Homologs in group_39

Help

12 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02425 FBDBKF_02425 41.5 Morganella morganii S1 malX Phosphotransferase system IIB components
FBDBKF_04790 FBDBKF_04790 40.0 Morganella morganii S1 malX Phosphotransferase system IIB components
EHELCC_02895 EHELCC_02895 41.5 Morganella morganii S2 malX Phosphotransferase system IIB components
EHELCC_06080 EHELCC_06080 40.0 Morganella morganii S2 malX Phosphotransferase system IIB components
NLDBIP_00565 NLDBIP_00565 41.5 Morganella morganii S4 malX Phosphotransferase system IIB components
NLDBIP_06400 NLDBIP_06400 40.0 Morganella morganii S4 malX Phosphotransferase system IIB components
LHKJJB_01470 LHKJJB_01470 41.5 Morganella morganii S3 malX Phosphotransferase system IIB components
LHKJJB_03280 LHKJJB_03280 40.0 Morganella morganii S3 malX Phosphotransferase system IIB components
HKOGLL_01510 HKOGLL_01510 41.5 Morganella morganii S5 malX Phosphotransferase system IIB components
HKOGLL_06755 HKOGLL_06755 40.0 Morganella morganii S5 malX Phosphotransferase system IIB components
F4V73_RS04800 F4V73_RS04800 40.5 Morganella psychrotolerans malX maltose/glucose-specific PTS transporter subunit IIBC
F4V73_RS09260 F4V73_RS09260 39.6 Morganella psychrotolerans malX maltose/glucose-specific PTS transporter subunit IIBC

