Homologs in group_1254

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06910 FBDBKF_06910 100.0 Morganella morganii S1 hisH imidazole glycerol phosphate synthase subunit HisH
EHELCC_04060 EHELCC_04060 100.0 Morganella morganii S2 hisH imidazole glycerol phosphate synthase subunit HisH
LHKJJB_09890 LHKJJB_09890 100.0 Morganella morganii S3 hisH imidazole glycerol phosphate synthase subunit HisH
HKOGLL_09085 HKOGLL_09085 100.0 Morganella morganii S5 hisH imidazole glycerol phosphate synthase subunit HisH
F4V73_RS01095 F4V73_RS01095 86.9 Morganella psychrotolerans hisH imidazole glycerol phosphate synthase subunit HisH
PMI_RS03255 PMI_RS03255 61.5 Proteus mirabilis HI4320 hisH imidazole glycerol phosphate synthase subunit HisH

Distribution of the homologs in the orthogroup group_1254

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1254

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6D408 8.14e-87 256 62 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q66C52 1.7e-84 251 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZFX8 1.7e-84 251 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Yersinia pestis
Q83KJ5 6.44e-81 242 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella flexneri
Q3Z0G2 8.28e-81 241 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella sonnei (strain Ss046)
Q32EF2 8.28e-81 241 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella dysenteriae serotype 1 (strain Sd197)
Q323I9 8.28e-81 241 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella boydii serotype 4 (strain Sb227)
P60595 8.28e-81 241 60 1 196 1 hisH Imidazole glycerol phosphate synthase subunit HisH Escherichia coli (strain K12)
P60596 8.28e-81 241 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7N6I3 1.6e-80 241 57 1 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P58237 1.21e-79 238 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Escherichia coli O157:H7
Q5QWQ7 6.23e-79 237 57 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
P0A1R4 2.65e-77 233 58 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1R5 2.65e-77 233 58 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella typhi
Q5PDP6 2.65e-77 233 58 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57MS0 2.65e-77 233 58 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella choleraesuis (strain SC-B67)
Q9KSX0 8.38e-77 231 54 1 200 1 hisH Imidazole glycerol phosphate synthase subunit HisH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P44340 1.42e-76 231 55 0 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN71 2.14e-76 230 55 0 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Haemophilus influenzae (strain 86-028NP)
Q5E635 4.71e-76 229 53 1 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8D8Q3 1.89e-75 228 52 1 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Vibrio vulnificus (strain CMCP6)
Q7MLS3 1.89e-75 228 52 1 200 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Vibrio vulnificus (strain YJ016)
P57921 2.23e-75 228 55 0 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pasteurella multocida (strain Pm70)
Q87QK8 6.43e-75 227 52 1 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P62448 1.65e-73 223 53 2 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Photobacterium profundum (strain SS9)
Q492K0 1.64e-72 220 51 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Blochmanniella pennsylvanica (strain BPEN)
P57204 3.64e-72 219 48 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9ZHE3 2.52e-71 218 49 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
A3QF19 1.02e-69 214 51 3 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q65RB8 9.21e-69 211 53 0 192 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q47XB5 1.49e-67 209 46 1 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q7VQW7 3.69e-67 207 48 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Blochmanniella floridana
A8FWC9 2.53e-66 206 51 3 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shewanella sediminis (strain HAW-EB3)
Q8EFB4 1.11e-65 204 49 3 212 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P59501 5.13e-65 201 49 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8A7Z4 2.85e-63 197 47 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5LBD5 3.15e-63 197 48 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64RT0 4.04e-63 196 48 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacteroides fragilis (strain YCH46)
Q5HSJ1 2.2e-61 192 47 3 195 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Campylobacter jejuni (strain RM1221)
Q9PM75 2.2e-61 192 47 3 195 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q84I56 4.91e-57 180 46 1 171 3 hisH Imidazole glycerol phosphate synthase subunit HisH (Fragment) Buchnera aphidicola subsp. Diuraphis noxia
Q8P9P1 2.66e-54 174 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UU43 2.66e-54 174 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas campestris pv. campestris (strain 8004)
Q8PLG8 5.17e-54 174 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas axonopodis pv. citri (strain 306)
Q84I54 1.52e-53 171 46 1 173 3 hisH Imidazole glycerol phosphate synthase subunit HisH (Fragment) Buchnera aphidicola subsp. Schlechtendalia chinensis
Q3BUF4 4.97e-53 171 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q87C32 5.92e-53 171 42 1 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q5H0K8 5.92e-53 171 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K0 5.92e-53 171 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q9PBC8 3.85e-52 169 42 1 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xylella fastidiosa (strain 9a5c)
Q84I55 6.9e-52 167 43 1 173 3 hisH Imidazole glycerol phosphate synthase subunit HisH (Fragment) Buchnera aphidicola subsp. Melaphis rhois
