Homologs in group_1165

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_06685 FBDBKF_06685 95.3 Morganella morganii S1 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
EHELCC_09730 EHELCC_09730 95.3 Morganella morganii S2 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
NLDBIP_10110 NLDBIP_10110 95.3 Morganella morganii S4 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
LHKJJB_07645 LHKJJB_07645 95.3 Morganella morganii S3 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
HKOGLL_07195 HKOGLL_07195 95.3 Morganella morganii S5 dppB ABC-type dipeptide/oligopeptide/nickel transport system, permease component
PMI_RS12435 PMI_RS12435 76.1 Proteus mirabilis HI4320 - ABC transporter permease

Distribution of the homologs in the orthogroup group_1165

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1165

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
Q3Z3V2 1.17e-44 157 32 5 302 3 gsiC Glutathione transport system permease protein GsiC Shigella sonnei (strain Ss046)
Q8FJK9 1.57e-44 157 32 5 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q32IB7 4.22e-44 156 31 5 305 3 gsiC Glutathione transport system permease protein GsiC Shigella dysenteriae serotype 1 (strain Sd197)
Q1RE94 4.22e-44 156 31 5 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain UTI89 / UPEC)
P75798 4.22e-44 156 31 5 305 1 gsiC Glutathione transport system permease protein GsiC Escherichia coli (strain K12)
Q0TJL7 4.22e-44 156 31 5 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A970 4.22e-44 156 31 5 305 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O1:K1 / APEC
Q8Z862 7.33e-44 155 33 6 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhi
Q57RB0 7.33e-44 155 33 6 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella choleraesuis (strain SC-B67)
Q8X6V7 8.33e-44 155 32 5 302 3 gsiC Glutathione transport system permease protein GsiC Escherichia coli O157:H7
Q5PGP5 9.66e-44 155 33 6 305 3 gsiC Glutathione transport system permease protein GsiC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8ZQM2 1.12e-43 155 33 6 308 3 gsiC Glutathione transport system permease protein GsiC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q83S26 1.25e-43 154 31 5 305 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri
Q0T6D1 1.25e-43 154 31 5 305 3 gsiC Glutathione transport system permease protein GsiC Shigella flexneri serotype 5b (strain 8401)
Q323W3 6.59e-43 152 31 5 302 3 gsiC Glutathione transport system permease protein GsiC Shigella boydii serotype 4 (strain Sb227)
P42062 7.47e-41 147 27 3 289 3 appB Oligopeptide transport system permease protein AppB Bacillus subtilis (strain 168)
A0A0H2ZGW7 2.08e-40 147 31 2 303 1 dppB Di/tripeptide transport system permease protein DppB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8YBN9 3.05e-39 143 30 3 289 3 BMEII0860 Putative peptide permease protein BMEII0860 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
A5VU90 3.05e-39 143 30 3 289 3 BOV_A0351 Putative peptide permease protein BOV_A0351 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q6D3B1 3.38e-38 140 30 2 294 3 gsiC Glutathione transport system permease protein GsiC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q8FWN8 1.36e-37 139 30 3 289 3 BRA0408 Putative peptide permease protein BRA0408/BS1330_II0405 Brucella suis biovar 1 (strain 1330)
Q8YDG7 1.69e-37 139 30 3 299 3 BMEII0209 Putative peptide transport system permease protein BMEII0209 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK1 1.79e-37 139 30 3 299 3 BAB2_1050 Putative peptide transport system permease protein BAB2_1050 Brucella abortus (strain 2308)
Q8VQK4 1.79e-37 139 30 3 299 3 BruAb2_1031 Putative peptide transport system permease protein BruAb2_1031 Brucella abortus biovar 1 (strain 9-941)
Q8FUX0 2.88e-37 138 30 3 299 3 BRA1092 Putative peptide transport system permease protein BRA1092/BS1330_II1084 Brucella suis biovar 1 (strain 1330)
P0AEF8 2.34e-36 136 30 4 316 1 dppB Dipeptide transport system permease protein DppB Escherichia coli (strain K12)
P0AEF9 2.34e-36 136 30 4 316 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG0 2.34e-36 136 30 4 316 3 dppB Dipeptide transport system permease protein DppB Escherichia coli O157:H7
A2RI75 2.58e-35 132 31 4 265 1 dppB Dipeptide transport system permease protein DppB Lactococcus lactis subsp. cremoris (strain MG1363)
P45096 1.08e-32 126 28 4 328 3 dppB Dipeptide transport system permease protein DppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q53191 4.94e-31 122 28 4 308 3 NGR_a01430 Probable peptide ABC transporter permease protein y4tP Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P94311 1.29e-30 121 27 5 335 3 dppB Dipeptide transport system permease protein DppB Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P77308 1.29e-29 118 29 4 304 1 ddpB Probable D,D-dipeptide transport system permease protein DdpB Escherichia coli (strain K12)
