Homologs in group_786

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03640 FBDBKF_03640 94.6 Morganella morganii S1 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
EHELCC_06895 EHELCC_06895 94.6 Morganella morganii S2 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
NLDBIP_07220 NLDBIP_07220 94.6 Morganella morganii S4 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
LHKJJB_06755 LHKJJB_06755 94.6 Morganella morganii S3 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
HKOGLL_04175 HKOGLL_04175 94.6 Morganella morganii S5 fhlA FhlA-type transcriptional regulator, contains GAF, AAA-type ATPase, and DNA-binding Fis domains
PMI_RS17810 PMI_RS17810 70.2 Proteus mirabilis HI4320 - sigma 54-interacting transcriptional regulator

Distribution of the homologs in the orthogroup group_786

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_786

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P71229 0.0 586 56 6 535 1 hyfR DNA-binding transcriptional activator HyfR Escherichia coli (strain K12)
P19323 0.0 541 56 7 530 1 fhlA Formate hydrogenlyase transcriptional activator FhlA Escherichia coli (strain K12)
E1WAA4 0.0 537 56 9 531 3 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain SL1344)
P0CL46 0.0 537 55 9 534 1 fhlA Formate hydrogenlyase transcriptional activator Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P12626 4.63e-87 281 44 5 347 4 anfA Nitrogen fixation protein AnfA Azotobacter vinelandii
Q9APD9 1.34e-85 275 44 3 346 3 zraR Transcriptional regulatory protein ZraR Klebsiella oxytoca
Q06065 3.05e-84 272 45 4 349 1 atoC Regulatory protein AtoC Escherichia coli (strain K12)
P14375 5.6e-84 271 47 6 315 1 zraR Transcriptional regulatory protein ZraR Escherichia coli (strain K12)
P25852 2.19e-83 269 47 4 315 1 zraR Transcriptional regulatory protein ZraR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P26047 2.93e-83 274 43 6 369 4 stc Signal-transduction and transcriptional-control protein Clostridium beijerinckii
Q8X613 3.22e-83 269 44 4 339 3 zraR Transcriptional regulatory protein ZraR Escherichia coli O157:H7
O87455 5.55e-82 268 38 8 460 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8Z333 8.39e-82 265 46 4 315 3 zraR Transcriptional regulatory protein ZraR Salmonella typhi
P09570 1.46e-81 267 41 8 381 4 nifA Nif-specific regulatory protein Azotobacter vinelandii
P12627 3.56e-81 266 43 4 346 1 vnfA Nitrogen fixation protein VnfA Azotobacter vinelandii
P54930 4.96e-79 260 45 3 327 4 nifA Nif-specific regulatory protein Enterobacter agglomerans
P27713 6.15e-79 260 44 2 317 4 nifA Nif-specific regulatory protein Herbaspirillum seropedicae
Q53206 7.19e-79 262 52 1 237 4 nifA Nif-specific regulatory protein Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P05407 2.44e-78 260 54 1 237 1 nifA Nif-specific regulatory protein Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P56266 5e-78 258 45 5 324 3 nifA Nif-specific regulatory protein Klebsiella oxytoca
P03027 5.8e-78 257 45 5 324 1 nifA Nif-specific regulatory protein Klebsiella pneumoniae
A6TCX4 3.38e-77 255 41 4 363 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
G3XCV0 1.04e-76 253 44 8 350 1 fleQ Transcriptional regulator FleQ Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P24426 1.5e-76 248 48 1 239 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum bv. trifolii
A4WDR5 2.29e-76 253 37 6 443 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Enterobacter sp. (strain 638)
B5XVA2 2.74e-76 253 40 4 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Klebsiella pneumoniae (strain 342)
Q3K999 1.17e-75 246 43 4 323 3 sfnR Sigma54-dependent transcriptional regulator SfnR Pseudomonas fluorescens (strain Pf0-1)
A0KEJ0 1.75e-75 250 50 1 251 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9I4N3 3.3e-75 249 42 5 351 1 fleR Response regulator protein FleR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
A4STH5 3.46e-75 249 48 3 264 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aeromonas salmonicida (strain A449)
P54931 5.06e-75 251 49 1 245 4 nifA Nif-specific regulatory protein Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q5E3W8 7.41e-75 249 40 6 365 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Aliivibrio fischeri (strain ATCC 700601 / ES114)
P09828 8.1e-75 249 37 7 415 4 nifA Nif-specific regulatory protein Rhizobium leguminosarum