P61783 9.15e-52 168 41 4 199 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q5X5X2 1.54e-51 167 43 1 197 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Legionella pneumophila (strain Paris)
Q5WX94 4.36e-51 166 43 1 197 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Legionella pneumophila (strain Lens)
Q5ZW90 4.61e-51 166 42 1 197 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q2RGW0 2.79e-50 164 46 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q30PY0 1.26e-48 160 41 5 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
P61782 1.52e-48 160 44 5 202 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q57929 2.36e-48 159 45 6 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q67KH8 6.39e-48 158 44 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
C6C1X6 4.41e-47 156 40 4 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q3AT63 2.63e-46 154 41 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chlorobium chlorochromatii (strain CaD3)
Q8TS91 2.85e-46 154 42 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P72138 3.36e-46 154 43 4 200 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7NNK4 5.08e-46 154 41 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q3A135 1.11e-45 152 42 4 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q465U3 2.17e-45 152 42 4 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanosarcina barkeri (strain Fusaro / DSM 804)
B8J215 2.32e-45 152 42 4 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q8KF56 2.59e-45 151 40 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q5HT90 2.95e-45 151 37 4 200 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Campylobacter jejuni (strain RM1221)
Q8ESS0 3.29e-45 151 40 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q0P8U2 8.02e-45 150 38 4 197 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q3SPZ6 1.33e-44 150 40 5 206 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q3ZY50 5.33e-44 148 40 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Dehalococcoides mccartyi (strain CBDB1)
A1W0U9 6.58e-44 148 38 4 197 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
Q5MZ63 2.08e-43 147 40 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31N58 2.08e-43 147 40 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q5JFV0 3.17e-43 146 42 6 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q2YAU8 4.69e-43 146 37 4 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q97KI0 5.24e-43 145 38 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q6F7A7 5.98e-43 145 41 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8PVD5 6.97e-43 145 41 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P60599 7.24e-43 145 41 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q3B286 1.02e-42 145 39 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1VGZ0 2.22e-42 144 40 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitratidesulfovibrio vulgaris (strain DP4)
P61779 2.22e-42 144 40 4 201 1 hisH Imidazole glycerol phosphate synthase subunit HisH Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A7GMU8 3.6e-42 144 40 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q3AD50 5.23e-42 143 43 6 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q3Z7F2 6.63e-42 143 39 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q39YP4 8.99e-42 142 41 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
O27568 9.63e-42 142 41 6 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8Y9G3 1.07e-41 142 40 6 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
O28019 1.15e-41 142 40 3 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
B0BYP8 1.44e-41 142 40 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Acaryochloris marina (strain MBIC 11017)
Q4FPU1 2.03e-41 142 35 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q820D2 2.05e-41 142 38 5 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
B7INA1 2.17e-41 142 39 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain G9842)
Q92E86 2.3e-41 142 41 7 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B8DQX7 3.27e-41 141 39 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q55805 6.73e-41 140 39 5 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q2S299 8.42e-41 140 41 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salinibacter ruber (strain DSM 13855 / M31)
Q722Y5 8.43e-41 140 41 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serotype 4b (strain F2365)
C1L0J4 8.43e-41 140 41 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serotype 4b (strain CLIP80459)
Q3IUP8 1.27e-40 140 41 7 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q8DIP5 1.29e-40 140 39 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q316L3 1.45e-40 140 40 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q7P0F1 1.6e-40 139 40 4 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q81G04 1.89e-40 139 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q039B3 2e-40 139 44 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WED3 2e-40 139 44 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lacticaseibacillus casei (strain BL23)
Q8TV83 2.44e-40 139 44 7 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B8HUR1 3.15e-40 139 39 6 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cyanothece sp. (strain PCC 7425 / ATCC 29141)
B8DA60 3.37e-40 139 39 6 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serotype 4a (strain HCC23)
Q9K0H2 6.19e-40 138 38 4 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P58789 7.29e-40 137 43 9 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
P60597 8.6e-40 137 38 3 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
B7HHG3 9.27e-40 137 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain B4264)
