Homologs in group_2330

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17635 FBDBKF_17635 100.0 Morganella morganii S1 thiC phosphomethylpyrimidine synthase ThiC
EHELCC_18120 EHELCC_18120 100.0 Morganella morganii S2 thiC phosphomethylpyrimidine synthase ThiC
NLDBIP_18030 NLDBIP_18030 100.0 Morganella morganii S4 thiC phosphomethylpyrimidine synthase ThiC
HKOGLL_17975 HKOGLL_17975 100.0 Morganella morganii S5 thiC phosphomethylpyrimidine synthase ThiC
F4V73_RS15015 F4V73_RS15015 94.6 Morganella psychrotolerans thiC phosphomethylpyrimidine synthase ThiC
PMI_RS13715 PMI_RS13715 85.2 Proteus mirabilis HI4320 thiC phosphomethylpyrimidine synthase ThiC

Distribution of the homologs in the orthogroup group_2330

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2330

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q7N963 0.0 1171 85 1 643 3 thiC Phosphomethylpyrimidine synthase Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q6DAM0 0.0 1155 84 2 648 3 thiC Phosphomethylpyrimidine synthase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
B7UPE9 0.0 1133 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A8AKS9 0.0 1133 85 1 624 3 thiC Phosphomethylpyrimidine synthase Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
Q3YUZ0 0.0 1132 85 1 624 3 thiC Phosphomethylpyrimidine synthase Shigella sonnei (strain Ss046)
B7LUK8 0.0 1132 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q83PB8 0.0 1132 85 1 624 3 thiC Phosphomethylpyrimidine synthase Shigella flexneri
Q0SY06 0.0 1132 85 1 624 3 thiC Phosphomethylpyrimidine synthase Shigella flexneri serotype 5b (strain 8401)
Q0TA71 0.0 1132 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q66FP5 0.0 1131 81 3 665 3 thiC Phosphomethylpyrimidine synthase Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8ZAQ2 0.0 1131 81 3 665 3 thiC Phosphomethylpyrimidine synthase Yersinia pestis
B1IUQ3 0.0 1131 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
B7LA88 0.0 1131 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain 55989 / EAEC)
B6I5K5 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain SE11)
P30136 0.0 1130 85 1 624 1 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain K12)
Q8FB77 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A8A794 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O9:H4 (strain HS)
B1XBZ7 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain K12 / DH10B)
C5A0T5 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain K12 / MC4100 / BW2952)
B7M7Q3 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O8 (strain IAI1)
B7NRS7 0.0 1130 84 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B5Z090 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6X9 0.0 1130 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O157:H7
B7NFT5 0.0 1130 84 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7MRC0 0.0 1129 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O81 (strain ED1a)
A7ZUK9 0.0 1129 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O139:H28 (strain E24377A / ETEC)
A1AIG5 0.0 1129 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O1:K1 / APEC
B7MIY0 0.0 1129 85 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli O45:K1 (strain S88 / ExPEC)
B1LNU6 0.0 1128 84 1 624 3 thiC Phosphomethylpyrimidine synthase Escherichia coli (strain SMS-3-5 / SECEC)
Q31U03 0.0 1127 85 1 624 3 thiC Phosphomethylpyrimidine synthase Shigella boydii serotype 4 (strain Sb227)
B2TWI1 0.0 1125 84 1 624 3 thiC Phosphomethylpyrimidine synthase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q32AG7 0.0 1125 84 1 624 3 thiC Phosphomethylpyrimidine synthase Shigella dysenteriae serotype 1 (strain Sd197)
B4TCT3 0.0 1121 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella heidelberg (strain SL476)
Q9L9I7 0.0 1120 84 1 624 1 thiC Phosphomethylpyrimidine synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4T0Z6 0.0 1120 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella newport (strain SL254)
A9N0K6 0.0 1120 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BJR3 0.0 1118 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella paratyphi A (strain AKU_12601)
Q5PKA6 0.0 1118 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TQK4 0.0 1118 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella schwarzengrund (strain CVM19633)
B5FQK9 0.0 1117 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella dublin (strain CT_02021853)
Q57H61 0.0 1117 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella choleraesuis (strain SC-B67)
Q8Z326 0.0 1117 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella typhi
C0Q2S6 0.0 1116 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella paratyphi C (strain RKS4594)
B5F1H7 0.0 1116 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella agona (strain SL483)
B5QYE9 0.0 1112 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella enteritidis PT4 (strain P125109)
B5XYE4 0.0 1112 84 1 624 3 thiC Phosphomethylpyrimidine synthase Klebsiella pneumoniae (strain 342)
B5RFJ0 0.0 1110 84 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella gallinarum (strain 287/91 / NCTC 13346)
A6TGQ1 0.0 1110 83 1 624 3 thiC Phosphomethylpyrimidine synthase Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
A9MHD6 0.0 1106 83 1 624 3 thiC Phosphomethylpyrimidine synthase Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q87KF0 0.0 1024 75 1 637 3 thiC Phosphomethylpyrimidine synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
A7N141 0.0 1021 75 1 637 3 thiC Phosphomethylpyrimidine synthase Vibrio campbellii (strain ATCC BAA-1116)
Q7MGM3 0.0 1020 75 1 636 3 thiC Phosphomethylpyrimidine synthase Vibrio vulnificus (strain YJ016)
Q8DDL4 0.0 1020 75 1 636 3 thiC Phosphomethylpyrimidine synthase Vibrio vulnificus (strain CMCP6)
A3QER4 0.0 1016 73 1 643 3 thiC Phosphomethylpyrimidine synthase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B4S2W4 0.0 1013 75 1 627 3 thiC Phosphomethylpyrimidine synthase Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
B0TRP7 0.0 1004 72 1 652 3 thiC Phosphomethylpyrimidine synthase Shewanella halifaxensis (strain HAW-EB4)
A8FUU9 0.0 1004 74 1 636 3 thiC Phosphomethylpyrimidine synthase Shewanella sediminis (strain HAW-EB3)
A1S6Q9 0.0 1004 77 0 599 3 thiC Phosphomethylpyrimidine synthase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
B1KHI4 0.0 999 73 1 636 3 thiC Phosphomethylpyrimidine synthase Shewanella woodyi (strain ATCC 51908 / MS32)
Q6LVY0 0.0 999 73 1 637 3 thiC Phosphomethylpyrimidine synthase Photobacterium profundum (strain SS9)