P10577 1.12e-74 248 42 5 343 1 ntrC DNA-binding transcriptional regulator NtrC Rhizobium meliloti (strain 1021)
Q7MFY9 1.69e-74 248 35 7 448 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain YJ016)
P28787 4.3e-74 246 41 4 343 3 ntrC DNA-binding transcriptional regulator NtrC Proteus hauseri
P54929 8.67e-74 249 55 1 236 4 nifA Nif-specific regulatory protein Azospirillum lipoferum
P30667 1.14e-73 249 48 3 282 1 nifA Nif-specific regulatory protein Azospirillum brasilense
Q8D4F9 1.85e-73 245 35 7 448 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Vibrio vulnificus (strain CMCP6)
Q6D8R9 3.29e-73 244 49 0 240 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A8GG93 4.83e-73 244 49 0 245 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Serratia proteamaculans (strain 568)
C0PWN2 8.95e-73 243 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi C (strain RKS4594)
B5FSZ0 9.53e-73 243 47 1 254 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella dublin (strain CT_02021853)
B5F363 1.28e-72 243 50 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella agona (strain SL483)
Q9K4U8 1.47e-72 243 40 5 365 2 norR2 Nitric oxide reductase transcription regulator NorR2 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P0AFU5 2.01e-72 241 45 3 312 1 qseF Transcriptional regulatory protein QseF Escherichia coli O157:H7
P0AFU4 2.01e-72 241 45 3 312 1 glrR Transcriptional regulatory protein GlrR Escherichia coli (strain K12)
B4T3B0 6.69e-72 241 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella newport (strain SL254)
B4TF23 8.61e-72 241 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella heidelberg (strain SL476)
P0AFB8 8.93e-72 239 36 8 443 1 glnG DNA-binding transcriptional regulator NtrC Escherichia coli (strain K12)
P0AFB9 8.93e-72 239 36 8 443 3 glnG DNA-binding transcriptional regulator NtrC Escherichia coli O157:H7
Q8Z4C6 9.27e-72 241 50 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhi
A9N0D7 9.27e-72 241 50 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5QV88 9.27e-72 241 50 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella enteritidis PT4 (strain P125109)
Q57KT4 9.27e-72 241 50 0 235 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella choleraesuis (strain SC-B67)
B5RDG4 9.46e-72 241 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8ZMJ8 1.1e-71 240 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TT16 1.1e-71 240 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella schwarzengrund (strain CVM19633)
Q5PF20 1.13e-71 240 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
P09133 1.17e-71 243 40 6 355 2 nifA Nif-specific regulatory protein Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A9MFX7 1.65e-71 240 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q845S7 1.87e-71 236 47 3 260 2 sfnR Sigma54-dependent transcriptional activator SfnR Pseudomonas putida
O85057 3.25e-71 240 43 6 324 1 None Limonene hydroxylase Geobacillus stearothermophilus
P54529 3.85e-71 244 51 1 236 4 yqiR Putative sigma L-dependent transcriptional regulator YqiR Bacillus subtilis (strain 168)
P41789 4.26e-71 238 37 10 439 1 glnG DNA-binding transcriptional regulator NtrC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
A8ANR6 4.63e-71 239 49 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
O31551 2.91e-70 239 41 7 340 2 acoR Acetoin dehydrogenase operon transcriptional activator AcoR Bacillus subtilis (strain 168)
P45671 3.57e-70 236 41 5 340 3 ntrC DNA-binding transcriptional regulator NtrC Azospirillum brasilense
B7LW25 3.65e-70 236 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
P06519 3.93e-70 238 43 6 329 4 xylR Transcriptional regulatory protein XylR Pseudomonas putida
P17899 4.46e-70 235 48 0 234 4 flbD Transcriptional regulatory protein FlbD Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B6I695 4.6e-70 236 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SE11)
A7ZQD8 5e-70 236 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O139:H28 (strain E24377A / ETEC)
P03029 7.8e-70 234 42 5 338 1 ntrC DNA-binding transcriptional regulator NtrC Klebsiella pneumoniae
B7NSI9 9.1e-70 235 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P37013 1.01e-69 235 46 1 256 1 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12)
B1XCN6 1.01e-69 235 46 1 256 2 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / DH10B)
