Homologs in group_82

Help

11 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02425 FBDBKF_02425 55.6 Morganella morganii S1 malX Phosphotransferase system IIB components
FBDBKF_04790 FBDBKF_04790 95.8 Morganella morganii S1 malX Phosphotransferase system IIB components
EHELCC_02895 EHELCC_02895 55.6 Morganella morganii S2 malX Phosphotransferase system IIB components
EHELCC_06080 EHELCC_06080 95.8 Morganella morganii S2 malX Phosphotransferase system IIB components
NLDBIP_00565 NLDBIP_00565 55.6 Morganella morganii S4 malX Phosphotransferase system IIB components
NLDBIP_06400 NLDBIP_06400 95.8 Morganella morganii S4 malX Phosphotransferase system IIB components
LHKJJB_01470 LHKJJB_01470 55.6 Morganella morganii S3 malX Phosphotransferase system IIB components
LHKJJB_03280 LHKJJB_03280 95.8 Morganella morganii S3 malX Phosphotransferase system IIB components
HKOGLL_01510 HKOGLL_01510 55.6 Morganella morganii S5 malX Phosphotransferase system IIB components
HKOGLL_06755 HKOGLL_06755 95.8 Morganella morganii S5 malX Phosphotransferase system IIB components
F4V73_RS04800 F4V73_RS04800 54.4 Morganella psychrotolerans malX maltose/glucose-specific PTS transporter subunit IIBC