A8H566 0.0 998 71 1 657 3 thiC Phosphomethylpyrimidine synthase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q48A96 0.0 996 72 1 646 3 thiC Phosphomethylpyrimidine synthase Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q3IFN9 0.0 994 73 1 645 3 thiC Phosphomethylpyrimidine synthase Pseudoalteromonas translucida (strain TAC 125)
B5FF66 0.0 989 74 1 641 3 thiC Phosphomethylpyrimidine synthase Aliivibrio fischeri (strain MJ11)
Q5E8W9 0.0 988 74 1 641 3 thiC Phosphomethylpyrimidine synthase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B7VMV7 0.0 986 74 1 637 3 thiC Phosphomethylpyrimidine synthase Vibrio atlanticus (strain LGP32)
B6EGV1 0.0 983 74 1 639 3 thiC Phosphomethylpyrimidine synthase Aliivibrio salmonicida (strain LFI1238)
C3LPQ3 0.0 978 75 2 643 3 thiC Phosphomethylpyrimidine synthase Vibrio cholerae serotype O1 (strain M66-2)
Q9KVS8 0.0 978 75 2 643 3 thiC Phosphomethylpyrimidine synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
A5F4D2 0.0 978 75 2 643 3 thiC Phosphomethylpyrimidine synthase Vibrio cholerae serotype O1 (strain ATCC 39541 / Classical Ogawa 395 / O395)
Q8EED7 0.0 978 74 1 603 3 thiC Phosphomethylpyrimidine synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
A4Y6R2 0.0 971 74 1 606 3 thiC Phosphomethylpyrimidine synthase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
Q12NC2 0.0 970 74 0 599 3 thiC Phosphomethylpyrimidine synthase Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q1LU45 0.0 963 74 5 611 3 thiC Phosphomethylpyrimidine synthase Baumannia cicadellinicola subsp. Homalodisca coagulata
Q21NU6 0.0 958 74 4 618 3 thiC Phosphomethylpyrimidine synthase Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q9HUJ2 0.0 954 74 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
B7V362 0.0 954 74 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas aeruginosa (strain LESB58)
Q02F45 0.0 953 74 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas aeruginosa (strain UCBPP-PA14)
A6VD86 0.0 952 73 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas aeruginosa (strain PA7)
C5BTK7 0.0 952 72 4 621 3 thiC Phosphomethylpyrimidine synthase Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q2SQL8 0.0 947 72 4 622 3 thiC Phosphomethylpyrimidine synthase Hahella chejuensis (strain KCTC 2396)
A5W9V8 0.0 942 73 4 608 3 thiC Phosphomethylpyrimidine synthase Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
B0KL24 0.0 941 73 4 608 3 thiC Phosphomethylpyrimidine synthase Pseudomonas putida (strain GB-1)
Q88DA5 0.0 939 73 4 608 3 thiC Phosphomethylpyrimidine synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q4KJA1 0.0 937 72 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1I419 0.0 936 72 4 608 3 thiC Phosphomethylpyrimidine synthase Pseudomonas entomophila (strain L48)
Q3KJ20 0.0 936 72 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas fluorescens (strain Pf0-1)
B1JAG3 0.0 934 72 4 610 3 thiC Phosphomethylpyrimidine synthase Pseudomonas putida (strain W619)
A4XPW1 0.0 931 71 4 610 3 thiC Phosphomethylpyrimidine synthase Pseudomonas mendocina (strain ymp)
B4SI60 0.0 927 72 3 599 3 thiC Phosphomethylpyrimidine synthase Stenotrophomonas maltophilia (strain R551-3)
Q478T2 0.0 927 69 6 638 3 thiC Phosphomethylpyrimidine synthase Dechloromonas aromatica (strain RCB)
A4VR38 0.0 926 72 4 609 3 thiC Phosphomethylpyrimidine synthase Stutzerimonas stutzeri (strain A1501)
B3PCK0 0.0 926 71 4 619 3 thiC Phosphomethylpyrimidine synthase Cellvibrio japonicus (strain Ueda107)
Q3J7C1 0.0 925 70 4 623 3 thiC Phosphomethylpyrimidine synthase Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q4ZZ08 0.0 924 71 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas syringae pv. syringae (strain B728a)
Q87VG1 0.0 922 71 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
B2FT70 0.0 922 72 3 596 3 thiC Phosphomethylpyrimidine synthase Stenotrophomonas maltophilia (strain K279a)
Q48P32 0.0 921 71 4 609 3 thiC Phosphomethylpyrimidine synthase Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q2Y6P4 0.0 921 71 3 608 3 thiC Phosphomethylpyrimidine synthase Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
A1K3Q2 0.0 916 68 5 641 3 thiC Phosphomethylpyrimidine synthase Azoarcus sp. (strain BH72)
Q5P6L3 0.0 913 67 6 639 3 thiC Phosphomethylpyrimidine synthase Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q13WN4 0.0 912 69 8 640 3 thiC Phosphomethylpyrimidine synthase Paraburkholderia xenovorans (strain LB400)
B2SXY6 0.0 911 69 8 640 3 thiC Phosphomethylpyrimidine synthase Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q8PH13 0.0 911 69 3 609 3 thiC Phosphomethylpyrimidine synthase Xanthomonas axonopodis pv. citri (strain 306)
Q5H4C0 0.0 910 70 3 607 3 thiC Phosphomethylpyrimidine synthase Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
B2SNG3 0.0 910 70 3 607 3 thiC Phosphomethylpyrimidine synthase Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2P755 0.0 910 70 3 607 3 thiC Phosphomethylpyrimidine synthase Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q3BPK7 0.0 910 69 3 609 3 thiC Phosphomethylpyrimidine synthase Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q82Y50 0.0 909 70 5 610 3 thiC Phosphomethylpyrimidine synthase Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q7P1H8 0.0 908 70 4 618 3 thiC Phosphomethylpyrimidine synthase Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q7W0D7 0.0 907 69 5 621 3 thiC Phosphomethylpyrimidine synthase Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W1Q0 0.0 907 69 5 621 3 thiC Phosphomethylpyrimidine synthase Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WQM6 0.0 907 69 5 621 3 thiC Phosphomethylpyrimidine synthase Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9ACX9 0.0 907 69 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia multivorans (strain ATCC 17616 / 249)
Q0AJI9 0.0 906 69 5 630 3 thiC Phosphomethylpyrimidine synthase Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q1D4L3 0.0 906 70 5 615 3 thiC Phosphomethylpyrimidine synthase Myxococcus xanthus (strain DK1622)
A9IFG8 0.0 905 69 5 621 3 thiC Phosphomethylpyrimidine synthase Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
B0VDF1 0.0 905 69 4 607 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baumannii (strain AYE)
A3M1D2 0.0 905 69 4 607 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I1W2 0.0 905 69 4 607 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baumannii (strain ACICU)
B7I331 0.0 905 69 4 607 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baumannii (strain AB0057)
B7H1M6 0.0 905 69 4 607 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baumannii (strain AB307-0294)
