Homologs in group_82

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02425 FBDBKF_02425 100.0 Morganella morganii S1 malX Phosphotransferase system IIB components
FBDBKF_04790 FBDBKF_04790 55.8 Morganella morganii S1 malX Phosphotransferase system IIB components
EHELCC_02895 EHELCC_02895 100.0 Morganella morganii S2 malX Phosphotransferase system IIB components
EHELCC_06080 EHELCC_06080 55.8 Morganella morganii S2 malX Phosphotransferase system IIB components
NLDBIP_06400 NLDBIP_06400 55.8 Morganella morganii S4 malX Phosphotransferase system IIB components
LHKJJB_01470 LHKJJB_01470 100.0 Morganella morganii S3 malX Phosphotransferase system IIB components
LHKJJB_03280 LHKJJB_03280 55.8 Morganella morganii S3 malX Phosphotransferase system IIB components
HKOGLL_01510 HKOGLL_01510 100.0 Morganella morganii S5 malX Phosphotransferase system IIB components
HKOGLL_06755 HKOGLL_06755 55.8 Morganella morganii S5 malX Phosphotransferase system IIB components
F4V73_RS04800 F4V73_RS04800 93.5 Morganella psychrotolerans malX maltose/glucose-specific PTS transporter subunit IIBC
F4V73_RS09260 F4V73_RS09260 55.6 Morganella psychrotolerans malX maltose/glucose-specific PTS transporter subunit IIBC

