Homologs in group_956

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04565 FBDBKF_04565 82.5 Morganella morganii S1 hcp hydroxylamine reductase
EHELCC_05855 EHELCC_05855 82.5 Morganella morganii S2 hcp hydroxylamine reductase
NLDBIP_06175 NLDBIP_06175 82.5 Morganella morganii S4 hcp hydroxylamine reductase
LHKJJB_03055 LHKJJB_03055 82.5 Morganella morganii S3 hcp hydroxylamine reductase
HKOGLL_06530 HKOGLL_06530 82.5 Morganella morganii S5 hcp hydroxylamine reductase
F4V73_RS09020 F4V73_RS09020 80.7 Morganella psychrotolerans hcp hydroxylamine reductase

Distribution of the homologs in the orthogroup group_956

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_956

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F1C2 0.0 1142 100 0 550 3 hcp Hydroxylamine reductase Proteus mirabilis (strain HI4320)
A1JMA4 0.0 976 82 0 548 3 hcp Hydroxylamine reductase Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
C6DF39 0.0 969 82 0 550 3 hcp Hydroxylamine reductase Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D3T2 0.0 964 81 0 550 3 hcp Hydroxylamine reductase Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A4TN50 0.0 962 82 0 548 3 hcp Hydroxylamine reductase Yersinia pestis (strain Pestoides F)
Q1CGD1 0.0 962 82 0 548 3 hcp Hydroxylamine reductase Yersinia pestis bv. Antiqua (strain Nepal516)
A9R4X7 0.0 962 82 0 548 3 hcp Hydroxylamine reductase Yersinia pestis bv. Antiqua (strain Angola)
Q8ZGE1 0.0 962 82 0 548 3 hcp Hydroxylamine reductase Yersinia pestis
Q1CAA5 0.0 962 82 0 548 3 hcp Hydroxylamine reductase Yersinia pestis bv. Antiqua (strain Antiqua)
A7FK04 0.0 962 82 0 548 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
B1JRH0 0.0 961 82 0 548 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66CL7 0.0 961 82 0 548 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype I (strain IP32953)
B2K9Z2 0.0 961 82 0 548 3 hcp Hydroxylamine reductase Yersinia pseudotuberculosis serotype IB (strain PB1/+)
C5BEA9 0.0 954 81 0 548 3 hcp Hydroxylamine reductase Edwardsiella ictaluri (strain 93-146)
P75825 0.0 900 75 0 550 1 hcp Hydroxylamine reductase Escherichia coli (strain K12)
B1IWP9 0.0 900 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A7ZYH7 0.0 900 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O9:H4 (strain HS)
B1X814 0.0 900 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain K12 / DH10B)
C4ZY45 0.0 900 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain K12 / MC4100 / BW2952)
B7NPH0 0.0 899 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LN27 0.0 899 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain SMS-3-5 / SECEC)
B6I8U4 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain SE11)
Q8FJE0 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q1RE52 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain UTI89 / UPEC)
B7NAM4 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
Q0TJH6 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A9B1 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O1:K1 / APEC
B7M801 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O8 (strain IAI1)
B7MQX7 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O81 (strain ED1a)
B5YSG9 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8X6L0 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O157:H7