Q8P5L9 0.0 904 69 3 610 3 thiC Phosphomethylpyrimidine synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RP37 0.0 904 69 3 610 3 thiC Phosphomethylpyrimidine synthase Xanthomonas campestris pv. campestris (strain B100)
Q4UYF2 0.0 904 69 3 610 3 thiC Phosphomethylpyrimidine synthase Xanthomonas campestris pv. campestris (strain 8004)
Q603T9 0.0 904 70 3 606 3 thiC Phosphomethylpyrimidine synthase Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
A6SUX7 0.0 904 69 4 619 3 thiC Phosphomethylpyrimidine synthase Janthinobacterium sp. (strain Marseille)
Q2L083 0.0 903 69 5 623 3 thiC Phosphomethylpyrimidine synthase Bordetella avium (strain 197N)
Q476U6 0.0 903 69 5 609 3 thiC Phosphomethylpyrimidine synthase Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6FFB6 0.0 903 69 4 613 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q3SFG3 0.0 902 69 6 623 3 thiC Phosphomethylpyrimidine synthase Thiobacillus denitrificans (strain ATCC 25259)
B2JJF7 0.0 901 69 7 627 3 thiC Phosphomethylpyrimidine synthase Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q9JXI0 0.0 901 67 6 634 3 thiC Phosphomethylpyrimidine synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q0KF34 0.0 901 69 5 608 3 thiC Phosphomethylpyrimidine synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
A9M0A4 0.0 900 67 6 634 3 thiC Phosphomethylpyrimidine synthase Neisseria meningitidis serogroup C (strain 053442)
Q9JWF3 0.0 900 67 6 634 3 thiC Phosphomethylpyrimidine synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
A1KWC0 0.0 899 67 6 634 3 thiC Phosphomethylpyrimidine synthase Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
B0VMD7 0.0 899 69 4 607 3 thiC Phosphomethylpyrimidine synthase Acinetobacter baumannii (strain SDF)
A4G224 0.0 899 69 4 619 3 thiC Phosphomethylpyrimidine synthase Herminiimonas arsenicoxydans
Q8Y368 0.0 898 69 5 612 3 thiC Phosphomethylpyrimidine synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
B2AGF3 0.0 898 69 5 609 3 thiC Phosphomethylpyrimidine synthase Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q5F588 0.0 895 68 7 626 3 thiC Phosphomethylpyrimidine synthase Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q4FVJ8 0.0 895 67 7 633 3 thiC Phosphomethylpyrimidine synthase Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q1LS28 0.0 892 69 5 608 3 thiC Phosphomethylpyrimidine synthase Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q12HI8 0.0 892 68 2 616 3 thiC Phosphomethylpyrimidine synthase Polaromonas sp. (strain JS666 / ATCC BAA-500)
Q2SUP3 0.0 891 67 5 632 3 thiC Phosphomethylpyrimidine synthase Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
A1VI67 0.0 890 66 3 629 3 thiC Phosphomethylpyrimidine synthase Polaromonas naphthalenivorans (strain CJ2)
A4JCZ0 0.0 890 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A1V2S9 0.0 889 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia mallei (strain SAVP1)
Q62FE9 0.0 889 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia mallei (strain ATCC 23344)
A2S3Z6 0.0 889 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia mallei (strain NCTC 10229)
A3MIG6 0.0 889 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia mallei (strain NCTC 10247)
Q63VF5 0.0 888 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia pseudomallei (strain K96243)
A3N7W7 0.0 888 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia pseudomallei (strain 668)
Q3JU20 0.0 888 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia pseudomallei (strain 1710b)
A3NTK3 0.0 888 67 5 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia pseudomallei (strain 1106a)
B4ED40 0.0 888 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
Q39HY9 0.0 887 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BXK3 0.0 886 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia orbicola (strain AU 1054)
A0K648 0.0 886 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia cenocepacia (strain HI2424)
B1YW60 0.0 886 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia ambifaria (strain MC40-6)
Q0BGQ9 0.0 885 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1JYX0 0.0 885 68 7 627 3 thiC Phosphomethylpyrimidine synthase Burkholderia orbicola (strain MC0-3)
A1AW65 0.0 879 67 4 604 3 thiC Phosphomethylpyrimidine synthase Ruthia magnifica subsp. Calyptogena magnifica
Q31JC9 0.0 879 67 8 632 3 thiC Phosphomethylpyrimidine synthase Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B5EQ61 0.0 874 68 4 608 3 thiC Phosphomethylpyrimidine synthase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J7C4 0.0 874 68 4 608 3 thiC Phosphomethylpyrimidine synthase Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
Q1QEM6 0.0 871 67 7 627 3 thiC Phosphomethylpyrimidine synthase Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q8D247 0.0 868 65 3 620 3 thiC Phosphomethylpyrimidine synthase Wigglesworthia glossinidia brevipalpis
A5CX15 0.0 863 66 4 604 3 thiC Phosphomethylpyrimidine synthase Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
Q2WAV0 0.0 861 67 5 602 3 thiC Phosphomethylpyrimidine synthase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q5NR58 0.0 852 68 10 604 3 thiC Phosphomethylpyrimidine synthase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q65M65 0.0 850 65 7 629 3 thiC Phosphomethylpyrimidine synthase Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q98AZ3 0.0 848 67 9 606 3 thiC Phosphomethylpyrimidine synthase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
P45740 0.0 848 66 6 612 1 thiC Phosphomethylpyrimidine synthase Bacillus subtilis (strain 168)
Q2K206 0.0 848 68 9 607 3 thiC Phosphomethylpyrimidine synthase Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q9KBJ4 0.0 847 65 4 611 3 thiC Phosphomethylpyrimidine synthase Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A7Z2P5 0.0 846 66 7 612 3 thiC Phosphomethylpyrimidine synthase Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
Q21XR6 0.0 846 66 7 616 3 thiC Phosphomethylpyrimidine synthase Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q92TI9 0.0 846 69 9 601 3 thiC Phosphomethylpyrimidine synthase Rhizobium meliloti (strain 1021)
B9MFQ3 0.0 845 66 6 604 3 thiC Phosphomethylpyrimidine synthase Acidovorax ebreus (strain TPSY)
A2SG83 0.0 844 67 9 619 3 thiC Phosphomethylpyrimidine synthase Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1WBZ7 0.0 843 66 6 604 3 thiC Phosphomethylpyrimidine synthase Acidovorax sp. (strain JS42)
Q2G7A9 0.0 843 66 9 626 3 thiC Phosphomethylpyrimidine synthase Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
B0T2Q1 0.0 840 67 8 611 3 thiC Phosphomethylpyrimidine synthase Caulobacter sp. (strain K31)
A1TKD9 0.0 839 66 8 614 3 thiC Phosphomethylpyrimidine synthase Paracidovorax citrulli (strain AAC00-1)