C4ZYV4 1.01e-69 235 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain K12 / MC4100 / BW2952)
B7LEC0 1.2e-69 235 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain 55989 / EAEC)
Q1R7Z1 1.33e-69 235 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain UTI89 / UPEC)
A1AEP9 1.33e-69 235 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O1:K1 / APEC
B7MKH8 1.33e-69 235 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O45:K1 (strain S88 / ExPEC)
B7MZ04 1.56e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O81 (strain ED1a)
Q3YYF5 1.67e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella sonnei (strain Ss046)
Q31X73 1.71e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella boydii serotype 4 (strain Sb227)
Q0TEH1 1.75e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A8A3I6 1.84e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O9:H4 (strain HS)
P23747 1.86e-69 233 48 0 235 1 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7M9E6 1.98e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O8 (strain IAI1)
Q8FEN6 2e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
B1IUX0 2.09e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7UHC1 2.18e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P59402 2.25e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri
Q0T1D4 2.25e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella flexneri serotype 5b (strain 8401)
Q32CL9 2.37e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Shigella dysenteriae serotype 1 (strain Sd197)
B5Z370 2.37e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X854 2.37e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O157:H7
B1LQ27 3.21e-69 234 46 1 256 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli (strain SMS-3-5 / SECEC)
B7N6T9 3.49e-69 234 48 0 237 3 norR Anaerobic nitric oxide reductase transcription regulator NorR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q00934 1.07e-68 231 41 5 322 1 pilR Response regulator protein PilR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q04848 1.31e-68 231 47 3 256 3 ntrC DNA-binding transcriptional regulator NtrC Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q43965 1.46e-68 234 41 5 321 1 mopR Phenol regulator MopR Acinetobacter guillouiae
Q46802 3.87e-68 233 50 1 231 4 uacR Putative uric acid sigma-54-dependent transcriptional regulator UacR Escherichia coli (strain K12)
Q9HU19 6.77e-68 229 41 6 327 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P29267 7.97e-68 229 43 4 313 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q88RJ6 1.34e-67 228 49 0 227 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
D5ARW9 4.45e-67 230 42 5 312 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P0CY94 4.94e-67 230 42 5 312 4 nifA1 Nif-specific regulatory protein Rhodobacter capsulatus
Q9K4V0 6.7e-67 228 40 8 367 2 norR1 Nitric oxide reductase transcription regulator NorR1 Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P31908 1.3e-66 226 42 4 322 3 hoxA Hydrogenase transcriptional regulatory protein HoxA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q88AQ2 2.03e-66 225 50 0 227 3 algB Alginate biosynthesis transcriptional regulatory protein AlgB Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q01265 9.04e-66 218 46 2 241 4 None Uncharacterized protein in HyuA 5'region (Fragment) Pseudomonas sp. (strain NS671)
P03028 9.79e-66 226 49 1 237 4 nifA Nif-specific regulatory protein Rhizobium meliloti (strain 1021)
P0C5S5 3.44e-64 219 40 3 292 3 luxO Luminescence regulatory protein LuxO Vibrio harveyi
A7MVC2 3.44e-64 219 40 3 292 1 luxO Luminescence regulatory protein LuxO Vibrio campbellii (strain ATCC BAA-1116)
Q9KT84 6.23e-64 218 37 3 331 1 luxO Regulatory protein LuxO Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87MX7 7.78e-64 218 38 3 301 3 luxO Regulatory protein LuxO Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P13632 9.24e-64 218 38 3 348 1 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium meliloti (strain 1021)
Q7MM78 2.65e-63 217 42 0 248 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain YJ016)
Q8CWJ5 2.65e-63 217 42 0 248 3 luxO Regulatory protein LuxO Vibrio vulnificus (strain CMCP6)
O25408 3.98e-63 214 47 0 228 1 flgR Transcriptional regulatory protein FlgR Helicobacter pylori (strain ATCC 700392 / 26695)
P10576 4.58e-63 217 44 2 257 3 ntrC DNA-binding transcriptional regulator NtrC Bradyrhizobium sp. (strain RP501 Parasponia)