B7LD66 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli (strain 55989 / EAEC)
B7MHH8 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O45:K1 (strain S88 / ExPEC)
B7UMW5 0.0 898 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O127:H6 (strain E2348/69 / EPEC)
A7ZJU2 0.0 897 75 0 550 3 hcp Hydroxylamine reductase Escherichia coli O139:H28 (strain E24377A / ETEC)
Q323M9 0.0 897 75 0 550 3 hcp Hydroxylamine reductase Shigella boydii serotype 4 (strain Sb227)
B2TUK6 0.0 897 75 0 550 3 hcp Hydroxylamine reductase Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LN38 0.0 897 75 0 550 3 hcp Hydroxylamine reductase Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q0T8K8 0.0 896 75 0 550 3 hcp Hydroxylamine reductase Shigella flexneri serotype 5b (strain 8401)
Q3Z3R0 0.0 895 75 0 550 3 hcp Hydroxylamine reductase Shigella sonnei (strain Ss046)
B4TRQ3 0.0 895 75 0 550 3 hcp Hydroxylamine reductase Salmonella schwarzengrund (strain CVM19633)
Q83S05 0.0 894 75 0 550 3 hcp Hydroxylamine reductase Shigella flexneri
B5BBT7 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi A (strain AKU_12601)
A9N804 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PGK4 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4T0F9 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella newport (strain SL254)
B4TCZ8 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella heidelberg (strain SL476)
B5QYM1 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella enteritidis PT4 (strain P125109)
B5F118 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Salmonella agona (strain SL483)
A4W8P1 0.0 894 74 0 550 3 hcp Hydroxylamine reductase Enterobacter sp. (strain 638)
Q8ZQE8 0.0 893 74 0 550 3 hcp Hydroxylamine reductase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
C0PXQ7 0.0 892 74 0 550 3 hcp Hydroxylamine reductase Salmonella paratyphi C (strain RKS4594)
B5R885 0.0 892 74 0 550 3 hcp Hydroxylamine reductase Salmonella gallinarum (strain 287/91 / NCTC 13346)
Q57R63 0.0 892 74 0 550 3 hcp Hydroxylamine reductase Salmonella choleraesuis (strain SC-B67)
B5FQ13 0.0 892 74 0 550 3 hcp Hydroxylamine reductase Salmonella dublin (strain CT_02021853)
Q32DZ1 0.0 890 75 0 550 3 hcp Hydroxylamine reductase Shigella dysenteriae serotype 1 (strain Sd197)
Q8Z829 0.0 890 74 0 550 3 hcp Hydroxylamine reductase Salmonella typhi
B5XYB9 0.0 889 74 0 550 3 hcp Hydroxylamine reductase Klebsiella pneumoniae (strain 342)
A6VL83 0.0 823 67 1 549 3 hcp Hydroxylamine reductase Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
Q65VW2 0.0 821 67 1 550 3 hcp Hydroxylamine reductase Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
B0BRE1 0.0 817 66 1 550 3 hcp Hydroxylamine reductase Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
A3N2J4 0.0 817 66 1 550 3 hcp Hydroxylamine reductase Actinobacillus pleuropneumoniae serotype 5b (strain L20)
B3GYM9 0.0 815 66 1 550 3 hcp Hydroxylamine reductase Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
A0KHA2 0.0 757 64 1 550 3 hcp Hydroxylamine reductase Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A4SQN8 0.0 749 63 2 551 3 hcp Hydroxylamine reductase Aeromonas salmonicida (strain A449)
C4LA04 0.0 744 63 2 555 3 hcp Hydroxylamine reductase Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