Distribution of the homologs in the orthogroup group_82

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_82

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P19642 0.0 843 77 1 527 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
P20166 7.53e-109 343 38 13 536 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q7CCJ4 4.31e-105 332 39 14 512 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 4.31e-105 332 39 14 512 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 4.31e-105 332 39 14 512 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
Q4L945 2.38e-102 325 38 12 514 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q7A807 7.34e-100 319 38 14 515 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 7.34e-100 319 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 7.34e-100 319 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 7.34e-100 319 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 7.34e-100 319 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A0C4 1.34e-99 318 38 11 512 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NYM1 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 1.26e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q2YUZ1 1.97e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GKB7 2.01e-97 313 38 14 515 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q7A3G4 8.88e-97 311 37 11 519 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 8.88e-97 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 8.88e-97 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NUS2 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
A5IVW5 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
Q2FV87 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
A6U4R9 1.25e-96 311 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
Q2YWC1 3.2e-96 310 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GDR0 3.48e-96 310 37 11 519 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q53922 2.46e-94 305 37 12 530 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
Q57071 2.09e-92 299 37 13 531 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
P69786 1.76e-87 281 37 15 515 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 1.76e-87 281 37 15 515 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 1.76e-87 281 37 15 515 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
P37439 4.97e-86 277 35 14 516 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q89AG6 1.03e-80 263 35 16 517 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P39816 1.14e-79 265 34 13 526 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
P57437 1.17e-75 250 34 15 517 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q8K9J0 8.29e-73 242 36 18 517 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P54715 3.51e-71 239 30 12 542 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
C7NB69 9.17e-71 238 32 15 546 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
Q9AGA7 2.53e-69 235 32 13 553 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
P09323 6.24e-67 231 33 9 518 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
O06900 3.36e-66 226 31 14 542 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
P45604 1.92e-63 222 34 10 514 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
O34521 4.64e-60 208 32 11 518 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P35595 2.54e-56 204 28 15 562 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q9S2H4 8.33e-50 179 30 10 430 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P31452 7.39e-41 154 33 6 379 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
P75569 3.58e-32 135 34 6 255 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 4.07e-30 129 32 6 270 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47315 1.46e-29 127 32 4 252 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 9.37e-28 121 32 6 263 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P42015 1.03e-27 116 42 5 169 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
P69790 4.71e-15 76 39 4 127 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 4.71e-15 76 39 4 127 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q6GKB4 2.91e-09 63 40 4 86 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 2.91e-09 63 40 4 86 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7A1Y1 1.32e-08 60 39 4 86 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 1.32e-08 60 39 4 86 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 1.32e-08 60 39 4 86 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 1.32e-08 60 39 4 86 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 1.32e-08 60 39 4 86 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 1.32e-08 60 39 4 86 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 1.32e-08 60 39 4 86 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q9S2H6 1.5e-08 55 43 1 71 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q7N9D9 3.6e-08 59 30 3 89 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q9CKN5 7.3e-08 58 39 2 73 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Pasteurella multocida (strain Pm70)
Q31Y50 1.28e-07 57 39 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
Q32DC5 1.82e-07 57 39 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
P77272 1.94e-07 57 39 3 87 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q83QN3 2.02e-07 57 39 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q1R8U3 2.1e-07 57 39 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q8FFA9 2.25e-07 57 39 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8XBJ1 2.29e-07 57 39 3 87 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q9KVD9 1.48e-06 54 31 2 86 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q87FD5 2.35e-06 53 33 5 92 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KF90 3.24e-06 53 38 2 85 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P24241 3.51e-06 53 33 0 81 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q49ZN7 4.89e-06 52 38 3 72 3 SSP0594 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P05306 7.41e-06 52 40 1 66 1 sacP PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)
Q45298 9.21e-06 52 40 1 71 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
Q7MBS2 1.02e-05 52 34 3 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)
Q8D4Z3 1.03e-05 52 34 3 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)
Q46072 1.21e-05 52 40 1 71 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
P26207 1.37e-05 51 38 1 86 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
P08722 2.33e-05 50 36 1 84 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)
Q5E5T6 3.2e-05 50 41 2 63 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4L8H5 4.01e-05 50 36 3 72 3 SH0741 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus haemolyticus (strain JCSC1435)
P51184 8.35e-05 48 34 2 85 3 scrA PTS system sucrose-specific EIIBC component Staphylococcus xylosus
P40739 8.49e-05 48 31 1 86 3 bglP PTS system beta-glucoside-specific EIIBCA component Bacillus subtilis (strain 168)
Q8CNB2 0.000119 48 33 4 87 3 SE_1890 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLT2 0.000119 48 33 4 87 3 SERP1900 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
P39794 0.000165 48 40 1 70 2 treP PTS system trehalose-specific EIIBC component Bacillus subtilis (strain 168)
P15400 0.000173 47 32 2 80 1 sacX Probable PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S4
Locus tag NLDBIP_00565
Feature type CDS
Gene malX
Product Phosphotransferase system IIB components
Location 111614 - 113230 (strand: 1)
Length 1617 (nucleotides) / 538 (amino acids)

Contig

Accession ZDB_519
Length 680340 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_82
Orthogroup size 12
N. genomes 6

Actions

Genomic region

Domains

PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02791 maltose/glucose PTS system EIICB component [EC:2.7.1.199 2.7.1.208] Glycolysis / Gluconeogenesis
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Phosphotransferase system (PTS)		 -

Protein Sequence

MSSQPKQKVTLWEFFQGLGKTFMLPVALLSFCGIILGIGSSLSSRDVLTLLPFLDHTVFQLLFTWMSKIGSFAFSFLPVMFAIAIPLGLARENKGVAAFAGFVGFAVFNLATNFYLIAADILPTTDPAILKAHNIRDVLGIQSIDSGILGAVIVGIIVYMLHERFNTIRLPDALAFFGGTRFVPIITTLVLGLCGLLVPLIWPWFAMGINGLGKLIQSAGAFGPMIFGSGERLLLPFGLHHILVALIRFTEAGGTMEVCGNTVNGALTIFQAQLSCPETQGFAASATQFLSQGKMPAFLGGLPGAALAMYHCAHPENRHKIKGLLISGVVACVIGGTTEPLEFLFLFVAPFLYLIHAILTGLGFTVMAITGVTIGNTDGNLIDFVVFGILHGIQTKWYMVPVVAFIWFASYYAIFRFAITRFNIKTPGRDTDTKESAPATGSSAGKSGYDVPAILAALGGKENIISLDNCITRLRMSVQDMSKVDDAQLKALRAIGVVHLNEHNLQVVIGPQVQSVKDELEKLIKSAPDSAQPEPQNA

