Homologs in group_1254

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06910 FBDBKF_06910 86.9 Morganella morganii S1 hisH imidazole glycerol phosphate synthase subunit HisH
EHELCC_04060 EHELCC_04060 86.9 Morganella morganii S2 hisH imidazole glycerol phosphate synthase subunit HisH
NLDBIP_04060 NLDBIP_04060 86.9 Morganella morganii S4 hisH imidazole glycerol phosphate synthase subunit HisH
LHKJJB_09890 LHKJJB_09890 86.9 Morganella morganii S3 hisH imidazole glycerol phosphate synthase subunit HisH
HKOGLL_09085 HKOGLL_09085 86.9 Morganella morganii S5 hisH imidazole glycerol phosphate synthase subunit HisH
PMI_RS03255 PMI_RS03255 62.6 Proteus mirabilis HI4320 hisH imidazole glycerol phosphate synthase subunit HisH

Distribution of the homologs in the orthogroup group_1254

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1254

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q6D408 1.02e-89 264 63 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q66C52 1.42e-85 253 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZFX8 1.42e-85 253 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Yersinia pestis
Q7N6I3 9.87e-85 251 59 1 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q83KJ5 3.3e-81 243 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella flexneri
Q3Z0G2 4.69e-81 242 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella sonnei (strain Ss046)
Q32EF2 4.69e-81 242 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella dysenteriae serotype 1 (strain Sd197)
Q323I9 4.69e-81 242 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shigella boydii serotype 4 (strain Sb227)
P60595 4.69e-81 242 61 1 196 1 hisH Imidazole glycerol phosphate synthase subunit HisH Escherichia coli (strain K12)
P60596 4.69e-81 242 61 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P58237 4.98e-80 239 60 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Escherichia coli O157:H7
P0A1R4 5.04e-80 239 59 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A1R5 5.04e-80 239 59 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella typhi
Q5PDP6 5.04e-80 239 59 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57MS0 5.04e-80 239 59 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salmonella choleraesuis (strain SC-B67)
P44340 2.46e-79 238 56 0 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QN71 3.2e-79 238 56 0 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Haemophilus influenzae (strain 86-028NP)
Q5QWQ7 3.85e-79 237 56 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5E635 7.86e-79 237 55 1 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8D8Q3 3.92e-78 235 54 1 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Vibrio vulnificus (strain CMCP6)
Q7MLS3 3.92e-78 235 54 1 200 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Vibrio vulnificus (strain YJ016)
Q9KSX0 5.27e-78 234 55 1 200 1 hisH Imidazole glycerol phosphate synthase subunit HisH Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P62448 7.57e-78 234 54 2 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Photobacterium profundum (strain SS9)
Q87QK8 1.72e-77 233 54 1 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
P57921 2.11e-75 228 54 0 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pasteurella multocida (strain Pm70)
P57204 7.82e-75 226 50 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q492K0 5.02e-74 224 51 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Blochmanniella pennsylvanica (strain BPEN)
Q9ZHE3 3.8e-72 219 49 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q65RB8 5.42e-71 216 54 0 192 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q47XB5 6.16e-71 218 48 2 209 3 hisH Imidazole glycerol phosphate synthase subunit HisH Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
A3QF19 5.18e-70 215 49 2 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shewanella loihica (strain ATCC BAA-1088 / PV-4)
A8FWC9 3.84e-69 213 51 2 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shewanella sediminis (strain HAW-EB3)
P59501 9.72e-69 211 51 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8EFB4 4.13e-67 207 48 3 212 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VQW7 1.06e-64 201 47 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Blochmanniella floridana
Q5LBD5 7.53e-63 196 48 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q64RT0 1.51e-62 195 47 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacteroides fragilis (strain YCH46)
Q8A7Z4 9.16e-62 193 46 2 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q5HSJ1 2.05e-60 189 47 3 195 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Campylobacter jejuni (strain RM1221)
Q9PM75 2.05e-60 189 47 3 195 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q87C32 5.44e-59 186 46 1 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PBC8 2.79e-58 184 45 1 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xylella fastidiosa (strain 9a5c)