Q8G969 0.0 743 63 2 554 3 hcp Hydroxylamine reductase Photobacterium phosphoreum
A8H1E5 0.0 743 63 3 552 3 hcp Hydroxylamine reductase Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A3QBU2 0.0 741 63 2 553 3 hcp Hydroxylamine reductase Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q8EH67 0.0 739 62 1 552 3 hcp Hydroxylamine reductase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q0HSK7 0.0 739 62 2 555 3 hcp Hydroxylamine reductase Shewanella sp. (strain MR-7)
A0KZL7 0.0 739 62 2 555 3 hcp Hydroxylamine reductase Shewanella sp. (strain ANA-3)
A1S3Z6 0.0 738 63 2 552 3 hcp Hydroxylamine reductase Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q7MLM1 0.0 738 62 2 554 3 hcp Hydroxylamine reductase Vibrio vulnificus (strain YJ016)
A1RMB2 0.0 735 62 2 552 3 hcp Hydroxylamine reductase Shewanella sp. (strain W3-18-1)
A4Y4L9 0.0 735 62 2 552 3 hcp Hydroxylamine reductase Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
A6WKS2 0.0 734 62 2 552 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS185)
Q8D8V3 0.0 734 62 2 554 3 hcp Hydroxylamine reductase Vibrio vulnificus (strain CMCP6)
Q0HGB4 0.0 733 62 2 555 3 hcp Hydroxylamine reductase Shewanella sp. (strain MR-4)
B8EBN7 0.0 733 62 2 552 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS223)
Q5DZ63 0.0 732 61 3 556 3 hcp Hydroxylamine reductase Aliivibrio fischeri (strain ATCC 700601 / ES114)
A9L5Q1 0.0 730 62 2 552 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS195)
A3D1X1 0.0 730 62 2 552 3 hcp Hydroxylamine reductase Shewanella baltica (strain OS155 / ATCC BAA-1091)
Q87QG0 0.0 728 62 2 554 3 hcp Hydroxylamine reductase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
B5EV28 0.0 728 61 3 556 3 hcp Hydroxylamine reductase Aliivibrio fischeri (strain MJ11)
B1KI74 0.0 725 61 3 553 3 hcp Hydroxylamine reductase Shewanella woodyi (strain ATCC 51908 / MS32)
B7VQW0 0.0 724 60 2 553 3 hcp Hydroxylamine reductase Vibrio atlanticus (strain LGP32)
A8FSF3 0.0 724 60 2 553 3 hcp Hydroxylamine reductase Shewanella sediminis (strain HAW-EB3)
Q07X28 0.0 717 61 4 554 3 hcp Hydroxylamine reductase Shewanella frigidimarina (strain NCIMB 400)
Q6LG35 0.0 711 60 2 553 3 hcp Hydroxylamine reductase Photobacterium profundum (strain SS9)
Q6WRT6 0.0 664 58 3 555 1 hcp Hydroxylamine reductase Rhodobacter capsulatus
Q397X6 0.0 567 52 3 553 3 hcp Hydroxylamine reductase Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A4JPG9 0.0 560 52 2 540 3 hcp Hydroxylamine reductase Burkholderia vietnamiensis (strain G4 / LMG 22486)
A0LNW5 0.0 558 50 5 548 3 hcp Hydroxylamine reductase Syntrophobacter fumaroxidans (strain DSM 10017 / MPOB)
A5FZG9 0.0 557 49 4 549 3 hcp Hydroxylamine reductase Acidiphilium cryptum (strain JF-5)
Q0B880 0.0 553 52 3 541 3 hcp Hydroxylamine reductase Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
B1YXE9 0.0 553 52 3 541 3 hcp Hydroxylamine reductase Burkholderia ambifaria (strain MC40-6)
Q0W3X3 0.0 547 49 4 548 3 hcp Hydroxylamine reductase Methanocella arvoryzae (strain DSM 22066 / NBRC 105507 / MRE50)
B5ERR7 0.0 543 48 5 557 3 hcp Hydroxylamine reductase Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