Q8R883 9.83e-40 137 38 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B9LI74 1.04e-39 137 38 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WD25 1.04e-39 137 38 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
O66943 1.44e-39 137 40 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Aquifex aeolicus (strain VF5)
A9VLH5 1.44e-39 137 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus mycoides (strain KBAB4)
A9BB49 1.49e-39 137 36 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain MIT 9211)
B7KGN3 1.89e-39 137 38 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Gloeothece citriformis (strain PCC 7424)
Q88R44 3.27e-39 136 38 5 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q7MPK8 3.33e-39 136 35 3 202 3 hisH3 Imidazole glycerol phosphate synthase subunit HisH 3 Vibrio vulnificus (strain YJ016)
Q31E66 3.96e-39 136 37 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4ZLP9 4.57e-39 136 37 5 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas syringae pv. syringae (strain B728a)
Q5FA21 5.1e-39 135 37 4 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P61778 6.15e-39 135 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain ATCC 10987 / NRS 248)
Q3KJI8 6.6e-39 135 38 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas fluorescens (strain Pf0-1)
Q4KJS7 1.26e-38 135 38 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q6GDC9 1.32e-38 134 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain MRSA252)
Q2YZ69 1.32e-38 134 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q48C78 1.35e-38 134 38 5 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
B8G9S3 1.52e-38 134 39 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chloroflexus aggregans (strain MD-66 / DSM 9485)
B9IUZ8 1.57e-38 134 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain Q1)
B7HKD2 1.57e-38 134 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain AH187)
Q9JVH3 1.73e-38 134 38 5 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
B0JFQ9 1.75e-38 134 37 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q4A047 1.97e-38 134 39 6 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2JVR1 1.99e-38 134 37 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain JA-3-3Ab)
Q9HNI6 2.2e-38 134 39 6 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q6HLE5 2.4e-38 134 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q2JN09 2.42e-38 134 38 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain JA-2-3B'a(2-13))
Q6KZD3 2.57e-38 133 38 5 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
P64365 2.7e-38 133 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain MW2)
Q6G600 2.7e-38 133 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain MSSA476)
P64364 2.7e-38 133 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain N315)
P64363 2.7e-38 133 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCM2 2.7e-38 133 35 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain COL)
Q87UG1 3.1e-38 134 38 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B7JFZ3 3.39e-38 134 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain AH820)
Q81T60 4.39e-38 133 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus anthracis
C3P504 4.39e-38 133 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus anthracis (strain A0248)
Q3SEU6 4.67e-38 134 39 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thiobacillus denitrificans (strain ATCC 25259)
Q63DX0 4.95e-38 133 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain ZK / E33L)
C1EMQ5 4.95e-38 133 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain 03BB102)
A0RBM0 4.95e-38 133 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus thuringiensis (strain Al Hakam)
C3L9P9 5.69e-38 133 37 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus anthracis (strain CDC 684 / NRRL 3495)
B8FP22 6.48e-38 133 39 4 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q47AM1 6.85e-38 133 39 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Dechloromonas aromatica (strain RCB)
Q9HU42 7.23e-38 133 37 5 203 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q7MPP4 8.36e-38 132 39 6 203 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Vibrio vulnificus (strain YJ016)
O34565 9.02e-38 132 38 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus subtilis (strain 168)
Q24QJ3 9.16e-38 132 39 4 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Desulfitobacterium hafniense (strain Y51)
B2J1A3 9.46e-38 132 38 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
A8FHR1 1.03e-37 132 40 6 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus pumilus (strain SAFR-032)
Q5HKP0 1.48e-37 131 36 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q65EG1 1.72e-37 132 40 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q7VBF5 1.91e-37 132 33 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q113E7 2.03e-37 132 38 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Trichodesmium erythraeum (strain IMS101)
Q39K87 2.53e-37 131 37 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A8AY26 3.31e-37 131 42 8 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
Q8DTR1 3.83e-37 130 38 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
A4ISR4 3.98e-37 131 41 7 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus thermodenitrificans (strain NG80-2)
Q9S4H8 3.99e-37 130 34 3 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira interrogans
Q4FNT5 4.26e-37 130 35 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pelagibacter ubique (strain HTCC1062)
Q63Q90 4.68e-37 130 38 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia pseudomallei (strain K96243)
Q3JN00 4.68e-37 130 38 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia pseudomallei (strain 1710b)