Q5X5X2 2.36e-56 179 44 1 196 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Legionella pneumophila (strain Paris)
Q3BUF4 2.54e-56 179 45 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q5WX94 2.69e-56 179 44 1 196 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Legionella pneumophila (strain Lens)
Q8P9P1 3.6e-56 179 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q4UU43 3.6e-56 179 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas campestris pv. campestris (strain 8004)
Q8PLG8 4.63e-56 179 45 1 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas axonopodis pv. citri (strain 306)
Q84I56 6.65e-56 177 45 1 171 3 hisH Imidazole glycerol phosphate synthase subunit HisH (Fragment) Buchnera aphidicola subsp. Diuraphis noxia
Q5ZW90 7.09e-56 178 43 1 196 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5H0K8 1.93e-55 177 45 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P3K0 1.93e-55 177 45 1 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q84I54 3.72e-54 173 46 1 173 3 hisH Imidazole glycerol phosphate synthase subunit HisH (Fragment) Buchnera aphidicola subsp. Schlechtendalia chinensis
Q84I55 1.34e-53 172 44 1 173 3 hisH Imidazole glycerol phosphate synthase subunit HisH (Fragment) Buchnera aphidicola subsp. Melaphis rhois
P61783 7.6e-52 168 42 4 199 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q2RGW0 1.9e-50 165 45 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q67KH8 2.46e-49 162 44 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
P61782 2.81e-49 162 45 5 202 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q57929 3.06e-49 161 45 6 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
B8J215 3.11e-49 162 43 3 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q30PY0 3.24e-49 162 44 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
Q8ESS0 1.04e-48 160 41 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
C6C1X6 1.51e-48 160 40 4 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q8KF56 4.52e-48 158 41 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q3SPZ6 1.51e-47 157 41 6 208 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
P72138 2.7e-47 156 43 4 200 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q3AT63 5.32e-46 153 40 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chlorobium chlorochromatii (strain CaD3)
Q7NNK4 5.42e-46 154 41 6 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5JFV0 6.1e-46 153 44 6 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q97KI0 1.9e-45 152 39 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q6F7A7 1.06e-44 150 41 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q8TS91 1.08e-44 150 40 4 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q3B286 3.36e-44 149 39 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
A1VGZ0 1.55e-43 147 41 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitratidesulfovibrio vulgaris (strain DP4)
P61779 1.58e-43 147 41 4 201 1 hisH Imidazole glycerol phosphate synthase subunit HisH Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q3A135 3.91e-43 146 41 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q92E86 5.37e-43 145 40 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q5HT90 6.01e-43 145 36 4 200 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Campylobacter jejuni (strain RM1221)
O27568 7.07e-43 145 41 6 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q465U3 7.85e-43 145 40 4 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanosarcina barkeri (strain Fusaro / DSM 804)
B7INA1 1.12e-42 145 39 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain G9842)
Q0P8U2 1.46e-42 144 37 4 197 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A1W0U9 1.48e-42 144 37 4 197 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P60597 1.49e-42 144 39 3 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIMB 9529 / HD100)
Q3AD50 1.73e-42 144 44 7 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
Q8DIP5 2.16e-42 144 39 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
O66943 2.45e-42 144 40 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Aquifex aeolicus (strain VF5)
Q88R44 3.05e-42 144 39 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q81G04 3.41e-42 144 39 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B8DQX7 3.55e-42 144 40 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
Q4FPU1 6.25e-42 143 36 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q5MZ63 1.02e-41 143 39 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31N58 1.02e-41 143 39 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q4FNT5 1.04e-41 142 37 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pelagibacter ubique (strain HTCC1062)
Q8Y9G3 1.15e-41 142 39 7 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B8DA60 1.31e-41 142 40 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serotype 4a (strain HCC23)
