Homologs in group_956

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04565 FBDBKF_04565 100.0 Morganella morganii S1 hcp hydroxylamine reductase
EHELCC_05855 EHELCC_05855 100.0 Morganella morganii S2 hcp hydroxylamine reductase
NLDBIP_06175 NLDBIP_06175 100.0 Morganella morganii S4 hcp hydroxylamine reductase
HKOGLL_06530 HKOGLL_06530 100.0 Morganella morganii S5 hcp hydroxylamine reductase
F4V73_RS09020 F4V73_RS09020 88.0 Morganella psychrotolerans hcp hydroxylamine reductase
PMI_RS10405 PMI_RS10405 82.5 Proteus mirabilis HI4320 hcp hydroxylamine reductase

Distribution of the homologs in the orthogroup group_956

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_956

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1C2 0.0 972 82 0 550 3 hcp Hydroxylamine reductase Proteus mirabilis (strain HI4320)
C6DF39 0.0 934 79 0 550 3 hcp Hydroxylamine reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D3T2 0.0 934 79 0 550 3 hcp Hydroxylamine reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JMA4 0.0 932 78 0 549 3 hcp Hydroxylamine reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C5BEA9 0.0 927 78 0 549 3 hcp Hydroxylamine reductase Edwardsiella ictaluri (strain 93-146)
A4TN50 0.0 924 78 0 549 3 hcp Hydroxylamine reductase Yersinia pestis (strain Pestoides F)
Q1CGD1 0.0 924 78 0 549 3 hcp Hydroxylamine reductase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4X7 0.0 924 78 0 549 3 hcp Hydroxylamine reductase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGE1 0.0 924 78 0 549 3 hcp Hydroxylamine reductase Yersinia pestis
Q1CAA5 0.0 924 78 0 549 3 hcp Hydroxylamine reductase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FK04 0.0 924 78 0 549 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JRH0 0.0 922 78 0 549 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CL7 0.0 922 78 0 549 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9Z2 0.0 922 78 0 549 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
A7ZJU2 0.0 891 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
B7NPH0 0.0 890 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LN27 0.0 890 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain SMS-3-5 / SECEC)
B6I8U4 0.0 890 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain SE11)
Q0T8K8 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Shigella flexneri serotype 5b (strain 8401)
Q1RE52 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain UTI89 / UPEC)
Q8FJE0 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJH6 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A9B1 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O1:K1 / APEC
B7LN38 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B7NAM4 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B7M801 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O8 (strain IAI1)
B7MQX7 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O81 (strain ED1a)
B5YSG9 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6L0 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O157:H7
B7LD66 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain 55989 / EAEC)
B7MHH8 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMW5 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
P75825 0.0 889 75 0 550 1 hcp Hydroxylamine reductase Escherichia coli (strain K12)
B1IWP9 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYH7 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O9:H4 (strain HS)
B1X814 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain K12 / DH10B)
C4ZY45 0.0 889 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain K12 / MC4100 / BW2952)
Q83S05 0.0 886 75 0 550 3 hcp Hydroxylamine reductase Shigella flexneri
A4W8P1 0.0 885 74 0 550 3 hcp Hydroxylamine reductase Enterobacter sp. (strain 638)
Q323M9 0.0 885 75 0 550 3 hcp Hydroxylamine reductase Shigella boydii serotype 4 (strain Sb227)
B2TUK6 0.0 885 75 0 550 3 hcp Hydroxylamine reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
Q3Z3R0 0.0 885 75 0 550 3 hcp Hydroxylamine reductase Shigella sonnei (strain Ss046)
Q32DZ1 0.0 884 75 0 550 3 hcp Hydroxylamine reductase Shigella dysenteriae serotype 1 (strain Sd197)
B5BBT7 0.0 883 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi A (strain AKU_12601)
Q5PGK4 0.0 883 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TRQ3 0.0 882 74 0 550 3 hcp Hydroxylamine reductase Salmonella schwarzengrund (strain CVM19633)
B5QYM1 0.0 882 74 0 550 3 hcp Hydroxylamine reductase Salmonella enteritidis PT4 (strain P125109)
A9N804 0.0 882 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B4T0F9 0.0 882 74 0 550 3 hcp Hydroxylamine reductase Salmonella newport (strain SL254)
B4TCZ8 0.0 882 74 0 550 3 hcp Hydroxylamine reductase Salmonella heidelberg (strain SL476)
B5F118 0.0 882 74 0 550 3 hcp Hydroxylamine reductase Salmonella agona (strain SL483)
C0PXQ7 0.0 881 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi C (strain RKS4594)
Q57R63 0.0 881 74 0 550 3 hcp Hydroxylamine reductase Salmonella choleraesuis (strain SC-B67)
Q8ZQE8 0.0 881 74 0 550 3 hcp Hydroxylamine reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5R885 0.0 881 74 0 550 3 hcp Hydroxylamine reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q8Z829 0.0 880 74 0 550 3 hcp Hydroxylamine reductase Salmonella typhi
B5FQ13 0.0 880 74 0 550 3 hcp Hydroxylamine reductase Salmonella dublin (strain CT_02021853)