A5VB82 0.0 838 65 7 624 3 thiC Phosphomethylpyrimidine synthase Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
Q1GEY0 0.0 838 67 10 612 3 thiC Phosphomethylpyrimidine synthase Ruegeria sp. (strain TM1040)
B9K253 0.0 833 66 8 604 3 thiC Phosphomethylpyrimidine synthase Allorhizobium ampelinum (strain ATCC BAA-846 / DSM 112012 / S4)
C5D571 0.0 833 66 3 597 3 thiC Phosphomethylpyrimidine synthase Geobacillus sp. (strain WCH70)
Q5QUD0 0.0 833 69 6 605 3 thiC Phosphomethylpyrimidine synthase Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5FNT7 0.0 832 66 4 596 3 thiC Phosphomethylpyrimidine synthase Gluconobacter oxydans (strain 621H)
A7HV30 0.0 832 67 5 597 3 thiC Phosphomethylpyrimidine synthase Parvibaculum lavamentivorans (strain DS-1 / DSM 13023 / NCIMB 13966)
B8GX84 0.0 832 65 10 627 3 thiC Phosphomethylpyrimidine synthase Caulobacter vibrioides (strain NA1000 / CB15N)
Q9A6Q5 0.0 832 65 10 627 1 thiC Phosphomethylpyrimidine synthase Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
B9JMY1 0.0 831 66 10 616 3 thiC Phosphomethylpyrimidine synthase Rhizobium rhizogenes (strain K84 / ATCC BAA-868)
Q8UCC9 0.0 830 68 6 593 3 thiC Phosphomethylpyrimidine synthase Agrobacterium fabrum (strain C58 / ATCC 33970)
Q1GQJ3 0.0 829 66 8 609 3 thiC Phosphomethylpyrimidine synthase Sphingopyxis alaskensis (strain DSM 13593 / LMG 18877 / RB2256)
C5CM74 0.0 826 64 5 618 3 thiC Phosphomethylpyrimidine synthase Variovorax paradoxus (strain S110)
Q2N8D9 0.0 822 64 10 629 3 thiC Phosphomethylpyrimidine synthase Erythrobacter litoralis (strain HTCC2594)
Q1IX15 0.0 820 65 7 605 3 thiC Phosphomethylpyrimidine synthase Deinococcus geothermalis (strain DSM 11300 / CIP 105573 / AG-3a)
B1Y5I3 0.0 819 64 8 624 3 thiC Phosphomethylpyrimidine synthase Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A8FFR8 0.0 816 65 4 602 3 thiC Phosphomethylpyrimidine synthase Bacillus pumilus (strain SAFR-032)
A4IK74 0.0 815 67 7 598 3 thiC Phosphomethylpyrimidine synthase Geobacillus thermodenitrificans (strain NG80-2)
A1B684 0.0 815 65 5 608 3 thiC Phosphomethylpyrimidine synthase Paracoccus denitrificans (strain Pd 1222)
Q5L325 0.0 814 66 6 599 3 thiC Phosphomethylpyrimidine synthase Geobacillus kaustophilus (strain HTA426)
Q9RYX8 0.0 812 66 11 604 3 thiC Phosphomethylpyrimidine synthase Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A4YZQ6 0.0 810 63 9 627 3 thiC Phosphomethylpyrimidine synthase Bradyrhizobium sp. (strain ORS 278)
A7GUZ5 0.0 807 63 6 609 3 thiC Phosphomethylpyrimidine synthase Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
A5EPQ5 0.0 805 63 9 627 3 thiC Phosphomethylpyrimidine synthase Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q89FP0 0.0 802 62 9 629 3 thiC Phosphomethylpyrimidine synthase Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
P61423 0.0 802 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain ATCC 10987 / NRS 248)
Q133T3 0.0 801 62 9 634 3 thiC Phosphomethylpyrimidine synthase Rhodopseudomonas palustris (strain BisB5)
Q2IYP8 0.0 800 61 9 639 3 thiC Phosphomethylpyrimidine synthase Rhodopseudomonas palustris (strain HaA2)
Q6HB59 0.0 799 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q631C7 0.0 799 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain ZK / E33L)
C1EZL5 0.0 799 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain 03BB102)
B7JGF0 0.0 799 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain AH820)
Q07PX1 0.0 799 62 7 633 3 thiC Phosphomethylpyrimidine synthase Rhodopseudomonas palustris (strain BisA53)
A9VR68 0.0 799 62 4 608 3 thiC Phosphomethylpyrimidine synthase Bacillus mycoides (strain KBAB4)
B9J5N4 0.0 799 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain Q1)
B7HX62 0.0 799 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain AH187)
B7HEM8 0.0 798 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain B4264)
Q815D5 0.0 798 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81WY7 0.0 797 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus anthracis
C3LEJ7 0.0 797 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P178 0.0 797 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus anthracis (strain A0248)
B3QFS9 0.0 796 62 10 638 3 thiC Phosphomethylpyrimidine synthase Rhodopseudomonas palustris (strain TIE-1)
B7IPY9 0.0 796 62 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus cereus (strain G9842)
A0RL17 0.0 796 63 5 608 3 thiC Phosphomethylpyrimidine synthase Bacillus thuringiensis (strain Al Hakam)
Q9PC93 0.0 790 65 4 579 3 thiC Phosphomethylpyrimidine synthase Xylella fastidiosa (strain 9a5c)
P61427 0.0 790 60 11 663 3 thiC Phosphomethylpyrimidine synthase Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A9IRH7 0.0 790 63 10 611 3 thiC Phosphomethylpyrimidine synthase Bartonella tribocorum (strain CIP 105476 / IBS 506)
Q3SPS0 0.0 789 61 9 643 3 thiC Phosphomethylpyrimidine synthase Nitrobacter winogradskyi (strain ATCC 25391 / DSM 10237 / CIP 104748 / NCIMB 11846 / Nb-255)
Q1QJD3 0.0 789 61 9 634 3 thiC Phosphomethylpyrimidine synthase Nitrobacter hamburgensis (strain DSM 10229 / NCIMB 13809 / X14)
Q87CY6 0.0 786 66 4 580 3 thiC Phosphomethylpyrimidine synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B6JI86 0.0 782 61 8 623 3 thiC Phosphomethylpyrimidine synthase Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
Q3A7P7 0.0 781 64 3 581 3 thiC1 Phosphomethylpyrimidine synthase 1 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A1US11 0.0 780 61 10 622 3 thiC Phosphomethylpyrimidine synthase Bartonella bacilliformis (strain ATCC 35685 / KC583 / Herrer 020/F12,63)
Q2RST7 0.0 780 62 5 607 3 thiC Phosphomethylpyrimidine synthase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q216H0 0.0 779 56 10 700 3 thiC Phosphomethylpyrimidine synthase Rhodopseudomonas palustris (strain BisB18)
Q6G099 0.0 776 64 8 585 3 thiC Phosphomethylpyrimidine synthase Bartonella quintana (strain Toulouse)
Q7MT71 0.0 771 63 3 573 3 thiC Phosphomethylpyrimidine synthase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
B2RH34 0.0 770 64 3 573 3 thiC Phosphomethylpyrimidine synthase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q6G477 0.0 769 60 9 617 3 thiC Phosphomethylpyrimidine synthase Bartonella henselae (strain ATCC 49882 / DSM 28221 / CCUG 30454 / Houston 1)
B1VPA3 0.0 763 62 7 606 3 thiC Phosphomethylpyrimidine synthase Streptomyces griseus subsp. griseus (strain JCM 4626 / CBS 651.72 / NBRC 13350 / KCC S-0626 / ISP 5235)
Q82FI7 0.0 761 61 5 608 3 thiC Phosphomethylpyrimidine synthase Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q64T99 0.0 757 62 6 576 3 thiC Phosphomethylpyrimidine synthase Bacteroides fragilis (strain YCH46)