Distribution of the homologs in the orthogroup group_82

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_82

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P19642 0.0 558 53 3 527 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
Q7CCJ4 3.07e-102 324 38 12 519 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 3.07e-102 324 38 12 519 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 3.07e-102 324 38 12 519 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
P20166 1.85e-101 323 37 14 531 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q4L945 2.55e-101 322 39 13 519 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q7A807 4.78e-101 322 38 12 520 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 4.78e-101 322 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 4.78e-101 322 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 4.78e-101 322 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 4.78e-101 322 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q4A0C4 6.72e-101 321 39 11 513 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8NYM1 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 2.37e-98 315 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q6GKB7 5.73e-98 313 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q2YUZ1 6.58e-98 313 38 12 520 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NUS2 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
A5IVW5 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
Q2FV87 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
A6U4R9 4.74e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
Q7A3G4 5e-94 303 35 10 528 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 5e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 5e-94 303 35 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q6GDR0 5.27e-94 303 34 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q2YWC1 1.32e-93 302 34 10 528 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q53922 2.77e-93 301 35 11 532 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
Q57071 1.49e-87 286 36 10 517 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
P69786 1.97e-79 259 36 17 525 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 1.97e-79 259 36 17 525 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 1.97e-79 259 36 17 525 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
P39816 6.69e-78 259 34 15 519 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
P37439 1.27e-77 254 35 15 518 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C7NB69 4.09e-69 234 31 14 540 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
P57437 5.44e-68 229 31 16 518 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AG6 4.38e-65 222 31 15 516 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
O06900 7.15e-64 219 29 11 534 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
O34521 1.21e-61 212 32 11 512 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P54715 3.55e-61 213 28 10 533 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
P09323 3.66e-60 213 32 13 518 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
Q9AGA7 5.02e-57 202 30 13 541 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
Q8K9J0 2.53e-55 196 30 13 526 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P45604 5.02e-52 190 32 13 518 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
Q9S2H4 1.04e-44 166 29 8 427 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P35595 3.34e-38 152 26 16 564 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P31452 1.3e-27 117 28 10 388 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
P47315 9.25e-26 115 29 4 251 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 4.15e-17 88 30 7 257 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P75569 3.56e-25 113 31 8 255 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 1.62e-16 86 30 10 273 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P42015 4.72e-25 108 43 5 160 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
P69790 2.36e-16 80 39 5 133 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 2.36e-16 80 39 5 133 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q9S2H6 1.05e-07 52 38 1 71 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CKN5 8.63e-07 55 50 3 62 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Pasteurella multocida (strain Pm70)
Q31Y50 9.64e-07 55 50 1 60 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)
P51184 1.04e-06 55 40 1 77 3 scrA PTS system sucrose-specific EIIBC component Staphylococcus xylosus
P77272 1.54e-06 54 48 1 60 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q32DC5 1.57e-06 54 48 1 60 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
Q83QN3 1.6e-06 54 48 1 60 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q1R8U3 1.87e-06 54 48 1 60 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
Q8XBJ1 1.94e-06 53 48 1 60 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q8FFA9 2.1e-06 53 48 1 60 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7A1Y1 6.44e-06 52 41 1 58 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 6.44e-06 52 41 1 58 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 6.44e-06 52 41 1 58 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 6.44e-06 52 41 1 58 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 6.44e-06 52 41 1 58 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 6.44e-06 52 41 1 58 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 6.44e-06 52 41 1 58 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q6GKB4 6.67e-06 52 41 1 58 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 6.67e-06 52 41 1 58 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q49ZN7 8.38e-06 52 42 2 71 3 SSP0594 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q9KF90 1.22e-05 51 38 1 71 3 bglP PTS system beta-glucoside-specific EIIBCA component Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P24241 1.39e-05 51 46 2 63 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q797S1 3.92e-05 50 40 3 71 3 ybbF Putative PTS system EIIBC component YbbF Bacillus subtilis (strain 168)
Q5E5T6 5.21e-05 49 42 2 59 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q45298 5.99e-05 49 42 1 63 3 ptsG PTS system glucose-specific EIIBCA component Corynebacterium glutamicum
P08722 7.09e-05 49 41 0 63 1 bglF PTS system beta-glucoside-specific EIIBCA component Escherichia coli (strain K12)
Q7N9D9 7.71e-05 48 34 0 58 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
P05306 8.3e-05 48 45 0 53 1 sacP PTS system sucrose-specific EIIBC component Bacillus subtilis (strain 168)
Q46072 8.8e-05 48 42 1 63 4 ptsM PTS system mannose-specific EIIBCA component Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q9KVD9 0.00015 48 36 3 73 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P26207 0.00017 48 35 0 70 3 arbF PTS system beta-glucoside-specific EIIBCA component Dickeya chrysanthemi
P12655 0.000231 47 47 3 59 1 scrA PTS system sucrose-specific EIIBCA component Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
P22825 0.000327 47 52 0 38 3 scrA PTS system sucrose-specific EIIBC component Vibrio alginolyticus
Q4L8H5 0.000478 46 34 1 58 3 SH0741 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus haemolyticus (strain JCSC1435)
Q87FD5 0.000495 46 31 1 72 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D4Z3 0.000595 46 34 0 58 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain CMCP6)
Q7MBS2 0.000605 46 34 0 58 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Vibrio vulnificus (strain YJ016)
Q9CJZ2 0.001 45 36 1 72 3 scrA PTS system sucrose-specific EIIBC component Pasteurella multocida (strain Pm70)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS09260
Feature type CDS
Gene malX
Product maltose/glucose-specific PTS transporter subunit IIBC
Location 1939328 - 1940899 (strand: 1)
Length 1572 (nucleotides) / 523 (amino acids)

Contig

Accession term accessions NZ_VXKB01000001 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_82
Orthogroup size 12
N. genomes 6

Actions

Genomic region

Domains

PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02791 maltose/glucose PTS system EIICB component [EC:2.7.1.199 2.7.1.208] Glycolysis / Gluconeogenesis
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Phosphotransferase system (PTS)		 -

Protein Sequence

MSQEKSFKSKLWAFFQSLGKTFMFPVSLLAFMGLLLGVGSSVTSPSAISSFPFLGNEFVQLTFGFMAMVGGFAFTYLPVMFAMAIPFGLSNRNKAVGAFAGFVGYMLMNMSINYYLTVTHQLADPAMMKQVGQSVVLGIQTLEMGVLGGIVVGIITYFLHERFQDTELHDAFAFFGGIRFVPIITALTLSLVGLAIPFLWRYVAMGIAGIGHIIQSTDVFGPFLYGVGVLLLKPFGLHHILLAMVRFTPAGGTEMVDGYEIAGALNIFYAELKAGLPFSPHITAFLSQGFMPTFIFGLPAVAYAIYRTAKPANRPVIKGLLLSGVLVSVVTGISEPIEFLFLFIAPVLYIFHIIMSGLALLVMALLGVTIGNTDGGILDLLIFGIMQGTATKWYLVFPVGVIWFAIYFFVFRWYILKHDVKTPGREDASEGAEQAVPANTRARGKSKYDHNLILTALGGKENIDSLDNCITRLRLVVKDMSKIDKKILKDAGALSVVVLDAHSVQVIIGPQVQSVKSGLEALI