B5XYB9 0.0 874 73 0 550 3 hcp Hydroxylamine reductase Klebsiella pneumoniae (strain 342)
B0BRE1 0.0 815 67 1 549 3 hcp Hydroxylamine reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2J4 0.0 815 67 1 549 3 hcp Hydroxylamine reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
A6VL83 0.0 813 67 1 550 3 hcp Hydroxylamine reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B3GYM9 0.0 811 67 1 549 3 hcp Hydroxylamine reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q65VW2 0.0 805 66 1 549 3 hcp Hydroxylamine reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A0KHA2 0.0 756 64 1 550 3 hcp Hydroxylamine reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SQN8 0.0 746 62 1 550 3 hcp Hydroxylamine reductase Aeromonas salmonicida (strain A449)
A8H1E5 0.0 739 61 1 551 3 hcp Hydroxylamine reductase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
Q7MLM1 0.0 738 61 2 555 3 hcp Hydroxylamine reductase Vibrio vulnificus (strain YJ016)
Q87QG0 0.0 734 62 2 554 3 hcp Hydroxylamine reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8D8V3 0.0 733 61 2 555 3 hcp Hydroxylamine reductase Vibrio vulnificus (strain CMCP6)
Q8G969 0.0 732 61 3 560 3 hcp Hydroxylamine reductase Photobacterium phosphoreum
A0KZL7 0.0 729 61 2 552 3 hcp Hydroxylamine reductase Shewanella sp. (strain ANA-3)
Q5DZ63 0.0 729 61 2 554 3 hcp Hydroxylamine reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
B5EV28 0.0 728 61 2 554 3 hcp Hydroxylamine reductase Aliivibrio fischeri (strain MJ11)
Q0HGB4 0.0 727 61 2 552 3 hcp Hydroxylamine reductase Shewanella sp. (strain MR-4)
Q0HSK7 0.0 726 61 2 552 3 hcp Hydroxylamine reductase Shewanella sp. (strain MR-7)
A1S3Z6 0.0 723 61 2 551 3 hcp Hydroxylamine reductase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
A8FSF3 0.0 722 61 3 552 3 hcp Hydroxylamine reductase Shewanella sediminis (strain HAW-EB3)
Q8EH67 0.0 722 61 2 552 3 hcp Hydroxylamine reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
C4LA04 0.0 717 61 2 554 3 hcp Hydroxylamine reductase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A6WKS2 0.0 717 61 2 552 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS185)
B7VQW0 0.0 717 60 2 554 3 hcp Hydroxylamine reductase Vibrio atlanticus (strain LGP32)
A1RMB2 0.0 716 60 2 552 3 hcp Hydroxylamine reductase Shewanella sp. (strain W3-18-1)
A4Y4L9 0.0 716 60 2 552 3 hcp Hydroxylamine reductase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A3D1X1 0.0 716 60 2 551 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8EBN7 0.0 716 60 2 551 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS223)
A3QBU2 0.0 715 60 2 552 3 hcp Hydroxylamine reductase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
B1KI74 0.0 714 60 3 552 3 hcp Hydroxylamine reductase Shewanella woodyi (strain ATCC 51908 / MS32)
A9L5Q1 0.0 711 60 2 552 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS195)
Q6LG35 0.0 701 60 2 553 3 hcp Hydroxylamine reductase Photobacterium profundum (strain SS9)
Q07X28 0.0 696 58 2 551 3 hcp Hydroxylamine reductase Shewanella frigidimarina (strain NCIMB 400)
Q6WRT6 0.0 646 57 2 554 1 hcp Hydroxylamine reductase Rhodobacter capsulatus
A4JPG9 0.0 577 53 3 542 3 hcp Hydroxylamine reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A5FZG9 0.0 576 50 4 549 3 hcp Hydroxylamine reductase Acidiphilium cryptum (strain JF-5)
Q397X6 0.0 571 53 3 552 3 hcp Hydroxylamine reductase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
C6C030 0.0 563 51 9 552 3 hcp Hydroxylamine reductase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
Q0B880 0.0 556 52 3 541 3 hcp Hydroxylamine reductase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YXE9 0.0 556 52 3 541 3 hcp Hydroxylamine reductase Burkholderia ambifaria (strain MC40-6)
A0LNW5 0.0 553 50 5 549 3 hcp Hydroxylamine reductase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
B5ERR7 0.0 551 49 4 540 3 hcp Hydroxylamine reductase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
Q0W3X3 0.0 542 49 4 549 3 hcp Hydroxylamine reductase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
P96095 0.0 538 48 5 540 3 hcp Hydroxylamine reductase Acidithiobacillus ferridurans
B5YHX5 0.0 530 47 8 553 3 hcp Hydroxylamine reductase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
C4XL87 4.43e-179 518 49 7 553 3 hcp Hydroxylamine reductase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B7JYM8 4.17e-177 513 46 9 564 3 hcp Hydroxylamine reductase Rippkaea orientalis (strain PCC 8801 / RF-1)
Q3M890 2.16e-175 509 46 7 551 3 hcp Hydroxylamine reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q39RS2 1.89e-172 501 45 7 556 3 hcp Hydroxylamine reductase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B0JIR2 5.65e-170 495 45 8 554 3 hcp Hydroxylamine reductase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B1WRV9 1.68e-169 494 45 7 556 3 hcp Hydroxylamine reductase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q74FD5 2.75e-169 494 46 8 555 3 hcp Hydroxylamine reductase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q2RQN9 1.05e-168 492 48 8 553 3 hcp Hydroxylamine reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
B7KLG3 3.79e-165 483 44 11 561 3 hcp Hydroxylamine reductase Gloeothece citriformis (strain PCC 7424)
Q1MPA7 6.03e-160 469 44 9 553 3 hcp Hydroxylamine reductase Lawsonia intracellularis (strain PHE/MN1-00)
Q5NRB3 2.32e-159 468 44 7 552 3 hcp Hydroxylamine reductase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B2A0K0 4.25e-156 460 41 9 562 3 hcp Hydroxylamine reductase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