Q5LCA5 0.0 757 62 6 576 3 thiC Phosphomethylpyrimidine synthase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q8AA15 0.0 754 61 8 582 3 thiC Phosphomethylpyrimidine synthase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
P61424 0.0 751 62 7 599 3 thiC Phosphomethylpyrimidine synthase Corynebacterium diphtheriae (strain ATCC 700971 / NCTC 13129 / Biotype gravis)
Q9X9U0 0.0 750 60 5 614 3 thiC Phosphomethylpyrimidine synthase Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
A9KGN7 0.0 739 61 6 588 3 thiC Phosphomethylpyrimidine synthase Coxiella burnetii (strain Dugway 5J108-111)
Q2JG22 0.0 739 58 8 634 3 thiC Phosphomethylpyrimidine synthase Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
B6J5W3 0.0 738 61 6 588 3 thiC Phosphomethylpyrimidine synthase Coxiella burnetii (strain CbuK_Q154)
Q83EJ0 0.0 738 61 6 588 3 thiC Phosphomethylpyrimidine synthase Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
B6J1X8 0.0 737 61 6 588 3 thiC Phosphomethylpyrimidine synthase Coxiella burnetii (strain CbuG_Q212)
Q8FPT3 0.0 728 61 7 605 3 thiC Phosphomethylpyrimidine synthase Corynebacterium efficiens (strain DSM 44549 / YS-314 / AJ 12310 / JCM 11189 / NBRC 100395)
A4QDR7 0.0 727 62 6 586 3 thiC Phosphomethylpyrimidine synthase Corynebacterium glutamicum (strain R)
Q5PB42 0.0 726 60 5 576 3 thiC Phosphomethylpyrimidine synthase Anaplasma marginale (strain St. Maries)
Q8NQW7 0.0 725 61 6 586 3 thiC Phosphomethylpyrimidine synthase Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q4JVZ0 0.0 721 63 5 562 3 thiC Phosphomethylpyrimidine synthase Corynebacterium jeikeium (strain K411)
Q5FHG9 0.0 717 58 7 573 3 thiC Phosphomethylpyrimidine synthase Ehrlichia ruminantium (strain Gardel)
Q3YSI0 0.0 717 58 7 588 3 thiC Phosphomethylpyrimidine synthase Ehrlichia canis (strain Jake)
Q5HBN2 0.0 716 58 7 573 3 thiC Phosphomethylpyrimidine synthase Ehrlichia ruminantium (strain Welgevonden)
Q2GG37 0.0 716 58 6 574 3 thiC Phosphomethylpyrimidine synthase Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
B4S9A9 0.0 715 60 5 578 3 thiC Phosphomethylpyrimidine synthase Prosthecochloris aestuarii (strain DSM 271 / SK 413)
B3EPH6 0.0 712 60 7 580 3 thiC Phosphomethylpyrimidine synthase Chlorobium phaeobacteroides (strain BS1)
Q2GKB1 0.0 709 59 6 577 3 thiC Phosphomethylpyrimidine synthase Anaplasma phagocytophilum (strain HZ)
Q3B2V9 0.0 703 60 8 578 3 thiC Phosphomethylpyrimidine synthase Chlorobium luteolum (strain DSM 273 / BCRC 81028 / 2530)
Q04VF1 0.0 699 62 4 539 3 thiC Phosphomethylpyrimidine synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain JB197)
Q04Y23 0.0 699 62 4 539 3 thiC Phosphomethylpyrimidine synthase Leptospira borgpetersenii serovar Hardjo-bovis (strain L550)
Q8G7X1 0.0 692 54 10 668 3 thiE/thiC Thiamine biosynthesis bifunctional protein ThiEC Bifidobacterium longum (strain NCC 2705)
Q5YNS3 0.0 689 60 6 590 3 thiC Phosphomethylpyrimidine synthase Nocardia farcinica (strain IFM 10152)
Q8KCH9 0.0 687 59 6 579 3 thiC Phosphomethylpyrimidine synthase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
O82392 0.0 686 59 8 583 1 THIC Phosphomethylpyrimidine synthase, chloroplastic Arabidopsis thaliana
B3QPT5 0.0 684 59 6 579 3 thiC Phosphomethylpyrimidine synthase Chlorobaculum parvum (strain DSM 263 / NCIMB 8327)
B3EE09 0.0 683 59 6 570 3 thiC Phosphomethylpyrimidine synthase Chlorobium limicola (strain DSM 245 / NBRC 103803 / 6330)
Q8F7G5 0.0 683 69 1 454 3 thiC Phosphomethylpyrimidine synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)
Q72NZ8 0.0 682 69 1 454 3 thiC Phosphomethylpyrimidine synthase Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130)
B4SBF6 0.0 681 59 8 568 3 thiC Phosphomethylpyrimidine synthase Pelodictyon phaeoclathratiforme (strain DSM 5477 / BU-1)
A4SFM6 0.0 681 58 9 587 3 thiC Phosphomethylpyrimidine synthase Chlorobium phaeovibrioides (strain DSM 265 / 1930)
B2HQM5 0.0 672 58 7 609 3 thiC Phosphomethylpyrimidine synthase Mycobacterium marinum (strain ATCC BAA-535 / M)
A0PTS1 0.0 670 57 7 609 3 thiC Phosphomethylpyrimidine synthase Mycobacterium ulcerans (strain Agy99)
B1MIP8 0.0 668 58 6 594 3 thiC Phosphomethylpyrimidine synthase Mycobacteroides abscessus (strain ATCC 19977 / DSM 44196 / CCUG 20993 / CIP 104536 / JCM 13569 / NCTC 13031 / TMC 1543 / L948)
Q3ATM0 0.0 663 57 9 575 3 thiC Phosphomethylpyrimidine synthase Chlorobium chlorochromatii (strain CaD3)
P61426 0.0 661 58 8 604 3 thiC Phosphomethylpyrimidine synthase Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QLS0 0.0 661 58 8 604 3 thiC Phosphomethylpyrimidine synthase Mycobacterium avium (strain 104)
P9WG79 0.0 658 57 6 599 1 thiC Phosphomethylpyrimidine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WG78 0.0 658 57 6 599 3 thiC Phosphomethylpyrimidine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TZE9 0.0 658 57 6 599 3 thiC Phosphomethylpyrimidine synthase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AK99 0.0 658 57 6 599 3 thiC Phosphomethylpyrimidine synthase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KFP5 0.0 658 57 6 599 3 thiC Phosphomethylpyrimidine synthase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P66912 0.0 658 57 6 599 3 thiC Phosphomethylpyrimidine synthase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q9ZBL0 0.0 656 55 7 609 3 thiC Phosphomethylpyrimidine synthase Mycobacterium leprae (strain TN)
B8ZU90 0.0 656 55 7 609 3 thiC Phosphomethylpyrimidine synthase Mycobacterium leprae (strain Br4923)
Q028Z8 0.0 578 60 2 455 3 thiC Phosphomethylpyrimidine synthase Solibacter usitatus (strain Ellin6076)
Q8DLZ2 0.0 556 60 2 452 3 thiC Phosphomethylpyrimidine synthase Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q2JPK6 0.0 551 59 2 447 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain JA-2-3B'a(2-13))
Q2JY68 0.0 548 59 2 447 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain JA-3-3Ab)
B8HNW1 0.0 546 59 2 447 3 thiC Phosphomethylpyrimidine synthase Cyanothece sp. (strain PCC 7425 / ATCC 29141)
Q3MGA3 0.0 545 58 2 447 3 thiC Phosphomethylpyrimidine synthase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q55894 0.0 543 56 3 473 3 thiC Phosphomethylpyrimidine synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B2J323 0.0 542 59 3 447 3 thiC Phosphomethylpyrimidine synthase Nostoc punctiforme (strain ATCC 29133 / PCC 73102)
B1XIG4 0.0 541 57 2 454 3 thiC Phosphomethylpyrimidine synthase Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q31P93 0.0 539 58 3 453 3 thiC Phosphomethylpyrimidine synthase Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q8YY69 0.0 539 58 2 447 3 thiC Phosphomethylpyrimidine synthase Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B7K508 0.0 537 57 2 454 3 thiC Phosphomethylpyrimidine synthase Rippkaea orientalis (strain PCC 8801 / RF-1)