C6C030 0.0 540 50 8 550 3 hcp Hydroxylamine reductase Maridesulfovibrio salexigens (strain ATCC 14822 / DSM 2638 / NCIMB 8403 / VKM B-1763)
B5YHX5 0.0 536 48 6 552 3 hcp Hydroxylamine reductase Thermodesulfovibrio yellowstonii (strain ATCC 51303 / DSM 11347 / YP87)
P96095 0.0 528 48 5 540 3 hcp Hydroxylamine reductase Acidithiobacillus ferridurans
Q3M890 0.0 523 48 9 553 3 hcp Hydroxylamine reductase Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q39RS2 1.06e-175 510 46 7 555 3 hcp Hydroxylamine reductase Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B7JYM8 2.24e-175 509 46 9 559 3 hcp Hydroxylamine reductase Rippkaea orientalis (strain PCC 8801 / RF-1)
C4XL87 8.2e-175 507 48 7 550 3 hcp Hydroxylamine reductase Solidesulfovibrio magneticus (strain ATCC 700980 / DSM 13731 / RS-1)
B1WRV9 1.87e-170 496 44 8 556 3 hcp Hydroxylamine reductase Crocosphaera subtropica (strain ATCC 51142 / BH68)
Q2RQN9 8.24e-169 492 48 8 552 3 hcp Hydroxylamine reductase Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q74FD5 2.85e-168 491 45 7 554 3 hcp Hydroxylamine reductase Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
B0JIR2 6.26e-168 490 44 6 553 3 hcp Hydroxylamine reductase Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
B7KLG3 1.41e-165 484 45 9 557 3 hcp Hydroxylamine reductase Gloeothece citriformis (strain PCC 7424)
Q5NRB3 8.19e-164 479 45 7 552 3 hcp Hydroxylamine reductase Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
B2A0K0 1.77e-157 464 41 8 562 3 hcp Hydroxylamine reductase Natranaerobius thermophilus (strain ATCC BAA-1301 / DSM 18059 / JW/NM-WN-LF)
Q24S27 1.87e-157 463 43 9 558 3 hcp Hydroxylamine reductase Desulfitobacterium hafniense (strain Y51)
B8FWP2 2.7e-157 463 43 10 558 3 hcp Hydroxylamine reductase Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q1MPA7 8.89e-157 461 44 8 551 3 hcp Hydroxylamine reductase Lawsonia intracellularis (strain PHE/MN1-00)
C5CIJ2 5.85e-154 455 44 10 563 3 hcp Hydroxylamine reductase Kosmotoga olearia (strain ATCC BAA-1733 / DSM 21960 / TBF 19.5.1)
B8CZ59 7.76e-154 454 42 11 564 3 hcp Hydroxylamine reductase Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
Q8R6M9 2.11e-153 453 42 8 557 3 hcp Hydroxylamine reductase Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q898N5 5.84e-152 450 41 12 574 3 hcp Hydroxylamine reductase Clostridium tetani (strain Massachusetts / E88)
A0Q355 1.55e-151 448 42 11 557 3 hcp Hydroxylamine reductase Clostridium novyi (strain NT)
B0KD48 1.43e-150 446 42 9 552 3 hcp Hydroxylamine reductase Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
B0K5Y2 1.79e-150 446 42 9 552 3 hcp Hydroxylamine reductase Thermoanaerobacter sp. (strain X514)
Q2RM63 4.52e-150 440 53 4 405 3 hcp Hydroxylamine reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q2RM63 1.06e-11 70 42 2 83 3 hcp Hydroxylamine reductase Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q8XHA1 1.81e-147 438 42 9 555 3 hcp Hydroxylamine reductase Clostridium perfringens (strain 13 / Type A)
A9BHK9 2.33e-147 437 41 9 551 3 hcp Hydroxylamine reductase Petrotoga mobilis (strain DSM 10674 / SJ95)
A7GH10 1.1e-146 437 39 11 578 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B3QXZ3 3.52e-146 434 41 8 557 3 hcp Hydroxylamine reductase Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