B8FWP2 3.29e-153 452 42 11 562 3 hcp Hydroxylamine reductase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
C5CIJ2 1.4e-152 451 42 9 570 3 hcp Hydroxylamine reductase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
Q24S27 2.32e-152 450 42 11 562 3 hcp Hydroxylamine reductase Desulfitobacterium hafniense (strain Y51)
B8CZ59 4.29e-152 450 42 10 562 3 hcp Hydroxylamine reductase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q8R6M9 5.76e-152 449 42 11 562 3 hcp Hydroxylamine reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q898N5 6.72e-152 450 41 11 575 3 hcp Hydroxylamine reductase Clostridium tetani (strain Massachusetts / E88)
Q8XHA1 7.71e-149 441 43 12 561 3 hcp Hydroxylamine reductase Clostridium perfringens (strain 13 / Type A)
A0Q355 1.04e-148 441 41 9 556 3 hcp Hydroxylamine reductase Clostridium novyi (strain NT)
B0K5Y2 1.79e-147 438 42 10 556 3 hcp Hydroxylamine reductase Thermoanaerobacter sp. (strain X514)
B0KD48 2.11e-147 437 42 10 556 3 hcp Hydroxylamine reductase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q2RM63 7.91e-147 432 51 4 406 3 hcp Hydroxylamine reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RM63 3.6e-12 72 40 2 100 3 hcp Hydroxylamine reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
B3QXZ3 8.6e-147 436 43 7 551 3 hcp Hydroxylamine reductase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q01770 1.43e-145 433 42 12 564 1 hcp Hydroxylamine reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
A6LCQ4 2.25e-145 432 41 11 560 3 hcp Hydroxylamine reductase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B1KYK8 8.86e-144 429 40 11 570 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Loch Maree / Type A3)
A7GH10 1.52e-143 429 40 11 570 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
A7FX38 1.93e-143 428 40 11 570 3 hcp Hydroxylamine reductase Clostridium botulinum (strain ATCC 19397 / Type A)
B1IKK5 4.4e-143 427 40 11 570 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Okra / Type B1)
Q8A9X8 8.91e-143 426 43 9 558 3 hcp Hydroxylamine reductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
C1FUX4 9.48e-143 426 40 11 570 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Kyoto / Type A2)
C3L261 1.76e-142 426 40 11 570 3 hcp Hydroxylamine reductase Clostridium botulinum (strain 657 / Type Ba4)
A6LL16 2.1e-142 425 40 10 570 3 hcp Hydroxylamine reductase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q97FI7 3.75e-142 424 40 8 549 3 hcp1 Hydroxylamine reductase 1 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8RFL1 7.86e-142 424 39 12 565 3 hcp Hydroxylamine reductase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
A9BHK9 9.65e-142 423 40 10 554 3 hcp Hydroxylamine reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
A3DBE8 1.88e-140 420 41 10 551 3 hcp Hydroxylamine reductase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8PS69 2.14e-140 419 42 9 558 3 hcp Hydroxylamine reductase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q58175 1.77e-139 417 39 11 556 3 hcp Hydroxylamine reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q64UD5 2.03e-139 417 41 10 564 3 hcp Hydroxylamine reductase Bacteroides fragilis (strain YCH46)
B2RJM1 2.61e-139 417 40 10 559 3 hcp Hydroxylamine reductase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
Q8KBT4 5.63e-139 416 43 15 558 3 hcp Hydroxylamine reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q7MVY0 7.62e-139 416 39 10 559 3 hcp Hydroxylamine reductase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q5LDB2 9.87e-138 413 41 10 564 3 hcp Hydroxylamine reductase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
P31101 4.12e-137 411 42 10 560 1 hcp Hydroxylamine reductase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q97DP4 3.39e-134 404 38 14 568 3 hcp2 Hydroxylamine reductase 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A8ZYF3 8.93e-132 397 40 13 561 3 hcp Hydroxylamine reductase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
A6USL5 7.64e-131 395 39 11 556 3 hcp Hydroxylamine reductase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A5IN10 4.36e-118 358 43 2 394 3 hcp Hydroxylamine reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A5IN10 1.29e-12 73 42 2 91 3 hcp Hydroxylamine reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X0Q4 1.18e-117 357 43 2 394 3 hcp Hydroxylamine reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X0Q4 2.94e-13 75 43 2 91 3 hcp Hydroxylamine reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O27502 7.03e-113 345 43 5 397 3 hcp Hydroxylamine reductase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27502 2.74e-15 81 44 2 100 3 hcp Hydroxylamine reductase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8Q0L5 2.21e-09 63 23 20 383 3 cooS1 Carbon monoxide dehydrogenase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TKW2 3.46e-07 57 22 18 358 3 cooS1 Carbon monoxide dehydrogenase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
P31896 0.000321 47 26 6 163 1 cooS Carbon monoxide dehydrogenase Rhodospirillum rubrum
P59934 0.000848 45 25 6 203 1 cooS1 Carbon monoxide dehydrogenase 1 Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_03055
Feature type CDS
Gene hcp
Product hydroxylamine reductase
Location 186025 - 187677 (strand: -1)
Length 1653 (nucleotides) / 550 (amino acids)
In genomic island -