B7KDN8 0.0 537 57 2 454 3 thiC Phosphomethylpyrimidine synthase Gloeothece citriformis (strain PCC 7424)
B1WW40 0.0 537 57 2 454 3 thiC Phosphomethylpyrimidine synthase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q7UP26 0.0 536 57 3 457 3 thiC Phosphomethylpyrimidine synthase Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
B0JSK4 0.0 536 58 2 447 3 thiC Phosphomethylpyrimidine synthase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q7NLK5 0.0 535 57 3 463 3 thiC Phosphomethylpyrimidine synthase Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q5N4X6 0.0 534 57 3 453 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
A7HCC3 0.0 534 57 2 456 3 thiC Phosphomethylpyrimidine synthase Anaeromyxobacter sp. (strain Fw109-5)
A6Q2K1 0.0 532 55 2 458 3 thiC Phosphomethylpyrimidine synthase Nitratiruptor sp. (strain SB155-2)
A5GQ73 0.0 527 54 5 490 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain RCC307)
B9L811 0.0 527 56 3 458 3 thiC Phosphomethylpyrimidine synthase Nautilia profundicola (strain ATCC BAA-1463 / DSM 18972 / AmH)
B0CCG9 0.0 526 56 2 447 3 thiC Phosphomethylpyrimidine synthase Acaryochloris marina (strain MBIC 11017)
Q7V906 0.0 524 54 5 483 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9313)
A2C642 0.0 524 54 5 483 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9303)
B8JAC3 0.0 524 57 2 454 3 thiC Phosphomethylpyrimidine synthase Anaeromyxobacter dehalogenans (strain 2CP-1 / ATCC BAA-258)
B4UDM7 1.04e-180 523 57 2 454 3 thiC Phosphomethylpyrimidine synthase Anaeromyxobacter sp. (strain K)
A9BD54 1.16e-180 523 54 5 482 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9211)
Q7VFU4 1.42e-180 523 56 1 450 3 thiC Phosphomethylpyrimidine synthase Helicobacter hepaticus (strain ATCC 51449 / 3B1)
Q2IID8 1.96e-180 523 57 2 454 3 thiC Phosphomethylpyrimidine synthase Anaeromyxobacter dehalogenans (strain 2CP-C)
Q30QG8 9.3e-180 521 54 1 461 3 thiC Phosphomethylpyrimidine synthase Sulfurimonas denitrificans (strain ATCC 33889 / DSM 1251)
A0RN29 1.48e-179 520 55 2 450 3 thiC Phosphomethylpyrimidine synthase Campylobacter fetus subsp. fetus (strain 82-40)
A3PFA2 1.93e-179 520 55 4 469 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9301)
Q7V9Q8 1.13e-178 518 54 4 477 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
A2BTJ3 1.86e-178 517 55 5 469 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain AS9601)
O67259 2.69e-178 517 58 2 460 3 thiC Phosphomethylpyrimidine synthase Aquifex aeolicus (strain VF5)
A8G7B7 5.1e-178 516 55 5 469 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9215)
Q3B0I6 5.63e-178 516 56 5 462 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain CC9902)
Q7U9W2 9.52e-178 516 55 5 478 3 thiC Phosphomethylpyrimidine synthase Parasynechococcus marenigrum (strain WH8102)
Q318D0 1.13e-177 515 55 5 469 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9312)
Q3AND3 1.75e-177 516 56 4 458 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain CC9605)
Q111Z9 9.49e-177 514 54 3 476 3 thiC Phosphomethylpyrimidine synthase Trichodesmium erythraeum (strain IMS101)
A2C559 1.02e-176 513 54 6 483 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain NATL1A)
A5GI51 1.47e-176 513 57 4 453 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain WH7803)
A2BYZ5 1.71e-176 512 55 5 469 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain MIT 9515)
Q46IK0 2.7e-176 512 53 6 483 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus (strain NATL2A)
Q7UZP7 5.14e-175 508 54 3 458 3 thiC Phosphomethylpyrimidine synthase Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0IDV6 5.72e-175 509 56 4 456 3 thiC Phosphomethylpyrimidine synthase Synechococcus sp. (strain CC9311)
Q7M818 6.6e-173 503 54 1 469 3 thiC Phosphomethylpyrimidine synthase Wolinella succinogenes (strain ATCC 29543 / DSM 1740 / CCUG 13145 / JCM 31913 / LMG 7466 / NCTC 11488 / FDC 602W)
Q3IRP7 3.98e-172 502 55 2 460 3 thiC Phosphomethylpyrimidine synthase Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q9HRG2 2.21e-169 495 54 3 446 3 thiC Phosphomethylpyrimidine synthase Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
B0R400 2.21e-169 495 54 3 446 3 thiC Phosphomethylpyrimidine synthase Halobacterium salinarum (strain ATCC 29341 / DSM 671 / R1)
Q5V2X0 4.92e-169 494 55 2 452 3 thiC Phosphomethylpyrimidine synthase Haloarcula marismortui (strain ATCC 43049 / DSM 3752 / JCM 8966 / VKM B-1809)
A7I162 3.43e-163 478 54 2 456 3 thiC Phosphomethylpyrimidine synthase Campylobacter hominis (strain ATCC BAA-381 / DSM 21671 / CCUG 45161 / LMG 19568 / NCTC 13146 / CH001A)
Q3AE33 3.99e-126 382 46 6 455 3 thiC Phosphomethylpyrimidine synthase Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A8MEI9 2.83e-124 378 44 4 450 3 thiC Phosphomethylpyrimidine synthase Alkaliphilus oremlandii (strain OhILAs)
A6TVU5 3e-123 375 44 4 447 3 thiC Phosphomethylpyrimidine synthase Alkaliphilus metalliredigens (strain QYMF)
A0Q1U9 9.61e-123 374 42 5 454 3 thiC Phosphomethylpyrimidine synthase Clostridium novyi (strain NT)
Q3ZXE1 1.22e-122 374 47 7 456 3 thiC Phosphomethylpyrimidine synthase Dehalococcoides mccartyi (strain CBDB1)
A5FR94 5.62e-122 372 47 7 456 3 thiC Phosphomethylpyrimidine synthase Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q3Z8E2 6.61e-122 372 47 9 456 3 thiC Phosphomethylpyrimidine synthase Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
Q2NHI8 1.38e-120 368 44 7 456 3 thiC1 Phosphomethylpyrimidine synthase 1 Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
B0S3A6 1.42e-120 368 43 5 453 3 thiC Phosphomethylpyrimidine synthase Finegoldia magna (strain ATCC 29328 / DSM 20472 / WAL 2508)
Q2RIM5 4.36e-120 367 47 8 456 3 thiC Phosphomethylpyrimidine synthase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q897B2 1.45e-119 367 43 4 452 3 thiC Phosphomethylpyrimidine synthase Clostridium tetani (strain Massachusetts / E88)
Q72KP6 2.97e-119 365 45 7 466 3 thiC Phosphomethylpyrimidine synthase Thermus thermophilus (strain ATCC BAA-163 / DSM 7039 / HB27)
Q5SKG5 4.47e-119 364 45 7 466 3 thiC Phosphomethylpyrimidine synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
C3L2Y4 1.02e-118 363 43 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain 657 / Type Ba4)
A7GHD2 1.18e-118 363 44 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A5I5Z5 1.44e-118 363 44 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FXG9 1.44e-118 363 44 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain ATCC 19397 / Type A)
