Homologs in group_1225

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06685 FBDBKF_06685 100.0 Morganella morganii S1 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
EHELCC_09730 EHELCC_09730 100.0 Morganella morganii S2 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
NLDBIP_10110 NLDBIP_10110 100.0 Morganella morganii S4 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
HKOGLL_07195 HKOGLL_07195 100.0 Morganella morganii S5 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
F4V73_RS15255 F4V73_RS15255 95.3 Morganella psychrotolerans - ABC transporter permease
PMI_RS12435 PMI_RS12435 75.8 Proteus mirabilis HI4320 - ABC transporter permease

Distribution of the homologs in the orthogroup group_1225

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1225

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q3Z3V2 4.31e-44 155 31 4 305 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q8FJK9 5.68e-44 155 31 4 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Z862 5.8e-44 155 31 4 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 5.8e-44 155 31 4 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q5PGP5 1.07e-43 155 31 4 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQM2 1.18e-43 155 31 4 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q32IB7 1.31e-43 154 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 1.31e-43 154 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 1.31e-43 154 30 4 305 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 1.31e-43 154 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 1.31e-43 154 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q8X6V7 2.85e-43 154 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q83S26 3.96e-43 153 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q0T6D1 4.13e-43 153 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
P42062 1.18e-42 152 28 3 289 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
Q323W3 2.07e-42 151 30 4 305 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
Q8YBN9 3.2e-40 146 31 3 289 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 3.2e-40 146 31 3 289 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
A0A0H2ZGW7 6.07e-40 145 31 2 303 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q6D3B1 3.78e-39 143 31 3 297 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q2YJK1 7.09e-39 142 31 3 299 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 7.09e-39 142 31 3 299 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q8YDG7 7.41e-39 142 31 3 299 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8FUX0 1.04e-38 142 31 3 299 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
P0AEF8 1.14e-38 142 31 4 311 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 1.14e-38 142 31 4 311 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 1.14e-38 142 31 4 311 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
Q8FWN8 1.25e-38 142 31 3 289 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
A2RI75 6.13e-36 134 31 4 273 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
P45096 3.99e-33 127 29 3 307 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q53191 4.05e-32 124 29 5 309 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q7A5Q6 7.63e-32 124 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 7.63e-32 124 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HG38 8.64e-32 124 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 8.64e-32 124 26 2 310 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 8.64e-32 124 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q8NWT4 9.38e-32 124 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 9.38e-32 124 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
P94311 1.43e-31 123 28 5 335 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P33591 9.39e-31 121 27 4 320 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
Q6GH25 1.68e-30 120 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
P08005 3.55e-30 119 29 10 294 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q2YXY7 3.65e-30 119 26 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0AFH5 1.96e-29 117 29 8 293 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 1.96e-29 117 29 8 293 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 1.96e-29 117 29 8 293 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 1.96e-29 117 29 8 293 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P0A4N8 4.01e-29 117 29 3 260 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 4.01e-29 117 29 3 260 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
P77308 5.47e-29 117 29 4 310 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
P45054 9.71e-29 115 28 7 309 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H3K104 1.29e-28 115 26 3 267 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0AGH3 2.6e-28 114 28 3 269 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 2.6e-28 114 28 3 269 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
Q2FVE8 4.48e-28 114 26 3 267 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
P26903 7.3e-28 113 29 5 282 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
P66967 4.24e-26 108 29 5 273 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 4.24e-26 108 29 5 273 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 4.24e-26 108 29 5 273 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P24138 8.5e-26 107 27 6 310 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
P0A2J3 3.36e-23 100 29 3 269 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 3.36e-23 100 29 3 269 3 sapB Peptide transport system permease protein SapB Salmonella typhi
P75554 1.91e-21 97 25 5 278 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47323 1.61e-20 94 23 4 289 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A9CKL3 3.55e-15 79 26 7 264 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
P0AFU0 4.86e-14 75 25 2 268 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 4.86e-14 75 25 2 268 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
P0A4M8 5.84e-11 66 27 7 212 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 5.84e-11 66 27 7 212 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P45286 6.13e-11 65 24 4 247 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_07645
Feature type CDS
Gene dppB
Product ABC-type dipeptide/oligopeptide/nickel transport system, permease component
Location 39852 - 40820 (strand: 1)
Length 969 (nucleotides) / 322 (amino acids)
In genomic island -