Q62GE3 4.68e-37 130 38 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia mallei (strain ATCC 23344)
P58788 4.7e-37 130 37 6 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8CTV0 4.96e-37 130 36 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q7U924 9.27e-37 130 36 4 207 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Parasynechococcus marenigrum (strain WH8102)
A3CNT2 9.52e-37 130 40 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptococcus sanguinis (strain SK36)
Q3M5W4 1.18e-36 129 36 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9RX89 1.58e-36 129 39 4 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
Q9K6Z4 1.97e-36 129 38 6 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q5KVC8 2.6e-36 129 40 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus kaustophilus (strain HTA426)
Q7VIW9 2.71e-36 129 37 7 216 3 hisH Imidazole glycerol phosphate synthase subunit HisH Helicobacter hepaticus (strain ATCC 51449 / 3B1)
A0AG17 2.85e-36 129 39 7 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q3J6Q3 3.37e-36 128 40 6 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
C5D7P0 3.44e-36 128 38 6 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus sp. (strain WCH70)
Q603K1 3.59e-36 129 38 7 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8YX49 3.59e-36 128 36 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q02132 3.72e-36 128 39 7 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lactococcus lactis subsp. lactis (strain IL1403)
Q5UYV3 8.35e-36 128 37 8 219 3 hisH Imidazole glycerol phosphate synthase subunit HisH Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
P16249 8.52e-36 128 36 3 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q845U9 9.47e-36 127 37 4 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia multivorans (strain ATCC 17616 / 249)
Q7V959 1.58e-35 127 38 7 210 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Prochlorococcus marinus (strain MIT 9313)
Q7V6M5 2.97e-35 126 36 4 196 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Prochlorococcus marinus (strain MIT 9313)
B1YL11 3.06e-35 125 36 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
P59118 3.19e-35 126 36 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P61780 3.19e-35 126 36 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q9SZ30 5.88e-35 132 36 5 203 2 HISN4 Imidazole glycerol phosphate synthase hisHF, chloroplastic Arabidopsis thaliana
Q7U899 6.35e-35 125 34 4 201 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Parasynechococcus marenigrum (strain WH8102)
Q3SWE9 7.13e-35 125 36 8 215 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q9A231 9.2e-35 125 39 4 178 3 hisH Imidazole glycerol phosphate synthase subunit HisH Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5LU93 1.09e-34 124 37 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
P60601 1.22e-34 124 37 8 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q3AYZ0 1.61e-34 124 34 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain CC9902)
Q5P793 1.64e-34 124 39 6 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
A7Z964 5.96e-34 122 36 6 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q89WM6 8.12e-34 122 36 8 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q46WL6 9.18e-34 122 36 5 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q88UE1 1.06e-33 122 41 7 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q8XV83 1.18e-33 122 36 7 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q2RNA5 1.25e-33 122 37 8 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
O69043 1.78e-33 121 33 4 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q98CT5 1.98e-33 121 35 8 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q8FY09 2.48e-33 121 34 6 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella suis biovar 1 (strain 1330)
Q57AH5 2.95e-33 121 34 6 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella abortus biovar 1 (strain 9-941)
Q2YQZ0 2.95e-33 121 34 6 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella abortus (strain 2308)
Q7M9X0 3.12e-33 120 33 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q9ZGM1 5.44e-33 120 33 3 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira borgpetersenii
Q5NMD4 6.31e-33 120 38 8 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q8YE35 1.3e-32 119 34 6 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
P60598 1.32e-32 119 33 4 209 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q47QS5 1.4e-32 119 33 3 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermobifida fusca (strain YX)
Q46JZ5 1.86e-32 119 36 7 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain NATL2A)
A9B5I2 1.99e-32 119 38 5 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q5WDI0 2.07e-32 119 36 6 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shouchella clausii (strain KSM-K16)
Q7V127 2.77e-32 118 34 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q82AA2 3.67e-32 118 36 4 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q7ULP3 4e-32 118 38 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q7W2Y1 4.77e-32 118 32 4 221 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WDY1 4.77e-32 118 32 4 221 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3AI95 6.5e-32 117 35 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain CC9605)
Q8ZY40 7.64e-32 117 36 5 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q5WYE9 9.99e-32 117 34 6 210 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Legionella pneumophila (strain Lens)
P18785 1.02e-31 116 34 6 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Azospirillum brasilense