Flanking regions ( +/- flanking 50bp)

TTATCTTATTTTACCTTCACAACACCACACTGACATTTACAGGATACCGTATGAGTAGCCAACCAAAACAAAAAGTCACGCTCTGGGAGTTTTTCCAGGGACTTGGCAAAACCTTTATGCTGCCTGTCGCGCTGCTCTCGTTCTGCGGGATCATCCTCGGCATCGGCAGTTCCCTCAGCAGCCGGGATGTACTGACACTGCTGCCGTTTCTGGATCACACCGTCTTCCAGTTACTGTTCACCTGGATGAGCAAAATCGGCTCATTTGCCTTCAGTTTCCTGCCGGTGATGTTTGCTATTGCCATTCCGCTGGGGCTGGCGCGTGAAAACAAGGGTGTGGCTGCATTTGCCGGGTTTGTCGGCTTTGCGGTATTTAACCTCGCCACTAACTTCTACCTCATTGCCGCTGATATTTTACCGACTACCGACCCTGCTATCCTGAAAGCCCATAACATCCGTGATGTGCTGGGGATCCAGTCAATCGACAGCGGGATCCTCGGTGCGGTTATTGTCGGTATTATTGTGTATATGCTGCATGAACGCTTCAATACCATCCGTCTGCCGGATGCCCTGGCGTTCTTCGGCGGTACCCGTTTTGTGCCGATTATCACCACCTTGGTACTCGGCCTGTGCGGCCTGCTGGTTCCGCTGATCTGGCCGTGGTTTGCTATGGGGATCAACGGATTAGGCAAACTGATTCAGAGCGCAGGCGCATTCGGTCCGATGATTTTCGGCTCCGGTGAACGGCTGTTACTGCCGTTTGGTCTGCATCACATACTGGTGGCGCTGATCCGCTTTACTGAAGCGGGCGGCACCATGGAAGTATGCGGCAATACGGTTAACGGCGCACTGACCATTTTCCAGGCGCAGCTCTCCTGCCCGGAAACCCAAGGCTTTGCGGCCAGTGCCACACAGTTCCTGTCTCAGGGTAAAATGCCGGCGTTCCTCGGCGGCCTGCCGGGTGCGGCATTAGCGATGTATCACTGTGCTCATCCTGAAAATCGTCATAAAATTAAGGGATTACTGATTTCCGGTGTGGTTGCCTGTGTTATCGGCGGCACAACTGAACCGCTGGAATTCCTGTTCCTGTTTGTCGCGCCGTTCCTGTATCTGATCCACGCAATTCTGACCGGCCTGGGCTTCACCGTAATGGCGATTACCGGTGTCACTATCGGTAACACCGACGGTAACCTGATTGACTTTGTGGTCTTCGGGATCCTCCACGGTATCCAGACCAAGTGGTATATGGTGCCGGTGGTGGCCTTTATCTGGTTCGCTTCTTACTATGCGATTTTCCGTTTCGCCATTACCCGCTTCAATATCAAAACCCCGGGCCGCGATACAGACACCAAAGAAAGCGCACCGGCAACCGGCAGTTCCGCAGGAAAATCCGGCTATGATGTTCCGGCTATTCTGGCGGCGCTGGGCGGTAAAGAGAACATTATTTCACTGGATAACTGTATCACCCGTCTGCGGATGTCCGTGCAGGACATGAGCAAAGTGGATGACGCACAGCTTAAAGCATTGCGGGCGATCGGGGTTGTCCATCTGAATGAACATAACTTACAGGTGGTTATCGGCCCGCAGGTTCAGTCTGTCAAAGATGAACTGGAAAAGCTGATAAAATCCGCGCCTGATTCCGCTCAGCCGGAACCGCAAAACGCCTGATAACTGACACCGCACTGCCTGACAGTGCGGTTTTTCTTTACGGAGAAACT