Contig

Accession ZDB_360
Length 302856 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_956
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03063 Prismane/CO dehydrogenase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1151 Energy production and conversion (C) C Hydroxylamine reductase (hybrid-cluster protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05601 hydroxylamine reductase [EC:1.7.99.1] Nitrogen metabolism
Metabolic pathways
-

Protein Sequence

MYCVQCEQTMRTPVGNGCAYAQGMCGKTAETSDLQDLLVAVLESLSAWAVAARESGIIDHDTDSFAPRAFFSTLTNVNFDSERIIGYAQEAIVMRDSLMKRCLAKNPALVLNHPLANLQLKGTDIASLVKQADEFALNKDKQAIGDDIHGLRMLCLYGLKGAAAYMEHAHVLGKYSDEIYGQYHEIMAWLGTDPSDMGELLNQSMAIGMMNFKIMEMLDAGETEAYGHPTPSSVNVRPVAGKAILISGHDLKDLHMLLQQTEGTGVNIYTHGEMLPAHGYPELKKYKHLVGNYGSGWQNQQTEFAKFPGPILMTSNCILDPNPGSYTDRIWTRSIVGWPGAKHLTGDDFSDLIAQAQAMDGFPYSEIEHLITVGFGRETLLNAADTVIDLVATGKLRHVFLVGGCDGSRGERSYYTDFARQVPQDCLIMTLACGKYRFNKLDFGTLEGLPRLLDVGQCNDAYSAIMLAVKLAEKLGCGVNDLPLTLVLSWFEQKAIVILLTLLALGVKDIFTGPTAPAFLTDNLLNVLNEKFGMRPITTVENDLHAVLGA