Q2YAU8 1.44e-41 142 38 4 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q7MPK8 1.57e-41 142 37 3 202 3 hisH3 Imidazole glycerol phosphate synthase subunit HisH 3 Vibrio vulnificus (strain YJ016)
Q039B3 1.68e-41 142 44 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
B3WED3 1.68e-41 142 44 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lacticaseibacillus casei (strain BL23)
B7HHG3 1.77e-41 142 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain B4264)
Q722Y5 2.16e-41 142 39 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serotype 4b (strain F2365)
C1L0J4 2.16e-41 142 39 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria monocytogenes serotype 4b (strain CLIP80459)
Q8TV83 2.18e-41 141 43 7 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
A7GMU8 2.88e-41 141 39 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q6GDC9 2.88e-41 141 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain MRSA252)
Q2YZ69 2.88e-41 141 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q3Z7F2 4.22e-41 141 40 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q3ZY50 4.41e-41 140 39 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Dehalococcoides mccartyi (strain CBDB1)
Q820D2 7.35e-41 140 38 4 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
P64365 9.09e-41 139 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain MW2)
Q6G600 9.09e-41 139 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain MSSA476)
P64364 9.09e-41 139 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain N315)
P64363 9.09e-41 139 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HCM2 9.09e-41 139 38 5 194 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus aureus (strain COL)
O28019 1.19e-40 139 40 5 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
A9VLH5 1.56e-40 139 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus mycoides (strain KBAB4)
Q9HU42 1.78e-40 139 36 5 207 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PVD5 2.44e-40 139 38 4 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P60599 2.48e-40 139 38 4 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q316L3 2.6e-40 139 39 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Oleidesulfovibrio alaskensis (strain ATCC BAA-1058 / DSM 17464 / G20)
Q3KJI8 3.49e-40 139 37 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas fluorescens (strain Pf0-1)
P61778 4.44e-40 138 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain ATCC 10987 / NRS 248)
Q4KJS7 4.53e-40 138 37 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
A8FHR1 5.8e-40 138 40 5 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus pumilus (strain SAFR-032)
B7KGN3 6.86e-40 138 38 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Gloeothece citriformis (strain PCC 7424)
Q9RX89 7.5e-40 138 40 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
B9IUZ8 1.11e-39 137 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain Q1)
B7HKD2 1.11e-39 137 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain AH187)
Q9S4H8 1.18e-39 137 35 3 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira interrogans
Q39YP4 1.52e-39 137 39 4 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B8HUR1 1.58e-39 137 38 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q3IUP8 1.72e-39 137 39 7 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q113E7 1.99e-39 137 40 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Trichodesmium erythraeum (strain IMS101)
Q6HLE5 2.18e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q31E66 2.18e-39 137 37 6 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q4ZLP9 2.24e-39 137 36 6 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas syringae pv. syringae (strain B728a)
B7JFZ3 2.85e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain AH820)
B8G9S3 2.95e-39 136 39 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chloroflexus aggregans (strain MD-66 / DSM 9485)
Q81T60 3.32e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus anthracis
C3P504 3.32e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus anthracis (strain A0248)
Q2S299 3.7e-39 136 40 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Salinibacter ruber (strain DSM 13855 / M31)
Q8YX49 3.82e-39 136 37 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B9LI74 4.11e-39 136 38 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WD25 4.11e-39 136 38 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q8R883 4.14e-39 135 37 4 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q4A047 4.14e-39 135 37 4 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q3M5W4 4.17e-39 136 38 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q63DX0 4.21e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain ZK / E33L)