C1FVP6 2.53e-118 362 44 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain Kyoto / Type A2)
A5D4K5 2.53e-118 362 44 4 447 3 thiC Phosphomethylpyrimidine synthase Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
B1ILH9 3.1e-118 362 44 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain Okra / Type B1)
Q39RJ6 4.77e-118 362 45 7 453 3 thiC Phosphomethylpyrimidine synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B1KZJ7 5.14e-118 362 43 5 447 3 thiC Phosphomethylpyrimidine synthase Clostridium botulinum (strain Loch Maree / Type A3)
Q0SV55 5.91e-118 362 42 4 447 3 thiC Phosphomethylpyrimidine synthase Clostridium perfringens (strain SM101 / Type A)
A4J8J1 1.68e-117 360 44 7 454 3 thiC Phosphomethylpyrimidine synthase Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
Q8XMK9 9.7e-117 358 42 4 447 3 thiC Phosphomethylpyrimidine synthase Clostridium perfringens (strain 13 / Type A)
Q0TTB7 9.7e-117 358 42 4 447 3 thiC Phosphomethylpyrimidine synthase Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
B9KAI3 1.87e-116 357 42 5 455 3 thiC Phosphomethylpyrimidine synthase Thermotoga neapolitana (strain ATCC 49049 / DSM 4359 / NBRC 107923 / NS-E)
B0K5Z9 2.47e-116 357 47 6 455 3 thiC Phosphomethylpyrimidine synthase Thermoanaerobacter sp. (strain X514)
B0KD66 1.16e-115 355 47 6 455 3 thiC Phosphomethylpyrimidine synthase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q186R0 1.63e-115 355 44 5 453 3 thiC Phosphomethylpyrimidine synthase Clostridioides difficile (strain 630)
B1LCP2 4.82e-115 353 41 5 455 3 thiC Phosphomethylpyrimidine synthase Thermotoga sp. (strain RQ2)
A5IIZ7 5.14e-115 353 41 5 455 3 thiC Phosphomethylpyrimidine synthase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WZP5 5.14e-115 353 41 5 455 3 thiC Phosphomethylpyrimidine synthase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
B5YJ75 3.2e-114 352 43 7 455 3 thiC Phosphomethylpyrimidine synthase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
A5N937 4.36e-114 352 42 4 452 3 thiC Phosphomethylpyrimidine synthase Clostridium kluyveri (strain ATCC 8527 / DSM 555 / NCIMB 10680)
B9E2H5 4.36e-114 352 42 4 452 3 thiC Phosphomethylpyrimidine synthase Clostridium kluyveri (strain NBRC 12016)
B1I672 5.51e-113 348 45 8 462 3 thiC Phosphomethylpyrimidine synthase Desulforudis audaxviator (strain MP104C)
Q8R9P1 9.33e-113 348 45 7 456 3 thiC Phosphomethylpyrimidine synthase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q6AK99 1.05e-112 348 43 6 455 3 thiC Phosphomethylpyrimidine synthase Desulfotalea psychrophila (strain LSv54 / DSM 12343)
O27617 1.99e-112 347 43 9 459 3 thiC2 Phosphomethylpyrimidine synthase 2 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q58432 2.03e-112 347 41 8 457 3 thiC Phosphomethylpyrimidine synthase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9PI55 5.42e-111 343 41 5 452 3 thiC Phosphomethylpyrimidine synthase Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
A7H4T0 1.36e-110 342 41 5 452 3 thiC Phosphomethylpyrimidine synthase Campylobacter jejuni subsp. doylei (strain ATCC BAA-1458 / RM4099 / 269.97)
A8ZVP4 1.97e-110 342 42 6 451 3 thiC Phosphomethylpyrimidine synthase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A6URG5 1.99e-110 342 41 8 457 3 thiC Phosphomethylpyrimidine synthase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A1VYG9 3.47e-110 341 41 5 452 3 thiC Phosphomethylpyrimidine synthase Campylobacter jejuni subsp. jejuni serotype O:23/36 (strain 81-176)
P61428 3.48e-110 341 41 9 457 3 thiC Phosphomethylpyrimidine synthase Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q5HW14 8.02e-110 340 41 5 452 3 thiC Phosphomethylpyrimidine synthase Campylobacter jejuni (strain RM1221)
A8FKN8 2.32e-109 339 41 5 452 3 thiC Phosphomethylpyrimidine synthase Campylobacter jejuni subsp. jejuni serotype O:6 (strain 81116 / NCTC 11828)
Q3A2D2 3.34e-109 339 42 6 457 3 thiC2 Phosphomethylpyrimidine synthase 2 Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
B8FUD2 3.88e-109 338 43 7 460 3 thiC Phosphomethylpyrimidine synthase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
A6VIH6 1.2e-108 337 40 8 456 3 thiC Phosphomethylpyrimidine synthase Methanococcus maripaludis (strain C7 / ATCC BAA-1331)
A9A8A9 1.43e-108 337 40 8 456 3 thiC Phosphomethylpyrimidine synthase Methanococcus maripaludis (strain C6 / ATCC BAA-1332)
A6UT74 2.17e-108 337 40 7 455 3 thiC Phosphomethylpyrimidine synthase Methanococcus aeolicus (strain ATCC BAA-1280 / DSM 17508 / OCM 812 / Nankai-3)
Q2LSU0 2.89e-108 336 43 6 456 3 thiC Phosphomethylpyrimidine synthase Syntrophus aciditrophicus (strain SB)
Q8RI60 1.37e-107 335 41 5 452 3 thiC Phosphomethylpyrimidine synthase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A4G002 2.11e-107 334 40 8 456 3 thiC Phosphomethylpyrimidine synthase Methanococcus maripaludis (strain C5 / ATCC BAA-1333)
Q8TPW4 1.22e-106 332 42 7 454 3 thiC1 Phosphomethylpyrimidine synthase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q8Q0F4 1.05e-105 330 41 7 454 3 thiC1 Phosphomethylpyrimidine synthase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q46AN2 1.65e-105 329 42 7 454 3 thiC2 Phosphomethylpyrimidine synthase 2 Methanosarcina barkeri (strain Fusaro / DSM 804)
Q97EU2 2.41e-105 329 40 5 452 3 thiC Phosphomethylpyrimidine synthase Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
C5A6A9 4.03e-104 325 41 7 457 3 thiC Phosphomethylpyrimidine synthase Thermococcus gammatolerans (strain DSM 15229 / JCM 11827 / EJ3)
A8F821 1.57e-103 324 40 7 456 3 thiC Phosphomethylpyrimidine synthase Pseudothermotoga lettingae (strain ATCC BAA-301 / DSM 14385 / NBRC 107922 / TMO)
Q8U0Q4 3.11e-103 323 41 7 462 3 thiC Phosphomethylpyrimidine synthase Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q0AZ84 3.37e-103 323 44 5 451 3 thiC Phosphomethylpyrimidine synthase Syntrophomonas wolfei subsp. wolfei (strain DSM 2245B / Goettingen)
Q5JD26 6.51e-102 320 41 8 463 3 thiC Phosphomethylpyrimidine synthase Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q8TZ33 1.63e-101 319 43 5 407 3 thiC Phosphomethylpyrimidine synthase Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
Q9V0X8 3.76e-101 318 41 7 457 3 thiC Phosphomethylpyrimidine synthase Pyrococcus abyssi (strain GE5 / Orsay)
Q1JZW3 5.22e-98 310 37 6 458 1 bzaF 5-hydroxybenzimidazole synthase Desulfuromonas acetoxidans (strain DSM 684 / 11070)
Q2RHR5 8.42e-97 306 40 5 451 3 bzaB 5-hydroxybenzimidazole synthase BzaB Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2NHG6 1.91e-94 301 39 7 416 3 thiC2 Phosphomethylpyrimidine synthase 2 Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