Flanking regions ( +/- flanking 50bp)

GCAATACCCCTTAACCAATAAATTATAAAGAAGCTGAGGAGTACTCTACGATGTCGCAGGAAAAGTCGTTTAAATCTAAGCTCTGGGCATTTTTTCAAAGTCTGGGAAAAACCTTTATGTTTCCCGTGTCATTACTGGCTTTCATGGGATTATTACTGGGGGTCGGCAGTTCAGTCACCAGCCCTTCCGCAATCAGCAGTTTTCCGTTTCTCGGCAATGAATTTGTTCAGCTGACATTCGGTTTTATGGCCATGGTCGGCGGCTTCGCCTTTACCTATCTGCCTGTTATGTTCGCCATGGCTATCCCGTTTGGTCTGTCAAACCGCAATAAAGCGGTCGGCGCATTTGCAGGGTTTGTCGGCTATATGCTGATGAATATGAGCATCAACTATTATCTGACCGTCACCCACCAGCTCGCCGATCCCGCCATGATGAAGCAGGTCGGGCAATCCGTGGTACTGGGGATCCAGACTCTCGAAATGGGCGTGCTGGGCGGAATTGTTGTCGGCATCATTACCTATTTTCTGCACGAGCGCTTTCAGGATACTGAGCTGCATGATGCTTTTGCGTTCTTCGGCGGGATCCGTTTTGTCCCGATTATCACCGCACTGACGCTTTCTCTCGTCGGGCTGGCAATTCCGTTCCTGTGGCGCTATGTGGCAATGGGGATTGCCGGTATCGGACATATTATTCAGAGCACTGATGTATTCGGTCCTTTCCTCTATGGTGTCGGCGTGCTGTTACTGAAGCCTTTCGGATTACACCATATTCTTCTGGCAATGGTCCGCTTTACCCCGGCAGGCGGCACAGAGATGGTAGACGGCTATGAAATCGCCGGCGCACTGAATATTTTCTATGCCGAACTGAAAGCCGGACTTCCATTCAGCCCGCATATCACCGCCTTTCTGTCCCAGGGCTTTATGCCGACCTTTATCTTTGGTTTACCGGCGGTTGCCTATGCTATTTACCGCACAGCAAAACCAGCTAACCGTCCGGTTATCAAAGGATTATTACTCTCCGGTGTGCTGGTTTCTGTTGTCACCGGCATTTCAGAGCCGATTGAATTTCTGTTCCTGTTTATCGCCCCGGTGCTTTATATCTTCCATATCATTATGTCCGGCCTCGCATTACTGGTCATGGCTCTGCTCGGTGTCACGATAGGTAACACGGATGGCGGTATTCTGGATCTGCTGATTTTCGGGATAATGCAGGGCACTGCGACCAAATGGTATCTGGTGTTCCCGGTCGGGGTTATCTGGTTCGCAATCTACTTCTTTGTCTTCCGCTGGTACATTTTAAAGCATGATGTCAAAACCCCGGGACGCGAAGATGCCTCTGAAGGTGCAGAACAAGCCGTTCCCGCCAATACGCGCGCGCGCGGGAAATCAAAATACGATCATAATCTGATCCTGACAGCGCTTGGCGGTAAAGAGAATATTGACTCGCTCGACAACTGCATCACCCGCTTGCGTCTTGTGGTAAAAGACATGAGTAAAATCGACAAAAAAATACTGAAAGATGCCGGTGCATTGTCTGTCGTGGTACTGGATGCTCACAGTGTTCAGGTCATTATCGGACCGCAGGTACAGAGTGTGAAATCCGGCCTTGAAGCCTTAATTTAAACAGGAAGTGAGCATGTACAATTTTGACGAAATCATTGAGCGAAAAAGTG