Distribution of the homologs in the orthogroup group_39

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_39

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P37439 0.0 788 80 0 476 1 ptsG PTS system glucose-specific EIICB component Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P69786 0.0 788 81 0 476 1 ptsG PTS system glucose-specific EIICB component Escherichia coli (strain K12)
P69787 0.0 788 81 0 476 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P69788 0.0 788 81 0 476 3 ptsG PTS system glucose-specific EIICB component Escherichia coli O157:H7
P57437 0.0 687 68 0 477 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q89AG6 0.0 671 68 0 476 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q8K9J0 0.0 655 69 0 477 3 ptsG PTS system glucose-specific EIICB component Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q53922 2.92e-147 439 47 9 515 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus carnosus (strain TM300)
P20166 2.09e-145 435 47 7 514 1 ptsG PTS system glucose-specific EIICBA component Bacillus subtilis (strain 168)
Q4A0C4 6.01e-145 433 48 10 501 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q7A3G4 6.78e-144 431 47 8 509 1 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain N315)
Q99R97 6.78e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7X6P1 6.78e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NUS2 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z3D6 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6G6D6 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QK27 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HD13 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain COL)
A5IVW5 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH9)
Q2FV87 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FDW8 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain USA300)
A6U4R9 9.58e-144 431 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain JH1)
P39816 2.54e-143 427 48 7 477 2 gamP PTS system glucosamine-specific EIICBA component Bacillus subtilis (strain 168)
Q6GDR0 4.44e-143 429 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q2YWC1 9.77e-143 428 47 8 509 3 glcB PTS system glucoside-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GKB7 1.91e-141 424 48 9 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MRSA252)
Q7A807 4.15e-141 423 47 9 499 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain N315)
Q99X32 4.15e-141 423 47 9 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IP58 4.15e-141 423 47 9 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH9)
A6TXX3 4.15e-141 423 47 9 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain JH1)
A7WXI2 4.15e-141 423 47 9 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q8NYM1 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MW2)
A8Z0F5 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300 / TCH1516)
Q6GCT7 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain MSSA476)
A6QDH3 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain Newman)
Q5HJI3 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain COL)
Q2G1G8 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK73 4.52e-141 423 48 10 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain USA300)
Q2YUZ1 6.39e-141 423 48 9 499 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q7CCJ4 3.02e-140 421 46 7 509 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HL73 3.02e-140 421 46 7 509 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8VRH0 3.02e-140 421 46 7 509 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus epidermidis
Q4L945 9.43e-138 415 47 10 502 3 ptsG PTS system glucose-specific EIICBA component Staphylococcus haemolyticus (strain JCSC1435)
Q57071 2.09e-129 393 46 9 503 1 ptsG PTS system glucose-specific EIICBA component Staphylococcus carnosus (strain TM300)
P09323 1.83e-104 328 39 9 485 1 nagE PTS system N-acetylglucosamine-specific EIICBA component Escherichia coli (strain K12)
P45604 1.85e-104 328 41 9 485 3 nagE PTS system N-acetylglucosamine-specific EIICBA component Klebsiella pneumoniae
Q9S2H4 9.77e-104 318 46 7 398 1 nagE2 PTS system N-acetylglucosamine-specific EIIC component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
O34521 7.02e-100 310 42 8 473 1 nagP PTS system N-acetylglucosamine-specific EIICB component Bacillus subtilis (strain 168)
P19642 5.45e-93 295 37 17 526 1 malX PTS system maltose-specific EIICB component Escherichia coli (strain K12)
Q9AGA7 8.03e-66 224 32 17 535 4 aglA PTS system alpha-glucoside-specific EIICB component Klebsiella pneumoniae
P54715 6.16e-62 213 28 14 536 1 malP PTS system maltose-specific EIICB component Bacillus subtilis (strain 168)
P35595 8.74e-61 214 30 16 554 3 exp5 PTS system glucose-specific EIICBA component Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
C7NB69 4.63e-60 208 29 13 534 3 Lebu_1527 PTS system alpha-glucoside-specific EIICB component Leptotrichia buccalis (strain ATCC 14201 / DSM 1135 / JCM 12969 / NCTC 10249 / C-1013-b)
O06900 1.25e-58 204 30 15 528 4 malB PTS system alpha-glucoside-specific EIICB component Fusobacterium mortiferum
P75569 3.03e-38 152 38 5 253 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P75569 1.3e-26 117 32 7 246 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47315 7.16e-38 151 34 8 318 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P47315 1.58e-27 120 33 7 236 3 ptsG PTS system glucose-specific EIICBA component Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
P31452 1.68e-36 141 32 13 379 1 glvC Phosphotransferase IIC component GlvC Escherichia coli (strain K12)
P42015 2.98e-31 125 47 2 153 3 ptsG PTS system glucose-specific EIICBA component (Fragment) Geobacillus stearothermophilus
P69790 8.56e-17 80 35 5 151 3 glvB Phosphotransferase enzyme IIB component GlvB Shigella flexneri
P69789 8.56e-17 80 35 5 151 3 glvB Phosphotransferase enzyme IIB component GlvB Escherichia coli (strain K12)
Q9S2H6 3.03e-09 57 36 0 76 1 nagF PTS system N-acetylglucosamine-specific EIIB component Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q9CKN5 1.43e-08 60 41 1 74 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Pasteurella multocida (strain Pm70)
Q7A1Y1 5.17e-06 52 36 0 68 3 MW0166 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MW2)
Q6GCT4 5.17e-06 52 36 0 68 3 SAS0167 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MSSA476)
Q7A804 5.17e-06 52 36 0 68 1 SA0186 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain N315)
Q99X29 5.17e-06 52 36 0 68 3 SAV0192 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HJI0 5.17e-06 52 36 0 68 3 SACOL0178 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain COL)
Q2G1G5 5.17e-06 52 36 0 68 3 SAOUHSC_00158 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FK70 5.17e-06 52 36 0 68 1 murP PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain USA300)
Q6GKB4 5.4e-06 52 36 0 68 3 SAR0193 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain MRSA252)
Q2YV12 5.4e-06 52 36 0 68 3 SAB0132 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8XBJ1 2.78e-05 50 33 1 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O157:H7
Q8FFA9 2.85e-05 50 33 1 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1R8U3 2.95e-05 50 33 1 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain UTI89 / UPEC)
P24241 3.69e-05 49 40 1 65 3 ascF PTS system arbutin-, cellobiose-, and salicin-specific EIIBC component Escherichia coli (strain K12)
Q49ZN7 5.92e-05 49 31 1 76 3 SSP0594 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q5E5T6 7.8e-05 48 35 1 64 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8CNB2 8.05e-05 48 36 0 66 3 SE_1890 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HLT2 8.05e-05 48 36 0 66 3 SERP1900 PTS system MurNAc-GlcNAc-specific EIIBC component Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q32DC5 8.78e-05 48 32 1 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella dysenteriae serotype 1 (strain Sd197)
P77272 0.000102 48 32 1 78 1 murP PTS system N-acetylmuramic acid-specific EIIBC component Escherichia coli (strain K12)
Q83QN3 0.000108 48 32 1 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella flexneri
Q9PQW5 0.000152 45 41 0 51 3 UU178 Putative phosphotransferase enzyme IIB component UU178 Ureaplasma parvum serovar 3 (strain ATCC 700970)
Q9CJZ2 0.000183 47 38 1 68 3 scrA PTS system sucrose-specific EIIBC component Pasteurella multocida (strain Pm70)
Q31Y50 0.000538 46 30 1 78 3 murP PTS system N-acetylmuramic acid-specific EIIBC component Shigella boydii serotype 4 (strain Sb227)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS11320
Feature type CDS
Gene ptsG
Product PTS glucose transporter subunit IIBC
Location 2492061 - 2493509 (strand: -1)
Length 1449 (nucleotides) / 482 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_39
Orthogroup size 13
N. genomes 7