P37344 4e-62 210 46 2 232 1 pspF Psp operon transcriptional activator Escherichia coli (strain K12)
P38022 5.06e-61 211 38 7 362 1 rocR Transcriptional activator RocR Bacillus subtilis (strain 168)
Q9KN48 7.98e-61 212 47 0 236 4 vasH Transcriptional regulator VasH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P10046 1.68e-60 209 38 3 342 3 dctD C4-dicarboxylate transport transcriptional regulatory protein DctD Rhizobium leguminosarum
P77743 5.53e-60 210 39 8 333 1 prpR Propionate catabolism operon regulatory protein Escherichia coli (strain K12)
P74839 7.51e-55 196 38 10 341 4 prpR Propionate catabolism operon regulatory protein Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9ZIB7 2.34e-54 194 34 5 353 1 tyrR HTH-type transcriptional regulatory protein TyrR Enterobacter agglomerans
P36219 1.31e-53 187 44 2 234 4 wtsA Pathogenicity locus probable regulatory protein WtsA Pantoea stewartii subsp. stewartii
O54426 2.3e-52 189 34 6 360 3 tyrR HTH-type transcriptional regulatory protein TyrR Citrobacter braakii
P0A2D7 2.76e-52 189 33 6 359 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2D8 2.76e-52 189 33 6 359 3 tyrR HTH-type transcriptional regulatory protein TyrR Salmonella typhi
P07604 2.94e-52 189 33 6 359 1 tyrR HTH-type transcriptional regulatory protein TyrR Escherichia coli (strain K12)
P37931 1.43e-51 181 46 1 206 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas syringae pv. syringae
P28614 7.18e-51 188 32 9 397 1 acoR Acetoin catabolism regulatory protein Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P44694 1.28e-49 176 34 3 327 1 tyrR HTH-type transcriptional regulatory protein TyrR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q04849 1.92e-49 180 40 2 255 3 ntrX Nitrogen assimilation regulatory protein NtrX Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
P26316 6.77e-49 174 45 3 207 4 hrpS Pathogenicity locus probable regulatory protein HrpS Pseudomonas savastanoi pv. phaseolicola
P37930 3.14e-48 172 45 1 202 4 hrpR Pathogenicity locus probable regulatory protein HrpR Pseudomonas syringae pv. syringae
Q68WH4 4.83e-39 152 32 4 258 3 RT0550 Putative response regulator NtrX-like Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q1RJS1 1.01e-38 151 32 4 259 3 RBE_0312 Putative response regulator NtrX-like Rickettsia bellii (strain RML369-C)
Q9ZCY9 1.1e-38 150 35 3 225 3 RP562 Putative response regulator NtrX-like Rickettsia prowazekii (strain Madrid E)
Q4UL27 3.94e-38 149 32 4 258 3 RF_0895 Putative response regulator NtrX-like Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P26408 8.31e-35 140 31 5 317 1 hupR1 Hydrogenase transcriptional regulatory protein HupR1 Rhodobacter capsulatus
P45512 1.18e-34 141 33 7 296 4 dhaR Glycerol metabolism operon regulatory protein Citrobacter freundii
P76016 7.89e-34 139 31 6 301 1 dhaR PTS-dependent dihydroxyacetone kinase operon regulatory protein Escherichia coli (strain K12)
Q92HC2 3.4e-32 132 32 5 259 3 RC0849 Putative response regulator NtrX-like Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P38035 4.75e-32 133 36 7 246 4 rtcR Transcriptional regulatory protein RtcR Escherichia coli (strain K12)
P55610 2.32e-27 119 29 8 336 4 NGR_a02110 Putative transcriptional regulatory protein y4pA Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P09432 1.83e-25 112 32 6 231 3 ntrC DNA-binding transcriptional regulator NtrC Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
P54156 7.65e-23 103 31 6 230 2 yplP Putative sigma L-dependent transcriptional regulator YplP Bacillus subtilis (strain 168)
D0ZLR9 2.41e-13 76 29 10 238 2 dgaR Transcriptional regulatory protein DagR Salmonella typhimurium (strain 14028s / SGSC 2262)
P06184 4.18e-13 74 24 7 322 3 pgtA Phosphoglycerate transport system transcriptional regulatory protein PgtA Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P23914 9.78e-12 71 30 6 211 3 levR Transcriptional regulatory protein LevR Bacillus subtilis (strain 168)
A0QTU7 0.00015 48 20 10 330 4 mimR Propane 2-monooxygenase operon transcriptional activator MimR Mycolicibacterium smegmatis (strain ATCC 700084 / mc(2)155)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS11225
Feature type CDS
Gene -
Product sigma 54-interacting transcriptional regulator
Location 386033 - 387670 (strand: -1)
Length 1638 (nucleotides) / 545 (amino acids)