Flanking regions ( +/- flanking 50bp)

GGCGTATTCTTATGTTGCATATAAAATACAACTTATAAGGAAGCAAGAGCATGTACTGTGTGCAATGTGAACAAACGATGCGTACACCGGTGGGTAATGGCTGTGCCTATGCCCAGGGCATGTGCGGTAAAACCGCAGAAACATCTGACTTACAGGATCTGCTGGTGGCAGTACTGGAAAGTCTTTCAGCGTGGGCGGTTGCTGCGCGTGAATCAGGTATCATCGATCACGACACAGACAGCTTTGCGCCGCGTGCATTTTTCTCCACATTAACTAACGTTAACTTCGATTCTGAGCGCATCATCGGTTATGCGCAGGAAGCGATTGTGATGCGTGACAGCCTGATGAAACGCTGCCTGGCGAAAAACCCGGCACTGGTTCTGAATCACCCGTTAGCAAACCTGCAACTGAAGGGCACGGATATTGCGTCACTGGTGAAACAGGCGGATGAATTTGCCCTGAATAAAGATAAGCAGGCTATCGGTGATGATATCCACGGTCTGCGTATGCTCTGCCTGTACGGACTGAAAGGGGCGGCGGCATATATGGAGCACGCCCATGTGCTGGGCAAATACAGCGATGAAATTTACGGCCAGTACCATGAAATCATGGCGTGGCTCGGTACTGATCCGTCTGATATGGGTGAGCTGCTCAACCAGTCTATGGCGATTGGTATGATGAACTTTAAAATCATGGAAATGCTGGATGCCGGTGAAACCGAAGCTTACGGTCACCCGACGCCGTCTTCCGTGAACGTCCGTCCGGTGGCAGGTAAAGCGATTCTGATCTCCGGTCATGACCTCAAAGATCTGCATATGCTGCTGCAACAGACAGAAGGCACCGGTGTGAACATTTACACTCACGGTGAAATGCTGCCTGCACACGGCTATCCGGAACTGAAAAAATACAAGCATCTGGTCGGTAACTACGGCAGCGGCTGGCAGAACCAGCAGACTGAGTTTGCCAAATTCCCGGGCCCGATCCTGATGACCTCCAACTGTATTCTGGATCCGAATCCGGGCAGTTATACCGACCGTATCTGGACCCGCAGCATCGTCGGCTGGCCGGGCGCGAAACACCTGACCGGTGATGATTTCAGCGATCTTATCGCGCAGGCTCAGGCGATGGACGGCTTCCCGTACAGCGAAATCGAGCACCTGATCACCGTCGGTTTCGGCCGCGAAACCCTGCTCAATGCAGCGGATACCGTGATTGACCTGGTGGCTACCGGCAAACTGCGTCATGTGTTCCTCGTCGGCGGATGCGACGGCAGCCGCGGTGAACGCAGCTACTACACCGATTTCGCCCGTCAGGTGCCTCAGGACTGCCTGATTATGACTCTGGCCTGCGGTAAATACCGTTTCAACAAACTGGATTTCGGTACCCTGGAAGGATTACCGCGCCTGCTTGATGTCGGTCAGTGCAACGATGCGTACTCCGCGATTATGCTGGCGGTGAAACTGGCTGAGAAACTGGGCTGCGGCGTCAATGATCTGCCGCTGACACTGGTGCTCTCCTGGTTTGAACAGAAAGCGATTGTGATTCTGCTGACTCTGCTGGCGCTGGGTGTGAAGGATATCTTCACCGGCCCGACCGCTCCGGCATTCCTGACTGACAATCTGCTGAATGTACTGAATGAAAAATTTGGTATGCGTCCGATTACCACTGTTGAAAATGATTTACACGCTGTGTTAGGCGCGTAATTGCTGTAACTGTTAGCACCGGAGAAGGCGGTCACGCCTTCTCCGGCACG