C1EMQ5 4.21e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus cereus (strain 03BB102)
A0RBM0 4.21e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus thuringiensis (strain Al Hakam)
C3L9P9 4.3e-39 136 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus anthracis (strain CDC 684 / NRRL 3495)
A8AY26 4.58e-39 135 43 7 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
B2J1A3 5.18e-39 135 39 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
Q7MPP4 5.87e-39 135 39 6 203 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Vibrio vulnificus (strain YJ016)
Q5KVC8 6.71e-39 135 41 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus kaustophilus (strain HTA426)
P58789 6.86e-39 135 43 7 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8DTR1 8.44e-39 135 38 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q55805 9.12e-39 135 39 5 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B0JFQ9 9.96e-39 135 38 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q7P0F1 1.06e-38 135 38 4 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q02132 1.18e-38 134 41 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lactococcus lactis subsp. lactis (strain IL1403)
B0BYP8 1.31e-38 135 39 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Acaryochloris marina (strain MBIC 11017)
Q2JVR1 1.55e-38 134 37 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain JA-3-3Ab)
Q6KZD3 2.02e-38 133 40 6 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q2RNA5 2.55e-38 134 39 8 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
O34565 2.72e-38 134 37 5 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus subtilis (strain 168)
A9BB49 2.84e-38 134 37 5 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain MIT 9211)
A4ISR4 2.98e-38 134 40 6 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus thermodenitrificans (strain NG80-2)
Q87UG1 3.16e-38 134 36 6 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5HKP0 4.08e-38 133 35 4 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A3CNT2 4.43e-38 133 39 5 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptococcus sanguinis (strain SK36)
Q48C78 5.79e-38 133 36 6 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5LU93 6.25e-38 133 38 6 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q9K0H2 6.38e-38 133 39 7 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9K6Z4 9.42e-38 132 38 6 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q47AM1 1e-37 132 39 5 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Dechloromonas aromatica (strain RCB)
Q3J6Q3 1.1e-37 132 38 6 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
B1YL11 1.21e-37 132 38 5 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
Q8CTV0 1.33e-37 131 35 4 193 3 hisH Imidazole glycerol phosphate synthase subunit HisH Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
A0AG17 1.34e-37 132 38 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
B8FP22 2.61e-37 131 38 4 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q9HNI6 2.8e-37 131 37 6 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q24QJ3 3.04e-37 131 38 4 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Desulfitobacterium hafniense (strain Y51)
Q2JN09 3.51e-37 131 36 5 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain JA-2-3B'a(2-13))
Q603K1 4.11e-37 131 39 7 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
C5D7P0 4.62e-37 130 39 7 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Geobacillus sp. (strain WCH70)
Q5FA21 5.02e-37 130 39 7 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
P16249 5.12e-37 131 35 3 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7VBF5 6.46e-37 130 33 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
Q7U924 1.07e-36 130 36 3 204 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Parasynechococcus marenigrum (strain WH8102)
Q65EG1 1.07e-36 130 39 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q7VIW9 1.27e-36 130 38 8 216 3 hisH Imidazole glycerol phosphate synthase subunit HisH Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q9JVH3 1.89e-36 129 39 7 210 3 hisH Imidazole glycerol phosphate synthase subunit HisH Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q63Q90 2.03e-36 129 38 6 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia pseudomallei (strain K96243)
Q3JN00 2.03e-36 129 38 6 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia pseudomallei (strain 1710b)
Q62GE3 2.03e-36 129 38 6 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia mallei (strain ATCC 23344)
P58788 2.5e-36 129 38 8 214 3 hisH Imidazole glycerol phosphate synthase subunit HisH Agrobacterium fabrum (strain C58 / ATCC 33970)
O69043 2.74e-36 129 33 3 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q7V959 3.31e-36 129 38 7 210 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Prochlorococcus marinus (strain MIT 9313)