Actions

Genomic region

Domains

PF00367 phosphotransferase system, EIIB
PF02378 Phosphotransferase system, EIIC

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1263 Carbohydrate transport and metabolism (G) G Phosphotransferase system IIC components, glucose/maltose/N-acetylglucosamine-specific

Protein Sequence

MFKNLFVVLQKIGKSLMLPVSVLPIAGILLGVGSAGLSWIPVSVSQVMAEAGGSVFSNMPLIFAIGVALGFTNNDGVSALASVVAYGIMSKTMLVVAPWVLGLSPDSVEIQRLTDTGVLGGIIAGIIAASMFNRFYRIKLPEYLGFFAGKRFVPIISGLIAIFVGILLSFIWPPIGTAIQRFSEWAAYQNPAVAFGIYGVVERALVPFGLHHIWNVPFQMQVGEYVNSAGQVFHGDIPRYMAGDPTAGMLSGGFLFKMFGLPAAAIAIWHTARPENRVKVGGIMISAALTAFLTGITEPIEFSFMFVAPILYVIHAILAGLAFVICILLGMRDGTSFSHGLIDFIVLSGNSSKLYLFPIIGILYAITYYSIFRFLIVKLNLKTPGREVEDKNAKQADKSAMGQSLVAAFGGKDNISSLDACITRLRIGVKEIDKVDRDELKRLGAAGVVVVGSGIQAIFGPKSDNLKTEMDEYIRSIGTTEK

Flanking regions ( +/- flanking 50bp)

ACAAATAAAAAACTTATAACACATACAACCCATATTCGGGAGTCTGCTTGATGTTTAAAAACCTATTTGTTGTTTTACAAAAAATTGGAAAATCCTTAATGTTACCGGTATCTGTGCTACCTATTGCCGGTATCTTACTAGGGGTTGGGTCTGCGGGACTATCATGGATCCCTGTCTCTGTTTCTCAAGTGATGGCAGAAGCGGGGGGATCGGTTTTCTCTAATATGCCACTGATTTTTGCTATTGGTGTGGCGTTAGGTTTTACCAATAATGATGGTGTCTCAGCTCTTGCGTCCGTCGTTGCCTATGGCATTATGTCAAAAACCATGCTGGTGGTGGCACCTTGGGTCTTAGGATTATCTCCTGATAGTGTTGAAATACAACGTTTAACTGATACGGGGGTACTCGGTGGGATCATTGCCGGTATTATTGCCGCATCAATGTTTAACCGCTTTTATCGTATTAAACTTCCTGAATATTTAGGCTTCTTTGCAGGTAAACGTTTTGTACCTATTATTTCTGGTCTGATTGCGATTTTTGTCGGTATTCTTTTATCCTTTATTTGGCCTCCTATTGGTACTGCTATTCAACGTTTTTCTGAGTGGGCTGCGTATCAAAATCCAGCCGTTGCATTTGGTATTTATGGTGTTGTTGAGCGTGCGTTAGTGCCATTTGGTCTGCATCATATCTGGAATGTACCATTCCAAATGCAAGTGGGTGAGTATGTAAATAGCGCAGGACAAGTGTTCCACGGTGATATTCCACGTTATATGGCAGGTGATCCAACTGCGGGGATGTTATCAGGTGGCTTCCTATTTAAAATGTTCGGTCTACCTGCGGCGGCCATTGCTATTTGGCATACAGCACGTCCTGAAAACCGTGTAAAAGTTGGCGGGATCATGATTTCTGCGGCATTGACTGCCTTTTTAACAGGGATCACAGAGCCAATTGAATTCTCATTTATGTTCGTAGCACCTATTCTTTATGTTATTCATGCCATTCTTGCCGGTTTAGCATTTGTTATTTGTATCTTGTTAGGTATGCGTGACGGTACAAGTTTTTCTCATGGTTTAATCGACTTTATCGTATTGAGTGGCAATAGCAGTAAACTGTATCTATTCCCAATTATTGGCATACTTTATGCGATAACTTATTACTCTATTTTCCGTTTCTTAATCGTGAAACTAAACCTGAAAACCCCAGGGCGAGAAGTAGAAGATAAAAACGCGAAACAAGCGGATAAAAGTGCGATGGGACAATCTTTAGTCGCTGCTTTCGGTGGTAAAGATAATATCAGTAGCTTAGATGCTTGTATTACACGCTTGCGTATTGGTGTAAAAGAGATTGATAAGGTCGATCGTGATGAGCTGAAAAGACTGGGAGCGGCTGGTGTTGTGGTGGTTGGATCCGGTATTCAAGCCATTTTTGGCCCTAAGTCTGATAATTTAAAAACTGAAATGGATGAATATATTCGGTCTATAGGTACAACTGAAAAATAAATTATTTTTGACTAAATTAGAAAACACTCTTATGCATCAGCTAAGAGTGT