Contig

Accession term accessions NZ_VXKB01000002 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 573139 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_786
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00158 Sigma-54 interaction domain
PF01590 GAF domain
PF02954 Bacterial regulatory protein, Fis family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG3829 Transcription (K)
Signal transduction mechanisms (T)		 KT RocR-type transcriptional regulator, contains PAS, AAA-type ATPase, and DNA-binding Fis domains

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K15836 formate hydrogenlyase transcriptional activator - -

Protein Sequence

MMKTKTSGDVVDNTEKTEHIRHERDQYRILVDITNSVLSHLEMDGLVAEVSREIHRFFGLSQISIALCDNYSSAVYLCYSSYYQRSKPVEKTLYHLNELHPDLAQVLDSNQPMRLTLNSGTQDPLYQHVCAQGMSETLLLPLAFNHKPLGVLVLSHENNTVFTDDSCNLLKQIAARFAIAVDNAAAYGEITRLKDSLKHENLWLNEQIHNNESFSEIIFQSDAMRNILEQVDLVANSDSTVLILGETGTGKELIARAIHRLSARHHRSMIKMNCAAIPSGLLESDLFGHDKGAFTGAATTHIGRFEMADKSTLFLDEIGDMPLDLQPKLLRVLQEREIERIGGNKVIPVDVRLIAATNRNLKSMTDDREFREDLYYRLNVFPIWIPPLRDRPEDIPLLATWFTQKIAQRMNRKIDCIPRDSLEKLARYPWPGNVRELENVIERAVILTRGNTLNIQLHELNIPKLSRLKTALETPSSLEKRMQTTAPENDDEERDRIIDALKATNGVVAGARGAATRLGLKRTTLLSRMQRLGISVQDIFEEDNH

Flanking regions ( +/- flanking 50bp)

AAAACTATTCAGAGCAGGATTATTTTTAAGAGCAAACCGTCGGATCAGGAATGATGAAGACGAAGACGAGCGGAGACGTTGTGGACAATACTGAAAAGACCGAACACATACGCCATGAACGTGACCAGTACAGAATATTGGTTGATATCACAAATTCTGTCCTGTCCCATCTGGAGATGGATGGATTAGTTGCTGAAGTATCGCGTGAAATTCACCGGTTTTTCGGACTGAGCCAGATAAGTATTGCACTGTGCGACAACTACAGTTCTGCTGTATACCTTTGTTATTCAAGCTATTACCAGCGTTCTAAGCCGGTTGAGAAAACACTGTATCATCTGAATGAACTGCATCCGGATCTGGCGCAGGTGCTTGACAGTAATCAGCCTATGCGCCTGACACTCAACAGCGGAACGCAAGATCCGCTGTATCAGCATGTCTGCGCCCAGGGAATGTCAGAAACACTGCTGCTGCCACTGGCCTTTAACCATAAACCACTTGGTGTTTTGGTGTTATCCCATGAAAACAATACTGTTTTCACGGATGACAGCTGTAATTTACTGAAACAAATTGCAGCCCGGTTTGCGATTGCTGTCGATAATGCGGCGGCTTACGGGGAAATTACCCGTCTGAAAGACAGCCTGAAACATGAAAATCTGTGGCTGAATGAACAGATTCATAATAATGAAAGCTTCAGTGAAATCATTTTCCAGAGTGATGCCATGCGCAACATTCTTGAGCAGGTGGACCTGGTTGCCAACAGTGACAGCACCGTGCTTATCCTCGGTGAAACCGGCACCGGGAAAGAACTTATCGCCCGGGCAATCCATCGCCTGAGCGCCCGCCATCACCGCAGTATGATTAAAATGAACTGTGCGGCCATCCCGTCAGGATTGCTGGAAAGCGACCTGTTCGGGCATGATAAAGGCGCGTTTACCGGAGCTGCCACAACCCATATCGGCCGCTTTGAAATGGCAGATAAAAGCACCCTGTTCCTGGATGAAATCGGTGATATGCCGTTAGATCTCCAGCCAAAATTGCTGCGGGTATTACAGGAGCGGGAGATTGAGCGGATCGGTGGTAATAAGGTTATCCCGGTCGATGTCCGGCTGATTGCCGCCACTAACCGTAACCTGAAATCCATGACGGACGACCGTGAGTTCCGTGAAGATCTCTACTATCGCCTGAATGTGTTCCCTATCTGGATCCCGCCGCTGCGCGACCGTCCGGAGGATATTCCGTTGCTGGCGACCTGGTTCACACAAAAAATTGCACAGCGGATGAACCGGAAAATTGACTGCATTCCCCGCGATTCACTGGAAAAACTGGCCCGTTATCCGTGGCCCGGTAATGTGCGCGAGCTGGAAAATGTGATTGAGCGGGCGGTTATCCTTACACGCGGTAACACACTGAATATTCAGCTGCATGAGCTTAATATCCCAAAGCTTTCCCGCCTGAAAACGGCGCTTGAAACACCAAGTTCACTGGAAAAACGGATGCAGACCACCGCACCGGAAAATGATGATGAAGAGCGGGACCGGATTATTGATGCACTGAAAGCCACCAATGGTGTGGTCGCCGGGGCGCGGGGAGCCGCAACGCGTCTGGGACTGAAACGCACCACGTTATTATCCCGCATGCAACGGTTAGGTATTTCCGTACAGGATATATTTGAAGAAGATAATCATTAATCTGATATTTGTTTTTATAATGATTTTTTAAATAAGAATGCGTCTCAAGA