Q9ZGM1 4.24e-36 128 34 3 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira borgpetersenii
Q5UYV3 1.15e-35 127 36 9 222 3 hisH Imidazole glycerol phosphate synthase subunit HisH Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
Q39K87 1.71e-35 127 37 7 209 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q3SEU6 1.82e-35 127 38 5 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thiobacillus denitrificans (strain ATCC 25259)
P9WMM0 1.98e-35 126 35 3 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P59957 1.98e-35 126 35 3 201 1 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P59118 3.59e-35 125 35 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
P61780 3.59e-35 125 35 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
Q5WDI0 3.69e-35 125 37 6 204 3 hisH Imidazole glycerol phosphate synthase subunit HisH Shouchella clausii (strain KSM-K16)
A9B5I2 7.07e-35 125 40 5 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q5P793 7.3e-35 125 38 5 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q9SZ30 9.33e-35 132 36 5 201 2 HISN4 Imidazole glycerol phosphate synthase hisHF, chloroplastic Arabidopsis thaliana
Q0BPX1 1.01e-34 125 35 6 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q7M9X0 1.18e-34 124 33 4 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
P9WMM1 1.24e-34 124 35 3 201 1 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
A7Z964 1.45e-34 124 37 6 206 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q88UE1 1.62e-34 124 42 9 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q47QS5 1.81e-34 124 34 3 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermobifida fusca (strain YX)
Q9A231 2.3e-34 124 39 4 176 3 hisH Imidazole glycerol phosphate synthase subunit HisH Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q98CT5 2.83e-34 124 36 8 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q7ULP3 4.35e-34 123 37 5 197 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q89WM6 4.74e-34 123 37 8 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q845U9 5.86e-34 123 36 6 209 3 hisH Imidazole glycerol phosphate synthase subunit HisH Burkholderia multivorans (strain ATCC 17616 / 249)
Q5NMD4 6.67e-34 122 39 10 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q7V127 8.96e-34 122 36 6 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q82AA2 9.19e-34 122 35 4 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q9P4P9 1.06e-33 129 35 6 208 3 hisHF Imidazole glycerol phosphate synthase hisHF Emericella nidulans (strain FGSC A4 / ATCC 38163 / CBS 112.46 / NRRL 194 / M139)
Q46WL6 1.64e-33 122 37 7 214 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q57AH5 1.86e-33 121 35 7 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella abortus biovar 1 (strain 9-941)
Q2YQZ0 1.86e-33 121 35 7 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella abortus (strain 2308)
Q7V6M5 2.22e-33 121 34 5 196 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Prochlorococcus marinus (strain MIT 9313)
Q8XV83 2.69e-33 121 36 7 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8FY09 2.86e-33 121 35 7 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella suis biovar 1 (strain 1330)
P60598 2.97e-33 121 33 4 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q3SWE9 3.08e-33 121 35 7 213 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q92TB1 3.99e-33 120 35 6 212 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhizobium meliloti (strain 1021)
Q7W2Y1 4.36e-33 121 34 6 225 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WDY1 4.36e-33 121 34 6 225 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q3AI95 5.79e-33 120 35 4 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain CC9605)
Q7VSY8 8.4e-33 120 34 6 225 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7U899 1.25e-32 119 33 4 201 3 hisH2 Imidazole glycerol phosphate synthase subunit HisH 2 Parasynechococcus marenigrum (strain WH8102)
P18785 1.29e-32 119 34 5 202 3 hisH Imidazole glycerol phosphate synthase subunit HisH Azospirillum brasilense
Q8YE35 1.37e-32 119 34 7 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FNZ6 1.7e-32 119 33 5 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
P60601 3.27e-32 118 35 8 213 3 hisH Imidazole glycerol phosphate synthase subunit HisH Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
P61781 4.85e-32 117 35 6 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q7SIC0 6.48e-32 117 35 6 195 1 hisH Imidazole glycerol phosphate synthase subunit HisH Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q3AYZ0 6.93e-32 117 33 5 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Synechococcus sp. (strain CC9902)
Q46JZ5 7.67e-32 117 35 6 199 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain NATL2A)
Q8ZY40 1.24e-31 116 37 6 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