Contig

Accession ZDB_364
Length 217237 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1225
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0601 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)
EP ABC-type dipeptide/oligopeptide/nickel transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02033 peptide/nickel transport system permease protein Quorum sensing -

Protein Sequence

MRSALFLFVRFVCLLTVTAAGVFILLSYSPIDPIRAYIGNDLLHVPPEQYPAIAARWGLDQPLWQRFWIWFSQMLRGDLGYSMLYNAPVSEVISARLGPSLALLISAWLLSGIAGLLLGLVAGRYLNRWPDKIISALSYLLASIPTFWIGLLLLSLFAVTLNWAPICCAWPMGEDADTATFGQKIHHLILPVLALGLLGVGNIALHTRAKVAEVMGTEFIRYAKAQGDKGWPMIKFHVLRHAITPALCLQFASVGELLSGSLLAEKVFAYPGLGQATIDAGLRGDIPLLMGIVMFCAILIFIGNSTADILLRRVNQGVIRES

Flanking regions ( +/- flanking 50bp)

TCATGGTCACTGCTCAACAGCGTGGATGACTGGGCCTGGACCTGTAAATAATGCGCAGTGCCCTGTTCCTTTTCGTGCGGTTTGTTTGTCTGCTGACGGTCACGGCGGCGGGGGTATTTATCCTCCTGAGCTATTCACCGATTGACCCGATCAGAGCCTATATCGGAAATGATCTGCTGCATGTACCACCGGAGCAGTATCCGGCAATCGCTGCCCGCTGGGGGCTGGATCAGCCGCTGTGGCAGCGGTTCTGGATCTGGTTCTCACAGATGCTGCGGGGCGATCTCGGTTACTCTATGCTGTATAACGCGCCGGTGTCAGAGGTGATTTCGGCGCGGCTCGGGCCGTCACTGGCACTCCTTATCAGCGCCTGGCTGCTCTCGGGCATTGCCGGGCTGCTGCTGGGGCTGGTGGCCGGGCGTTATCTGAACCGCTGGCCGGACAAAATTATTTCGGCACTGTCGTATCTGCTGGCTTCGATACCGACATTCTGGATAGGCTTACTGTTATTGTCTCTGTTTGCGGTCACCCTGAACTGGGCACCAATCTGCTGTGCCTGGCCGATGGGCGAGGATGCGGACACGGCAACCTTCGGGCAGAAAATTCATCACCTGATTCTGCCGGTGCTGGCGCTGGGCTTACTCGGTGTCGGTAACATTGCCCTGCACACACGGGCAAAAGTGGCGGAAGTGATGGGGACCGAATTTATCCGTTATGCGAAAGCGCAGGGGGATAAAGGCTGGCCGATGATTAAATTTCATGTGCTGCGTCACGCCATTACCCCGGCACTCTGTTTACAGTTTGCCTCTGTGGGGGAACTGCTGAGCGGTTCGCTGCTGGCGGAGAAAGTGTTCGCCTATCCCGGACTGGGACAGGCGACGATAGACGCGGGGCTGCGGGGGGATATCCCGCTGCTGATGGGTATTGTGATGTTTTGCGCGATCCTGATTTTTATCGGTAACAGCACGGCGGATATTTTACTGCGCCGCGTGAATCAGGGAGTGATCCGCGAATCATGACGTATAACCCGAACCGTGCGCTGTTAAAACTGACGGGCACATTACTGATG