Q8NWT4 3.04e-29 117 24 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MW2)
Q6G9H8 3.04e-29 117 24 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MSSA476)
Q5HG38 3.04e-29 117 24 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain COL)
Q2FYQ5 3.04e-29 117 24 2 310 1 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH55 3.04e-29 117 24 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain USA300)
Q7A5Q6 3.17e-29 117 24 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain N315)
Q99UA0 3.17e-29 117 24 2 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain Mu50 / ATCC 700699)
P33591 5.28e-29 116 26 4 320 1 nikB Nickel transport system permease protein NikB Escherichia coli (strain K12)
P45054 7.43e-29 115 28 7 314 3 oppB Oligopeptide transport system permease protein OppB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AFH5 8.67e-29 115 28 8 298 3 oppB Oligopeptide transport system permease protein OppB Shigella flexneri
P0AFH2 8.67e-29 115 28 8 298 1 oppB Oligopeptide transport system permease protein OppB Escherichia coli (strain K12)
P0AFH3 8.67e-29 115 28 8 298 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFH4 8.67e-29 115 28 8 298 3 oppB Oligopeptide transport system permease protein OppB Escherichia coli O157:H7
P08005 9.13e-29 115 29 8 277 1 oppB Oligopeptide transport system permease protein OppB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0AGH3 2.6e-28 114 28 3 269 1 sapB Putrescine export system permease protein SapB Escherichia coli (strain K12)
P0AGH4 2.6e-28 114 28 3 269 3 sapB Peptide transport system permease protein SapB Escherichia coli O157:H7
Q6GH25 5.86e-28 114 25 3 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain MRSA252)
Q2YXY7 1.86e-27 112 25 3 310 3 nikB Nickel import system permease protein NikB Staphylococcus aureus (strain bovine RF122 / ET3-1)
P0A4N8 2.65e-27 112 28 3 260 3 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N7 2.65e-27 112 28 3 260 1 oppB Oligopeptide transport system permease protein OppB Lactococcus lactis subsp. lactis (strain IL1403)
P26903 8.58e-27 110 28 5 282 2 dppB Dipeptide transport system permease protein DppB Bacillus subtilis (strain 168)
A0A0H3K104 9.93e-27 110 26 3 267 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2FVE8 2.23e-26 109 25 3 267 1 cntB Metal-staphylopine import system permease protein CntB Staphylococcus aureus (strain NCTC 8325 / PS 47)
P24138 7.92e-25 105 26 6 310 1 oppB Oligopeptide transport system permease protein OppB Bacillus subtilis (strain 168)
P66967 9.49e-25 105 27 6 295 3 BQ2027_MB1314C Putative peptide transport permease protein Mb1314c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ7 9.49e-25 105 27 6 295 1 Rv1283c Putative peptide transport permease protein Rv1283c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ6 9.49e-25 105 27 6 295 3 MT1320 Putative peptide transport permease protein MT1320 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A2J3 5.72e-23 100 28 3 269 2 sapB Peptide transport system permease protein SapB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J4 5.72e-23 100 28 3 269 3 sapB Peptide transport system permease protein SapB Salmonella typhi
P75554 1.25e-21 97 25 5 278 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P47323 6.81e-18 87 22 4 289 3 oppB Oligopeptide transport system permease protein OppB Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
A9CKL3 1.76e-14 76 26 7 264 3 yejB Peptidoglycan transport system permease protein YejB Agrobacterium fabrum (strain C58 / ATCC 33970)
P0AFU0 1.01e-13 74 25 2 268 1 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli (strain K12)
P0AFU1 1.01e-13 74 25 2 268 3 yejB Inner membrane ABC transporter permease protein YejB Escherichia coli O157:H7
P45286 1.47e-10 64 24 4 247 3 sapB Peptide transport system permease protein SapB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A4M8 1.53e-10 65 27 6 186 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M7 1.53e-10 65 27 6 186 3 amiC Oligopeptide transport system permease protein AmiC Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P94312 0.000381 45 26 4 153 3 dppC Dipeptide transport system permease protein DppC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS15255
Feature type CDS
Gene -
Product ABC transporter permease
Location 37436 - 38404 (strand: 1)
Length 969 (nucleotides) / 322 (amino acids)