A7FX38 4.35e-146 435 39 11 578 3 hcp Hydroxylamine reductase Clostridium botulinum (strain ATCC 19397 / Type A)
B1IKK5 6.09e-146 435 39 11 578 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Okra / Type B1)
A6LCQ4 1.1e-145 433 42 11 559 3 hcp Hydroxylamine reductase Parabacteroides distasonis (strain ATCC 8503 / DSM 20701 / CIP 104284 / JCM 5825 / NCTC 11152)
B1KYK8 1.43e-145 434 39 11 578 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Loch Maree / Type A3)
C1FUX4 1.9e-145 433 39 11 578 3 hcp Hydroxylamine reductase Clostridium botulinum (strain Kyoto / Type A2)
C3L261 2.21e-145 433 39 11 578 3 hcp Hydroxylamine reductase Clostridium botulinum (strain 657 / Type Ba4)
B2RJM1 3.22e-144 429 41 10 563 3 hcp Hydroxylamine reductase Porphyromonas gingivalis (strain ATCC 33277 / DSM 20709 / CIP 103683 / JCM 12257 / NCTC 11834 / 2561)
A6LL16 5.53e-144 429 41 8 563 3 hcp Hydroxylamine reductase Thermosipho melanesiensis (strain DSM 12029 / CIP 104789 / BI429)
Q8RFL1 6.43e-144 429 40 12 568 3 hcp Hydroxylamine reductase Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q7MVY0 1.04e-143 428 41 10 563 3 hcp Hydroxylamine reductase Porphyromonas gingivalis (strain ATCC BAA-308 / W83)
Q01770 1.62e-143 427 41 9 560 1 hcp Hydroxylamine reductase Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q97FI7 3.94e-143 426 40 9 550 3 hcp1 Hydroxylamine reductase 1 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q58175 1.03e-140 420 40 14 559 3 hcp Hydroxylamine reductase Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8A9X8 2.23e-140 419 41 9 558 3 hcp Hydroxylamine reductase Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
A3DBE8 2.51e-140 419 40 13 561 3 hcp Hydroxylamine reductase Acetivibrio thermocellus (strain ATCC 27405 / DSM 1237 / JCM 9322 / NBRC 103400 / NCIMB 10682 / NRRL B-4536 / VPI 7372)
Q8KBT4 7.68e-140 418 42 14 562 3 hcp Hydroxylamine reductase Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
Q8PS69 6.27e-139 416 43 11 559 3 hcp Hydroxylamine reductase Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q97DP4 2.25e-138 415 39 13 574 3 hcp2 Hydroxylamine reductase 2 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q64UD5 4.3e-137 411 40 10 558 3 hcp Hydroxylamine reductase Bacteroides fragilis (strain YCH46)
Q5LDB2 2.71e-135 406 40 10 558 3 hcp Hydroxylamine reductase Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
A6USL5 3.15e-133 401 40 12 560 3 hcp Hydroxylamine reductase Methanococcus vannielii (strain ATCC 35089 / DSM 1224 / JCM 13029 / OCM 148 / SB)
A8ZYF3 4e-130 393 39 13 563 3 hcp Hydroxylamine reductase Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
P31101 5.14e-130 393 40 11 562 1 hcp Hydroxylamine reductase Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
A5IN10 1.52e-121 367 44 2 396 3 hcp Hydroxylamine reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
A5IN10 1.31e-14 79 31 8 207 3 hcp Hydroxylamine reductase Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9X0Q4 2.35e-120 364 43 2 396 3 hcp Hydroxylamine reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9X0Q4 5.22e-16 84 33 8 207 3 hcp Hydroxylamine reductase Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
O27502 4.36e-118 358 45 4 395 3 hcp Hydroxylamine reductase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