O27586 2.78e-93 298 39 10 463 3 thiC1 Phosphomethylpyrimidine synthase 1 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
A0A0K1TQ05 2.78e-93 297 40 7 459 1 bzaB 5-hydroxybenzimidazole synthase BzaB Eubacterium limosum
P61425 1.05e-92 296 36 7 452 1 bzaF 5-hydroxybenzimidazole synthase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
C0QJ00 1.61e-92 296 36 6 456 3 bzaF 5-hydroxybenzimidazole synthase Desulforapulum autotrophicum (strain ATCC 43914 / DSM 3382 / VKM B-1955 / HRM2)
Q39YG0 2.82e-92 295 36 6 451 3 bzaF 5-hydroxybenzimidazole synthase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
Q8PY39 3.98e-92 295 38 8 460 3 thiC2 Phosphomethylpyrimidine synthase 2 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
A0A0K1TPY7 6.31e-92 294 38 6 455 1 bzaA 5-hydroxybenzimidazole synthase BzaA Eubacterium limosum
Q8TI28 1.26e-91 293 37 9 462 3 thiC2 Phosphomethylpyrimidine synthase 2 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q46EW5 3.61e-91 292 38 9 462 3 thiC1 Phosphomethylpyrimidine synthase 1 Methanosarcina barkeri (strain Fusaro / DSM 804)
Q2FQY7 4.14e-90 289 38 10 455 3 thiC Phosphomethylpyrimidine synthase Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
A8A8N6 8.56e-90 289 42 5 397 3 thiC Phosphomethylpyrimidine synthase Ignicoccus hospitalis (strain KIN4/I / DSM 18386 / JCM 14125)
A3CVT7 1.9e-89 287 38 10 453 3 thiC Phosphomethylpyrimidine synthase Methanoculleus marisnigri (strain ATCC 35101 / DSM 1498 / JR1)
O30259 5.05e-89 286 44 5 394 3 thiC Phosphomethylpyrimidine synthase Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q2RHR4 5.3e-89 286 37 4 449 3 bzaA 5-hydroxybenzimidazole synthase BzaA Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
A7I8Q1 3.58e-87 281 38 11 455 3 thiC Phosphomethylpyrimidine synthase Methanoregula boonei (strain DSM 21154 / JCM 14090 / 6A8)
B8GKY4 9.72e-86 278 36 10 453 3 thiC Phosphomethylpyrimidine synthase Methanosphaerula palustris (strain ATCC BAA-1556 / DSM 19958 / E1-9c)
C3MMC3 1.43e-82 270 37 7 403 3 thiC Phosphomethylpyrimidine synthase Sulfolobus islandicus (strain L.S.2.15 / Lassen #1)
C4KG47 1.43e-82 270 37 7 403 3 thiC Phosphomethylpyrimidine synthase Sulfolobus islandicus (strain M.16.4 / Kamchatka #3)
Q97X14 1.43e-82 270 37 7 403 3 thiC2 Phosphomethylpyrimidine synthase 2 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)
A2SU66 1.44e-82 270 35 9 464 3 thiC Phosphomethylpyrimidine synthase Methanocorpusculum labreanum (strain ATCC 43576 / DSM 4855 / Z)
C3MX60 1.53e-82 270 37 7 403 3 thiC Phosphomethylpyrimidine synthase Sulfolobus islandicus (strain M.14.25 / Kamchatka #1)
C3N4K5 4.04e-82 268 37 7 403 3 thiC Phosphomethylpyrimidine synthase Sulfolobus islandicus (strain M.16.27)
Q96ZH0 1.57e-79 261 36 8 452 3 thiC Phosphomethylpyrimidine synthase Sulfurisphaera tokodaii (strain DSM 16993 / JCM 10545 / NBRC 100140 / 7)
Q4JCB9 2.89e-78 258 37 7 408 3 thiC Phosphomethylpyrimidine synthase Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q8ZZC0 5.02e-78 258 37 7 405 3 thiC Phosphomethylpyrimidine synthase Pyrobaculum aerophilum (strain ATCC 51768 / DSM 7523 / JCM 9630 / CIP 104966 / NBRC 100827 / IM2)
Q97YJ8 1.32e-76 254 37 7 403 3 thiC1 Phosphomethylpyrimidine synthase 1 Saccharolobus solfataricus (strain ATCC 35092 / DSM 1617 / JCM 11322 / P2)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_18225
Feature type CDS
Gene thiC
Product phosphomethylpyrimidine synthase ThiC
Location 15608 - 17557 (strand: 1)
Length 1950 (nucleotides) / 649 (amino acids)
In genomic island -

Contig

Accession ZDB_382
Length 38736 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2330
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01964 Radical SAM ThiC family
PF13667 ThiC-associated domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0422 Coenzyme transport and metabolism (H) H 4-amino-2-methyl-5-hydroxymethylpyrimidine (HMP) synthase ThiC

Kegg Ortholog Annotation(s)

Protein Sequence

MSREQRIDTTDLSPGAETAAPSKARTRREQRDAAEEYISTLKGVNFPNSSRIYLTGSRPDIRVPMREIALSPTLIGGDKANPQYEENEPVPVYDTAGPYGDPQVKLDVRTGLARLREQWVAERGDTEAVTHLSSDFTRDRLADNGLDHLRYPNRPAPLKAKTGKRVTQLHYARKGIVTPEMEFIAIRENMGRERIRGEVLLQQHPGQHFGANLPDNITPEFVRDEVAAGRAIIPSNINHPESEPMIIGRNFLVKVNANIGNSSVTSSIEEEVEKLVWSTRWGADTVMDLSTGRYIHETREWILRNSPVPIGTVPVYQALEKVNGVAEDLTWEMFRDTLLEQAEQGVDYFTIHAGVLLRYVPMTAKRLTGIVSRGGSIMAKWCLSHHQENFLYQHFRDICEICAAYDVALSLGDGLRPGSIQDANDEAQFAELHTLGELTKTAWEYDVQVMIEGPGHVPMQMIRKNMTEELEHCHEAPFYTLGPLTTDIAPGYDHFTSGIGAALIGWFGCAMLCYVTPKEHLGLPNKEDVKQGLITYKIAAHAADLAKGHPGAQIRDNAMSKARFEFRWEDQFNLALDPETARTYHDETLPQASGKVAHFCSMCGPKFCSMKISQEVRDYAAGMEEMSDAFRAKGSELYHSAEERIDESA

Flanking regions ( +/- flanking 50bp)

TTTCTCACTTTTTCTTCCGGTTTTGCCGGTTTCACTGTAAGGAATTTGCTATGTCCCGTGAACAACGTATTGATACCACTGATCTCTCCCCGGGTGCGGAAACCGCCGCTCCTTCCAAAGCCCGTACCCGCCGTGAGCAGCGCGACGCGGCAGAGGAATATATCAGCACCCTGAAAGGGGTGAATTTCCCGAACTCCTCCCGTATTTATCTCACCGGCTCGCGCCCGGATATCCGCGTACCGATGCGGGAAATTGCCCTGTCCCCGACTCTGATCGGCGGTGATAAAGCCAATCCGCAGTATGAAGAGAATGAACCGGTACCGGTTTATGATACCGCCGGGCCGTACGGCGACCCGCAGGTGAAACTGGATGTCCGTACCGGCCTTGCCCGCCTGCGTGAACAATGGGTTGCAGAGCGGGGTGATACCGAAGCGGTGACACACCTGAGTTCTGATTTCACCCGTGACCGCCTGGCCGATAACGGCCTTGACCATCTGCGCTACCCGAACCGCCCGGCGCCGCTGAAAGCCAAAACCGGAAAACGGGTGACACAACTGCATTATGCCCGGAAAGGGATTGTCACCCCGGAGATGGAGTTTATCGCCATCCGCGAAAATATGGGGCGTGAACGCATCCGGGGCGAAGTTCTGCTGCAACAGCATCCGGGACAGCATTTCGGTGCCAATCTGCCGGATAACATCACCCCGGAATTTGTCCGCGATGAAGTCGCTGCCGGGCGCGCCATTATCCCGTCCAATATTAACCACCCGGAATCCGAACCGATGATTATCGGCCGCAATTTCCTGGTAAAAGTGAATGCCAATATCGGCAACTCCTCTGTCACCTCCTCCATTGAGGAAGAAGTGGAGAAACTGGTCTGGTCCACCCGCTGGGGCGCGGATACGGTGATGGATCTCTCCACCGGCCGCTATATTCACGAAACCCGCGAGTGGATCCTGCGTAACAGCCCGGTGCCTATCGGTACCGTACCGGTCTATCAGGCACTCGAGAAAGTAAACGGTGTGGCCGAGGATCTGACCTGGGAGATGTTCCGCGATACCCTGCTGGAGCAGGCGGAACAAGGGGTGGATTACTTCACTATCCACGCCGGTGTCCTGCTGCGCTATGTGCCGATGACAGCAAAACGCCTGACCGGCATTGTGTCACGCGGCGGCTCAATTATGGCGAAATGGTGTCTGTCCCATCATCAGGAAAACTTCCTCTATCAGCACTTCCGTGACATCTGTGAAATCTGCGCGGCGTATGACGTGGCGCTGTCGCTCGGTGATGGTCTGCGTCCGGGCTCTATTCAGGATGCCAACGACGAAGCCCAGTTCGCTGAACTGCATACTCTCGGCGAGCTGACCAAAACCGCGTGGGAATATGATGTGCAGGTGATGATTGAAGGTCCGGGTCATGTGCCGATGCAGATGATCCGCAAAAACATGACCGAAGAACTGGAACACTGTCATGAAGCGCCGTTCTACACCCTGGGGCCACTGACCACCGATATTGCGCCGGGCTATGACCATTTCACATCCGGTATCGGCGCGGCACTGATCGGCTGGTTCGGCTGTGCCATGCTCTGTTATGTGACCCCGAAAGAGCATCTCGGATTACCGAATAAAGAAGATGTTAAACAAGGGCTTATCACCTATAAAATCGCCGCGCATGCCGCCGATCTCGCCAAAGGGCATCCGGGAGCCCAAATCCGCGATAACGCGATGTCAAAAGCGCGTTTCGAGTTCCGCTGGGAAGATCAGTTCAATCTGGCGCTGGACCCGGAAACTGCCCGGACTTACCACGATGAAACCCTGCCGCAGGCATCCGGCAAAGTCGCACATTTCTGTTCAATGTGCGGGCCGAAATTCTGCTCAATGAAAATCTCACAGGAAGTCCGCGACTACGCTGCCGGGATGGAAGAGATGTCTGACGCCTTCCGCGCCAAAGGCAGCGAGCTGTATCACAGTGCAGAGGAGCGTATCGATGAATCTGCCTGACGCGCCGTTTGCCCGGACGGAACACAAATTAGGGCTGTATCCGGTGGTCG