P60600 2.69e-31 115 35 2 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q85FY4 5.18e-31 115 33 5 206 3 hisH Imidazole glycerol phosphate synthase subunit hisH Cyanidioschyzon merolae (strain NIES-3377 / 10D)
O33565 6.23e-31 115 36 7 208 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q9X7C0 7.88e-31 114 38 3 200 3 hisH Imidazole glycerol phosphate synthase subunit HisH Mycobacterium leprae (strain TN)
Q9X0C8 1.29e-30 114 37 7 204 1 hisH Imidazole glycerol phosphate synthase subunit HisH Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q31AG5 3.53e-30 113 34 4 198 3 hisH Imidazole glycerol phosphate synthase subunit HisH Prochlorococcus marinus (strain MIT 9312)
Q6A8L2 4.42e-30 112 34 5 201 3 hisH Imidazole glycerol phosphate synthase subunit HisH Cutibacterium acnes (strain DSM 16379 / KPA171202)
Q5FTN5 1.07e-29 112 38 5 176 3 hisH Imidazole glycerol phosphate synthase subunit HisH Gluconobacter oxydans (strain 621H)
O94303 1.52e-29 117 34 6 205 3 his4 Imidazole glycerol phosphate synthase hisHF Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P48262 2.1e-29 111 34 6 205 3 hisH Imidazole glycerol phosphate synthase subunit hisH Cyanophora paradoxa
Q9TLQ8 2.97e-29 110 35 8 210 3 hisH Imidazole glycerol phosphate synthase subunit hisH Cyanidium caldarium
Q5WYE9 4.65e-29 110 32 6 211 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Legionella pneumophila (strain Lens)
Q5YYP7 6.79e-29 109 34 3 205 3 hisH Imidazole glycerol phosphate synthase subunit HisH Nocardia farcinica (strain IFM 10152)
Q9RDX3 1.34e-28 109 30 6 211 3 hisH Imidazole glycerol phosphate synthase subunit HisH Legionella pneumophila
Q5ZXI1 1.34e-28 109 30 6 211 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6Z7 1.34e-28 109 30 6 211 3 hisH1 Imidazole glycerol phosphate synthase subunit HisH 1 Legionella pneumophila (strain Paris)
P33734 2.33e-28 114 32 7 212 1 HIS7 Imidazole glycerol phosphate synthase hisHF Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q6AE14 5.21e-28 107 33 4 203 3 hisH Imidazole glycerol phosphate synthase subunit HisH Leifsonia xyli subsp. xyli (strain CTCB07)
A9WQ58 4.33e-26 102 32 6 207 3 hisH Imidazole glycerol phosphate synthase subunit HisH Renibacterium salmoninarum (strain ATCC 33209 / DSM 20767 / JCM 11484 / NBRC 15589 / NCIMB 2235)
Q4JW55 2.22e-25 101 30 8 233 3 hisH Imidazole glycerol phosphate synthase subunit HisH Corynebacterium jeikeium (strain K411)
Q8G4S6 3.28e-25 100 33 8 212 3 hisH Imidazole glycerol phosphate synthase subunit HisH Bifidobacterium longum (strain NCC 2705)
Q4J8I5 2.56e-24 97 30 5 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
O33777 6.86e-23 94 32 6 195 3 hisH Imidazole glycerol phosphate synthase subunit HisH Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
Q970Y7 6.62e-22 91 29 6 196 3 hisH Imidazole glycerol phosphate synthase subunit HisH Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q8X239 2.96e-08 54 28 5 134 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q974T4 2.96e-07 52 29 5 129 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q2NGI4 1.26e-06 50 24 8 161 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q59055 2.48e-06 49 25 8 181 1 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q6KZC5 2.63e-06 49 27 9 202 3 guaAA GMP synthase [glutamine-hydrolyzing] subunit A Picrophilus torridus (strain ATCC 700027 / DSM 9790 / JCM 10055 / NBRC 100828 / KAW 2/3)
Q72IE5 5.3e-06 49 31 5 128 3 guaA GMP synthase [glutamine-hydrolyzing] Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
B9KFL4 5.42e-06 49 29 6 134 3 guaA GMP synthase [glutamine-hydrolyzing] Campylobacter lari (strain RM2100 / D67 / ATCC BAA-1060)
Q5SI28 5.55e-06 49 31 5 128 1 guaA GMP synthase [glutamine-hydrolyzing] Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O27693 6.77e-06 48 32 6 131 3 trpG Anthranilate synthase component 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
B6EGZ6 7.2e-06 49 27 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio salmonicida (strain LFI1238)
A8FAH5 7.82e-06 48 29 4 134 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus pumilus (strain SAFR-032)
Q0UHC4 8.16e-06 48 31 6 129 3 GUA1 GMP synthase [glutamine-hydrolyzing] Phaeosphaeria nodorum (strain SN15 / ATCC MYA-4574 / FGSC 10173)
A8G223 9.07e-06 48 32 7 128 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9215)
B5FAY1 9.27e-06 48 27 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio fischeri (strain MJ11)
Q5E763 9.45e-06 48 27 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Aliivibrio fischeri (strain ATCC 700601 / ES114)
B1JSB0 9.85e-06 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q668A8 9.85e-06 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9P0 9.85e-06 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7FFZ9 9.85e-06 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A4IJ95 1e-05 47 26 8 182 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Geobacillus thermodenitrificans (strain NG80-2)