O27502 1.31e-14 79 39 3 109 3 hcp Hydroxylamine reductase Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q8Q0L5 6.56e-08 59 23 17 343 3 cooS1 Carbon monoxide dehydrogenase 1 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8TKW2 5.75e-06 52 22 17 343 3 cooS1 Carbon monoxide dehydrogenase 1 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS10405
Feature type CDS
Gene hcp
Product hydroxylamine reductase
Location 2283644 - 2285296 (strand: -1)
Length 1653 (nucleotides) / 550 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_956
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF03063 Prismane/CO dehydrogenase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1151 Energy production and conversion (C) C Hydroxylamine reductase (hybrid-cluster protein)

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05601 hydroxylamine reductase [EC:1.7.99.1] Nitrogen metabolism
Metabolic pathways
-

Protein Sequence

MYCVQCEQTMRTPVGNGCAYAQGMCGKTAETSDLQDLLVAVLEGLSAWALAARSVDIIDHDIDSFAPRAFFSTLTNVNFDSERIVGYAKEAIYLRESLKSRTLAKNAAIQVAHPKAEIQLEGNDLASLQKQAQRFALNNDKAQVGDDLHGLRMLCLYGLKGAAAYMEHAHVLGQYDDEIYAEYHRYMAWLGTDPADMNELLDNAMGIGQMNFRIMALLDKGETQAYGDPTPVSVNVRPVAGKAILISGHDLKDLQMLLEQTEGKGINVYTHGEMLPAHGYPELKKYKHLVGNYGSGWQNQQSEFAKFPGPVLMTSNCIIDPNVGNYGDRIWTRSIVGWPGVKHIKGDDFSEMIEQALSLEGFPYSEIEHLITVGFGRQTLLNAADTVIDLVSQKKLRHVFLVGGCDGSRGERSYYTDLARAIPQDCLIMTLACGKYRFNKLDFGTLEGLPRLLDVGQCNDAYSAIMLAVNLAEKLGCGVNDLPLSLILSWFEQKAIVILLTLLSLGVKNIYTGPTAPAFLTDNLLAILNEKFGMRAITTPEQDLQEILSA

Flanking regions ( +/- flanking 50bp)

TTTAATGCAACTTATAAAAATAAAGCGTCATCTTATAGAAGGAATTCGATATGTATTGTGTGCAATGTGAACAAACAATGAGAACACCTGTTGGTAATGGTTGTGCCTATGCACAAGGTATGTGCGGTAAAACAGCAGAAACCTCTGATCTACAAGACTTATTGGTGGCAGTATTAGAAGGGCTGTCAGCATGGGCATTAGCTGCGCGTAGTGTTGATATTATTGATCACGATATAGACAGCTTTGCGCCACGGGCTTTCTTCTCGACGTTAACCAATGTTAATTTTGATTCTGAACGTATTGTTGGATATGCCAAAGAGGCTATTTATTTACGTGAAAGCTTAAAATCACGTACGTTAGCCAAAAATGCAGCCATCCAAGTCGCTCATCCTAAAGCCGAAATTCAATTAGAAGGCAACGACTTAGCCAGTCTACAGAAACAAGCCCAACGCTTTGCATTAAATAATGATAAAGCGCAAGTGGGGGATGATTTACATGGTTTACGTATGCTTTGCTTGTATGGCTTAAAAGGTGCTGCTGCTTATATGGAGCATGCTCATGTTTTAGGCCAGTACGATGATGAAATTTATGCTGAATATCATCGTTACATGGCATGGTTAGGTACCGATCCTGCGGATATGAATGAGTTGCTAGACAATGCAATGGGCATTGGTCAAATGAACTTTCGTATTATGGCGTTATTGGATAAAGGTGAAACTCAAGCTTATGGTGATCCAACCCCTGTTTCCGTTAATGTACGCCCAGTAGCAGGTAAAGCTATTTTAATTTCAGGCCATGATCTGAAAGATTTACAGATGCTACTTGAACAGACCGAAGGTAAAGGCATTAATGTTTATACGCACGGTGAAATGTTACCCGCCCATGGTTATCCAGAGCTGAAAAAATATAAACACTTAGTCGGTAACTACGGAAGTGGTTGGCAGAATCAACAAAGTGAATTTGCCAAATTTCCTGGCCCTGTGTTAATGACATCTAACTGTATTATTGATCCTAATGTGGGGAACTATGGCGATCGTATTTGGACGCGTAGTATTGTTGGTTGGCCGGGTGTGAAACACATTAAAGGTGATGATTTCTCTGAAATGATTGAGCAAGCGCTCTCTTTAGAGGGATTTCCGTACAGTGAAATTGAACACTTAATTACTGTTGGATTTGGTCGTCAAACACTATTAAATGCGGCTGATACAGTGATTGATTTAGTTTCACAGAAAAAACTTCGTCATGTCTTCTTAGTTGGGGGGTGTGATGGTAGTCGTGGTGAACGTAGCTACTATACCGATCTTGCTCGTGCCATTCCCCAAGATTGCTTAATTATGACATTAGCTTGTGGTAAATATCGCTTTAATAAACTTGATTTTGGCACATTAGAGGGCTTACCGCGCTTACTTGATGTGGGTCAGTGTAACGATGCCTACTCTGCGATTATGCTAGCGGTTAATCTTGCAGAAAAATTAGGTTGTGGTGTAAATGATTTACCCCTGTCCTTGATTTTGTCGTGGTTTGAACAAAAAGCGATTGTTATTTTATTAACCCTACTCTCATTAGGGGTAAAAAATATTTATACTGGGCCGACTGCGCCTGCATTTTTAACCGATAATTTGCTCGCAATACTTAATGAAAAATTTGGTATGCGTGCGATCACCACGCCAGAACAAGATCTTCAAGAAATTCTTTCTGCTTAATTTATTTATTCATCATCATTGCCGAAGCCTAAAGGCTTCGGTAAGGAAGC