Contig

Accession term accessions NZ_VXKB01000005 accessions NZ_VXKB01000000 Name: value, dtype: object
Length 213534 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1165
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0601 Amino acid transport and metabolism (E)
Inorganic ion transport and metabolism (P)		 EP ABC-type dipeptide/oligopeptide/nickel transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02033 peptide/nickel transport system permease protein Quorum sensing -

Protein Sequence

MRSALFLFVRFVCLLTVTAAGVFILLSYSPIDPIRAYIGNDLLHVPPEQYPVIAARWGLDQPLWQRFWIWFSQMIRGDLGYSMLYNAPVSEVISARLGPSLALLISAWFFSGIAGLLMGLVAGRYLNRWPDKIISALSYLLASIPTFWIGLLLLSLFAVSLQWAPVCCAWPMGEDADSATFGQKVHHLILPVLALGLLGVGNIALHTRAKVAEVMSTEFIHYAKAQGDKGWPMIKFHVLRHAITPALCLQFASVGELLSGSLLAEKVFAYPGLGQATIDAGLRGDIPLLMGIVMFCAILIFMGNSTADILLRRINRGVIRES

Flanking regions ( +/- flanking 50bp)

TCGTGGTCACTGTTAAACAGCGTGGATGACTGGGCCTGGACCTGTAAATAATGCGCAGTGCACTATTTCTTTTTGTGCGGTTTGTTTGTCTGCTGACGGTGACAGCTGCGGGGGTGTTTATCCTCCTCAGCTATTCACCGATAGATCCGATCAGAGCCTATATCGGAAACGATTTATTGCACGTACCACCGGAGCAATACCCGGTGATCGCCGCCCGCTGGGGGCTGGATCAACCGCTGTGGCAGCGTTTTTGGATCTGGTTTTCACAGATGATCAGAGGCGATCTCGGGTATTCGATGCTGTATAACGCGCCGGTGTCTGAGGTGATTTCAGCAAGGCTGGGTCCGTCACTGGCGCTGCTTATCAGTGCCTGGTTTTTCTCCGGTATTGCCGGGCTGCTGATGGGGCTGGTGGCAGGGCGATATCTGAATCGCTGGCCGGATAAAATTATTTCAGCACTATCCTATCTGTTGGCGTCGATCCCGACATTCTGGATAGGGCTGCTGTTACTGTCCCTGTTTGCAGTTTCGCTGCAATGGGCACCGGTCTGCTGCGCCTGGCCGATGGGCGAAGATGCTGACAGTGCAACATTCGGACAGAAGGTTCACCATCTGATCCTGCCGGTACTGGCGCTGGGGTTGCTCGGTGTCGGAAATATCGCTCTGCATACGCGGGCAAAAGTGGCGGAAGTGATGAGCACTGAATTTATCCACTACGCAAAAGCGCAGGGGGATAAAGGCTGGCCGATGATTAAATTTCATGTGCTGCGCCACGCGATTACACCGGCGCTCTGTTTACAGTTTGCGTCTGTCGGGGAATTACTGAGCGGCTCCCTGCTGGCGGAAAAGGTGTTTGCCTATCCGGGACTCGGGCAGGCGACAATAGATGCGGGGTTGCGGGGTGATATCCCGTTACTGATGGGCATTGTGATGTTTTGCGCTATCCTGATTTTTATGGGCAACAGCACAGCCGATATTCTGCTGCGCCGTATTAACCGGGGGGTTATCCGCGAATCATGACCTATAACCCGAACCGTGCACTGCTAAGACTGATCGGCACATTACTGATG