Q7VSY8 1.02e-31 117 32 4 221 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q85FY4 3.16e-31 115 33 5 210 3 hisH Imidazole glycerol phosphate synthase subunit hisH Cyanidioschyzon merolae (strain NIES-3377 / 10D)
P9WMM0 5.07e-31 115 33 2 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59957 5.07e-31 115 33 2 199 1 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q31AG5 7.84e-31 114 35 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain MIT 9312)
Q9RDX3 1.44e-30 114 34 6 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Legionella pneumophila
Q5ZXI1 1.44e-30 114 34 6 210 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6Z7 1.44e-30 114 34 6 210 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Legionella pneumophila (strain Paris)
Q6A8L2 1.45e-30 114 35 5 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q92TB1 1.46e-30 114 33 6 215 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhizobium meliloti (strain 1021)
Q5YYP7 1.9e-30 114 35 4 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nocardia farcinica (strain IFM 10152)
P9WMM1 3.73e-30 113 32 2 199 1 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
Q9P4P9 3.81e-30 119 33 5 206 3 hisHF Imidazole glycerol phosphate synthase hisHF Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
O33565 6.19e-30 112 35 6 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q7SIC0 7.81e-30 112 34 6 196 1 hisH Imidazole glycerol phosphate synthase subunit HisH Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
P61781 8.44e-30 112 34 6 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q0BPX1 1.01e-29 112 33 6 209 3 hisH Imidazole glycerol phosphate synthase subunit HisH Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
O94303 1.82e-29 117 34 5 205 3 his4 Imidazole glycerol phosphate synthase hisHF Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8FNZ6 3.98e-29 110 31 4 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P48262 4.48e-29 110 33 6 206 3 hisH Imidazole glycerol phosphate synthase subunit hisH Cyanophora paradoxa
Q9X0C8 1.53e-28 108 34 7 209 1 hisH Imidazole glycerol phosphate synthase subunit HisH Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P33734 2.92e-28 113 32 8 214 1 HIS7 Imidazole glycerol phosphate synthase hisHF Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9TLQ8 2.1e-27 106 34 8 209 3 hisH Imidazole glycerol phosphate synthase subunit hisH Cyanidium caldarium
Q4JW55 2.34e-27 106 31 8 232 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium jeikeium (strain K411)
P60600 6.36e-27 104 34 3 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q9X7C0 1.26e-26 103 35 2 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium leprae (strain TN)
Q4J8I5 2.87e-26 102 32 5 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q5FTN5 6.54e-26 102 35 5 176 3 hisH Imidazole glycerol phosphate synthase subunit HisH Gluconobacter oxydans (strain 621H)
Q6AE14 3.43e-25 100 33 4 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leifsonia xyli subsp. xyli (strain CTCB07)
A9WQ58 6.12e-24 97 33 7 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
O33777 3.74e-23 94 32 7 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q970Y7 4.18e-23 94 29 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8G4S6 1.45e-22 93 33 8 212 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bifidobacterium longum (strain NCC 2705)
A7Z235 2.15e-06 50 33 7 138 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q6KZC5 2.48e-06 49 26 8 208 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
A8FAH5 3.09e-06 50 29 4 134 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus pumilus (strain SAFR-032)
Q73LZ4 9.05e-06 48 27 4 132 3 guaA GMP synthase [glutamine-hydrolyzing] Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q8X239 1.17e-05 47 26 5 134 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q046I2 1.54e-05 48 31 7 135 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
A3MZT9 1.63e-05 47 25 5 172 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q74LF7 1.92e-05 47 31 7 135 3 guaA GMP synthase [glutamine-hydrolyzing] Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
B0BUD1 2e-05 47 25 5 172 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXB7 2e-05 47 25 5 172 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
P29727 4.2e-05 47 31 7 138 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus subtilis (strain 168)
Q974T4 5.83e-05 45 27 5 136 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q65MU0 8.07e-05 46 27 5 134 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8Y822 0.000131 45 31 7 130 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q720X7 0.00018 45 30 7 130 3 guaA GMP synthase [glutamine-hydrolyzing] Listeria monocytogenes serotype 4b (strain F2365)
B9L0W3 0.000186 45 31 5 126 3 guaA GMP synthase [glutamine-hydrolyzing] Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
O27693 0.000276 43 32 7 131 3 trpG Anthranilate synthase component 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q7MNE1 0.000382 43 27 7 128 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain YJ016)
Q8DF07 0.000386 43 27 7 128 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain CMCP6)
A4T0R6 0.000409 43 34 3 95 3 cobQ Cobyric acid synthase Mycolicibacterium gilvum (strain PYR-GCK)
Q0AW22 0.000414 43 27 5 146 3 guaA GMP synthase [glutamine-hydrolyzing] Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
B6EGZ6 0.000569 43 26 5 126 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio salmonicida (strain LFI1238)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_04060
Feature type CDS
Gene hisH
Product imidazole glycerol phosphate synthase subunit HisH
Location 138665 - 139261 (strand: 1)
Length 597 (nucleotides) / 198 (amino acids)
In genomic island -

