q5PF20 7.41e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TF23 8.77e-74 246 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
B5RDG4 9.35e-74 246 51 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
P41789 1.01e-73 244 37 9 446 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A9MFX7 1.26e-73 245 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
P0AFU5 2.37e-73 243 49 2 267 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 2.37e-73 243 49 2 267 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
P45671 4.37e-73 243 42 5 340 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
A8ANR6 4.41e-73 244 51 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
B7LW25 8.86e-73 243 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B6I695 1.17e-72 243 51 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
P09133 1.26e-72 245 40 5 355 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P03029 1.27e-72 241 42 5 341 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
P23747 1.38e-72 241 50 0 235 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A7ZQD8 1.82e-72 242 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NSI9 2.1e-72 242 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
Q1R7Z1 2.98e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 2.98e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 2.98e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
P37013 3.01e-72 241 50 0 237 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 3.01e-72 241 50 0 237 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 3.01e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B7LEC0 3.31e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
B7MZ04 3.42e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q8FEN6 4.09e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B7N6T9 4.45e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TEH1 4.59e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7UHC1 4.69e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q31X73 5.1e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
B7M9E6 5.1e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q3YYF5 5.21e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
Q9K4U8 5.34e-72 241 40 4 365 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B5Z370 5.72e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 5.72e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
B1IUX0 5.97e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q32CL9 6.78e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
A8A3I6 6.78e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
P59402 6.99e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 6.99e-72 241 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
B1LQ27 8.37e-72 240 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
Q43965 1.36e-71 241 39 5 354 1 mopR Phenol regulator MopR Acinetobacter guillouiae
O31551 3.68e-71 241 41 7 341 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P06519 5.27e-71 240 42 5 303 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
Q845S7 5.34e-71 234 48 0 239 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
Q04848 2.32e-70 236 40 6 364 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q46802 2.69e-70 239 51 1 231 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
P17899 2.73e-70 235 48 0 234 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P0CY94 4.17e-70 238 43 5 312 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
D5ARW9 4.98e-70 238 43 5 312 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O85057 5.4e-70 237 43 6 324 1 None Limonene hydroxylase Geobacillus stearothermophilus
Q9HU19 5.48e-70 234 41 4 324 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q88RJ6 6.27e-70 234 44 4 305 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q00934 9.2e-69 231 41 5 322 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P29267 7.01e-68 229 43 3 311 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q88AQ2 8.19e-68 228 51 0 227 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q9K4V0 3.15e-67 229 41 7 367 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P03028 1.14e-66 228 50 1 238 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
Q01265 2.13e-66 220 46 2 241 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P0C5S5 9.44e-66 223 41 3 292 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 9.44e-66 223 41 3 292 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q87MX7 9.64e-66 223 41 3 292 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KT84 1.06e-65 223 37 3 331 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q7MM78 2.53e-65 222 43 0 248 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 2.53e-65 222 43 0 248 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
O25408 4.28e-65 219 48 0 228 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P10576 2.44e-64 220 40 6 346 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P31908 2.48e-64 220 42 4 322 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P37344 4.18e-64 215 48 1 230 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P38022 8.87e-64 218 40 9 347 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
P13632 1.42e-63 218 38 3 348 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q9KN48 1.77e-61 214 36 5 375 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10046 1.28e-60 209 38 4 342 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P77743 1.81e-58 206 38 7 333 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P74839 7.24e-55 196 38 11 344 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P36219 1.28e-54 190 44 2 236 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
Q9ZIB7 6.36e-53 191 34 6 348 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P37931 4.04e-52 182 48 4 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P0A2D7 6.69e-52 187 32 4 381 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 6.69e-52 187 32 4 381 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P07604 1.61e-51 186 33 6 351 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
O54426 1.78e-51 186 33 4 353 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P26316 5.05e-50 177 46 4 208 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
Q04849 2.91e-49 179 40 2 255 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P44694 3.16e-49 175 34 4 327 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P37930 1.66e-48 173 45 1 202 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
P28614 5.4e-48 180 34 9 362 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q68WH4 3.6e-40 155 33 4 258 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q9ZCY9 8.56e-40 154 34 4 258 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q1RJS1 2.71e-39 152 33 4 259 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q4UL27 1.16e-38 150 33 4 258 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P45512 4.65e-36 145 33 6 295 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P26408 9.69e-36 142 32 5 317 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P76016 4.23e-35 142 32 6 301 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
P38035 1.26e-33 137 32 8 300 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
Q92HC2 1.6e-32 133 32 5 259 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P09432 4.15e-27 117 33 6 231 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P55610 2.66e-25 113 28 8 336 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P54156 7.34e-24 105 32 7 230 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
D0ZLR9 8.76e-14 78 29 10 238 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P06184 4e-13 74 24 7 322 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23914 1.73e-12 73 31 7 211 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
P56269 9.7e-06 48 30 4 139 3 nifA Nif-specific regulatory protein (Fragment) Azotobacter chroococcum mcd 1
A0QTU7 3.42e-05 50 26 5 153 4 mimR Propane 2-monooxygenase operon transcriptional activator MimR Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)
G3XGC1 0.001 45 26 5 153 4 mimR Propane 2-monooxygenase operon transcriptional activator MimR Mycolicibacterium goodii