A4TMS8 1e-05 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis (strain Pestoides F)
Q1CK82 1e-05 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis bv. Antiqua (strain Nepal516)
A9R7Z2 1e-05 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis bv. Antiqua (strain Angola)
Q8ZCU4 1e-05 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis
Q1C5J6 1e-05 48 31 7 134 3 guaA GMP synthase [glutamine-hydrolyzing] Yersinia pestis bv. Antiqua (strain Antiqua)
B7VJU8 1.82e-05 48 28 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio atlanticus (strain LGP32)
C3KUC5 1.84e-05 47 30 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain 657 / Type Ba4)
B1L1J7 1.92e-05 47 30 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Loch Maree / Type A3)
A7GIN0 1.99e-05 47 30 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IFD1 1.99e-05 47 30 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Okra / Type B1)
A5I720 2.01e-05 47 30 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FYP0 2.01e-05 47 30 4 126 3 guaA GMP synthase [glutamine-hydrolyzing] Clostridium botulinum (strain ATCC 19397 / Type A)
Q31DE7 2.16e-05 47 31 7 128 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9312)
A7Z235 2.54e-05 47 28 6 134 3 guaA GMP synthase [glutamine-hydrolyzing] Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
B8I4P0 2.92e-05 47 30 5 128 3 guaA GMP synthase [glutamine-hydrolyzing] Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
Q7MNE1 3.33e-05 47 27 5 128 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain YJ016)
Q8DF07 3.33e-05 47 27 5 128 3 guaA GMP synthase [glutamine-hydrolyzing] Vibrio vulnificus (strain CMCP6)
Q73LZ4 3.41e-05 47 27 4 129 3 guaA GMP synthase [glutamine-hydrolyzing] Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
A3PA84 4.08e-05 47 30 7 128 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9301)
A9BER7 4.19e-05 47 29 6 127 3 guaA GMP synthase [glutamine-hydrolyzing] Petrotoga mobilis (strain DSM 10674 / SJ95)
Q5L3Y1 4.96e-05 45 25 8 182 1 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Geobacillus kaustophilus (strain HTA426)
B0BUD1 5.29e-05 45 30 1 85 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GXB7 5.29e-05 45 30 1 85 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A3MZT9 5.34e-05 45 30 1 85 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Actinobacillus pleuropneumoniae serotype 5b (strain L20)
Q04F27 5.55e-05 45 24 6 170 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
O29741 7.72e-05 45 26 9 187 3 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q7V9A9 9.89e-05 45 28 7 154 3 guaA GMP synthase [glutamine-hydrolyzing] Prochlorococcus marinus (strain MIT 9313)
Q2NS52 0.000234 44 29 5 134 3 guaA GMP synthase [glutamine-hydrolyzing] Sodalis glossinidius (strain morsitans)
P83813 0.000244 43 25 6 165 1 pdxT Pyridoxal 5'-phosphate synthase subunit PdxT Geobacillus stearothermophilus
B9L0W3 0.000283 44 30 5 126 3 guaA GMP synthase [glutamine-hydrolyzing] Thermomicrobium roseum (strain ATCC 27502 / DSM 5159 / P-2)
Q0AW22 0.000322 44 28 5 130 3 guaA GMP synthase [glutamine-hydrolyzing] Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS01095
Feature type CDS
Gene hisH
Product imidazole glycerol phosphate synthase subunit HisH
Location 231652 - 232248 (strand: -1)
Length 597 (nucleotides) / 198 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1254
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00117 Glutamine amidotransferase class-I

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0118 Amino acid transport and metabolism (E) E Imidazoleglycerol phosphate synthase glutamine amidotransferase subunit HisH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02501 imidazole glycerol-phosphate synthase subunit HisH [EC:4.3.2.10] Histidine metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Biosynthesis of amino acids
Histidine biosynthesis, PRPP => histidine

Protein Sequence

MNIVITDTGCANIASVRYAIERLGYKPVVTADSNLIRQADKVFLPGVGTAGAAMENLAERGLISTIRALTQPVLGICLGMQLLAATSEENNIPLLGLIDTPVRKMTPQGLPVPHMGWNTVDFTADSPLFRDIAPQSYFYFVHSYACPVSDATIATTTYGDTFTSILRRDNFYGVQFHPERSGKTGITLIKNFLEMDAL

Flanking regions ( +/- flanking 50bp)

GCTATCCGCGTGGAAGGGGATGTCCTGCCCAGCTCGAAAGGGGTGTTGTGATGAACATTGTCATTACCGACACCGGCTGCGCCAATATCGCGTCCGTCCGCTATGCGATTGAGCGCCTGGGCTACAAGCCGGTGGTCACCGCAGACAGCAACCTTATCCGTCAGGCAGACAAAGTATTTCTGCCCGGCGTCGGTACTGCGGGTGCGGCGATGGAAAATCTGGCTGAGCGCGGGCTTATCAGCACGATCCGCGCACTGACACAACCGGTGCTCGGCATCTGTCTGGGAATGCAGCTTCTCGCTGCCACCAGCGAAGAAAACAATATCCCTCTGCTCGGGCTGATTGATACCCCGGTCAGGAAAATGACCCCGCAGGGTCTGCCGGTGCCGCACATGGGCTGGAACACGGTAGATTTTACTGCTGATTCGCCATTGTTCCGCGATATCGCACCACAGAGTTATTTCTATTTTGTTCACAGTTACGCCTGTCCGGTGAGTGACGCGACGATCGCCACCACCACTTACGGCGATACCTTCACCAGTATCCTGCGCCGCGATAACTTTTACGGGGTACAATTTCACCCCGAGCGCTCGGGCAAAACAGGGATAACACTGATTAAAAATTTTCTGGAGATGGATGCCTTATGATCATTCCGGCACTGGATTTAATCGACGGACAAGTTGTGCGCCTTCACCAG