Contig

Accession ZDB_520
Length 336657 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1254
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00117 Glutamine amidotransferase class-I

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0118 Amino acid transport and metabolism (E) E Imidazoleglycerol phosphate synthase glutamine amidotransferase subunit HisH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02501 imidazole glycerol-phosphate synthase subunit HisH [EC:4.3.2.10] Histidine metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Biosynthesis of amino acids
Histidine biosynthesis, PRPP => histidine

Protein Sequence

MHIVITDTGCANIASVRYAVERLGYQPLVTADPDLIRQADKVFLPGVGTAGAAMENLTARGLVSTIRSLTQPVLGICLGMQLLGTTSEEGNIDLLGLIDTPVQKMTPDGLPVPHMGWNTVEFTADLPLFRDIAPQSYFYFVHSYACPVSDATAATTTYGEAFSSVLFRDNFYGVQFHPERSGKTGITLIKNFLEMKAS

Flanking regions ( +/- flanking 50bp)

GCTATCCGTGTGGAAGGTAATGTTCTGCCGAGTTCAAAAGGGGTGCTGTGATGCACATAGTGATCACCGATACCGGCTGTGCCAATATCGCCTCCGTCCGCTACGCGGTGGAGCGTCTTGGTTATCAGCCGCTGGTCACCGCCGACCCTGACCTTATCCGTCAGGCAGATAAAGTCTTTCTGCCGGGAGTCGGGACGGCGGGCGCGGCAATGGAAAATCTGACAGCGCGCGGGCTGGTGAGCACCATCCGTTCCCTGACACAACCGGTGCTGGGGATTTGCCTCGGCATGCAGTTGCTCGGCACCACCAGCGAAGAAGGAAATATTGATCTGCTCGGCCTGATCGATACCCCGGTACAAAAAATGACGCCGGACGGGCTGCCGGTGCCGCACATGGGCTGGAATACCGTGGAATTTACCGCTGATCTGCCGCTGTTCCGTGATATTGCGCCGCAGAGCTATTTTTATTTTGTTCACAGTTACGCCTGCCCGGTCAGCGACGCTACGGCTGCCACCACCACATACGGTGAGGCATTCAGCAGTGTTCTTTTCCGCGATAATTTTTACGGCGTGCAGTTCCACCCGGAGCGTTCAGGCAAAACCGGTATCACACTGATTAAAAATTTTCTGGAGATGAAAGCGTCATGATCATTCCCGCACTGGATTTAATTGACGGACAGGTAGTGCGCCTTCACCAG