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_07220
Feature type CDS
Gene fhlA
Product FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
Location 114381 - 115988 (strand: -1)
Length 1608 (nucleotides) / 535 (amino acids)

Contig

Accession ZDB_522
Length 269640 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_786
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF01590 GAF domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15836 formate hydrogenlyase transcriptional activator - -

Protein Sequence

MDNTDKTEHIRHERDQYRILVDITNSVLSHLEMDGLVAEVSREIHRFFGLSQISIALCDNYSSAVYLCYSSYYQARKPAEKTLYHLDELHPDLAQVLDSNQPMRLTLDSATEDPLYQHVCAQGMTETLLLPLAFNHKPLGVLILSHENNHIFTDDNCNLLKQIAARFAIAVDNAAAYEEITRLKDSLKHENLWLNEQIHNNESFSEIIFQSDAMRNILEQVDLVAASDSTVLILGETGTGKELIARAIHRLSDRHHRSMIKMNCAAIPSGLLESDLFGHDKGAFTGATTTHIGRFEMADKSTLFLDEIGDMPLDLQPKLLRVLQEREIERIGGNKVIPVDVRLIAATNRNLKSMTDEREFREDLYYRLNVFPIWIPPLRERPEDIPLLATYFTQKIARRMNRNIDCIPRDALEQLSRYPWPGNVRELENVIERAVILTRGNTLNIQLHELNIPKHSRLKTALETPSSLEKRMQTAAPENDDEERDRIIAALKATNGVVAGARGAATRLGLKRTTLLSRMQRLGISVQDIFEEDNH

Flanking regions ( +/- flanking 50bp)

GCAATCCGTCCGGATCAGGAATGTGAAAGACGAAGACGAGCGGAGACGTTGTGGACAACACTGACAAGACCGAACACATACGCCATGAACGTGACCAGTACCGGATATTGGTAGATATCACCAACTCAGTGCTTTCCCATCTGGAGATGGACGGCCTGGTTGCTGAGGTCTCCCGCGAGATCCACCGGTTTTTCGGGCTGAGCCAGATAAGCATTGCATTGTGTGATAATTACAGTTCTGCTGTATATCTTTGTTATTCCAGCTATTACCAGGCCCGCAAACCCGCAGAAAAGACATTATATCATCTGGATGAACTGCATCCTGATCTGGCACAGGTTCTGGACAGTAACCAGCCGATGCGCCTGACACTCGACAGTGCCACAGAGGATCCGCTGTATCAGCATGTCTGTGCGCAGGGCATGACAGAAACCCTGCTGCTGCCGCTGGCATTTAACCATAAGCCGCTGGGCGTTCTGATATTATCTCATGAAAATAATCATATTTTTACTGACGATAACTGTAATCTGCTCAAGCAGATAGCCGCCCGGTTTGCCATTGCGGTGGATAATGCTGCAGCCTATGAAGAGATCACCCGGCTGAAAGACAGCCTCAAGCATGAAAACCTGTGGCTGAACGAACAGATTCACAACAACGAAAGTTTCAGTGAAATCATTTTCCAGAGTGATGCCATGCGCAACATTCTGGAGCAGGTGGATCTGGTTGCCGCCAGTGACAGCACCGTGCTTATCCTCGGCGAAACCGGCACCGGGAAGGAGCTGATCGCCCGCGCCATCCACCGTCTGAGTGACCGCCATCACCGCAGCATGATCAAAATGAACTGCGCGGCCATCCCGTCCGGGCTGCTGGAAAGCGACCTGTTCGGCCATGACAAAGGCGCCTTCACCGGCGCGACCACCACTCATATCGGCCGCTTTGAAATGGCGGATAAAAGCACCCTGTTTCTTGATGAAATCGGCGATATGCCGCTGGATCTCCAGCCCAAACTGCTGCGGGTGTTACAGGAGCGGGAAATTGAGCGCATCGGCGGTAATAAGGTGATTCCGGTGGATGTGCGGCTGATTGCCGCCACCAACCGCAACCTGAAATCCATGACCGATGAGCGCGAGTTCCGCGAAGATCTCTACTACCGGCTGAATGTGTTCCCTATCTGGATCCCGCCGCTGCGCGAACGTCCGGAGGATATTCCGCTGCTGGCGACCTACTTCACACAGAAGATTGCCCGCCGGATGAACCGCAATATCGACTGCATTCCGCGTGATGCCCTGGAGCAGCTGAGCCGCTATCCGTGGCCCGGCAACGTGCGTGAACTGGAAAATGTGATTGAACGGGCGGTGATCCTGACGCGCGGGAATACCCTTAACATTCAGTTACATGAACTGAATATCCCAAAGCATTCACGCCTGAAAACGGCGCTGGAGACCCCGAGCTCACTGGAAAAACGGATGCAGACAGCCGCACCGGAGAATGATGACGAAGAGCGCGACCGGATTATTGCTGCCCTGAAGGCCACCAACGGCGTTGTTGCCGGTGCCCGGGGTGCCGCAACCCGTCTGGGACTGAAACGGACAACATTATTATCCCGTATGCAGCGGTTAGGTATTTCTGTACAGGATATATTCGAAGAAGATAATCACTAAGCTGATATTTAAACTGCCGCCACTGAAATAAGAATGTCTCGCAAATAAAA