Homologs in group_762

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02905 FBDBKF_02905 100.0 Morganella morganii S1 uup ATPase components of ABC transporters with duplicated ATPase domains
EHELCC_03375 EHELCC_03375 100.0 Morganella morganii S2 uup ATPase components of ABC transporters with duplicated ATPase domains
NLDBIP_00085 NLDBIP_00085 100.0 Morganella morganii S4 uup ATPase components of ABC transporters with duplicated ATPase domains
HKOGLL_01990 HKOGLL_01990 100.0 Morganella morganii S5 uup ATPase components of ABC transporters with duplicated ATPase domains
F4V73_RS05350 F4V73_RS05350 85.1 Morganella psychrotolerans - ABC-F family ATP-binding cassette domain-containing protein
PMI_RS05995 PMI_RS05995 66.6 Proteus mirabilis HI4320 - ABC-F family ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_762

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_762

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O05519 2.32e-62 220 30 14 538 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 1.49e-24 111 32 3 223 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 2.06e-17 89 29 5 218 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O34512 4.28e-61 214 28 12 529 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 1.38e-11 70 27 9 243 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
A0A0H2VBH0 3.68e-60 214 30 14 535 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 5.8e-24 110 31 4 273 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P63389 9.6e-60 213 30 14 535 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 4.8e-24 110 31 4 273 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 9.6e-60 213 30 14 535 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 4.8e-24 110 31 4 273 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P0A9U3 2.81e-55 198 30 15 545 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 2.81e-55 198 30 15 545 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 2.81e-55 198 30 15 545 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P39115 8.08e-55 197 28 12 512 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 1.86e-26 117 31 3 201 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 4.27e-13 75 30 5 181 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P44808 6.44e-52 191 29 16 547 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P44808 9.36e-26 115 34 1 206 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
O59672 1.28e-51 192 31 21 558 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 7.96e-25 112 34 7 216 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8K9I3 5.96e-51 187 27 16 517 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P43672 2.85e-50 186 30 18 552 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 7.73e-27 118 34 0 195 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
O06476 4.43e-49 183 29 14 542 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q8K268 4.47e-49 184 29 17 540 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q8K268 2.66e-26 117 34 4 210 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
Q5R9Z5 5.03e-49 184 29 18 546 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q5R9Z5 2.68e-25 114 33 4 210 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q9M1H3 1.35e-48 183 29 18 556 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 3.39e-25 114 30 4 225 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 3e-10 67 26 12 315 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q8H0V6 1.39e-48 183 28 18 552 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 4.05e-24 110 34 4 204 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 7.17e-06 52 23 6 250 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q9NUQ8 3.78e-48 182 29 16 543 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9NUQ8 8.72e-25 112 33 4 210 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
Q9LV93 1.23e-47 180 28 11 546 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
Q66H39 2.03e-47 179 30 19 540 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q66H39 3.67e-25 114 33 4 210 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
P40024 2.27e-47 178 28 14 534 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P40024 5.65e-24 109 30 3 217 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 4.03e-47 179 34 12 395 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 2.02e-25 114 32 4 215 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 2.55e-08 60 26 7 253 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P57445 7.41e-47 176 27 15 531 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57445 4.13e-20 97 28 4 230 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q9UG63 2.99e-46 175 29 14 531 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
O42943 3.92e-46 175 28 19 537 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 4.64e-24 110 31 5 207 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8T6B7 4.49e-46 174 28 18 547 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 1.14e-21 102 33 2 200 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q99LE6 5.98e-46 174 29 14 531 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q9FIB4 8.57e-46 174 27 13 557 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9FJH6 2.96e-45 172 25 11 544 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
P0A9W5 4.35e-45 171 27 19 560 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 8.77e-24 108 33 3 214 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 4.35e-45 171 27 19 560 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 8.77e-24 108 33 3 214 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 4.35e-45 171 27 19 560 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 8.77e-24 108 33 3 214 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
A0A0H2VFI8 6.04e-45 170 27 18 559 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 5.94e-23 106 33 3 214 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q2KJA2 2.62e-43 167 28 14 537 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
P45127 2.8e-43 166 27 16 534 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 6.24e-22 103 32 2 190 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8SRV5 3.45e-43 165 28 16 492 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 1.09e-21 102 31 4 214 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q57242 2.38e-41 161 29 15 535 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q57242 6.93e-07 55 28 7 221 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8T6B4 9.16e-41 162 27 15 525 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 2.58e-22 105 30 5 207 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 0.000339 47 29 2 106 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q6MG08 1.04e-40 161 26 11 514 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 6.62e-18 91 31 6 205 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 3.57e-08 60 25 5 215 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q767L0 1.62e-40 160 26 11 517 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 5.45e-18 91 31 6 205 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 3.74e-08 60 22 3 224 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
O31716 2.23e-40 157 26 16 549 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 2.4e-11 70 24 7 237 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q8NE71 5e-40 159 26 11 514 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 5.69e-18 91 31 6 205 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 3.4e-08 60 25 5 214 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q6P542 1.16e-39 158 26 11 514 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 2.91e-18 92 31 6 205 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 6.05e-07 56 23 3 213 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q7YR37 1.7e-39 157 26 11 514 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 5.21e-18 91 31 6 205 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 1.95e-07 57 24 5 215 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
P0DX93 9.44e-39 152 24 11 502 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 6.34e-20 96 30 6 189 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P23212 3.59e-37 147 26 18 526 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 3.52e-20 97 33 5 188 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P25256 5.21e-36 145 28 15 535 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 5.86e-19 94 35 4 179 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 1.25e-12 73 27 8 258 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
Q45978 8.31e-36 145 29 20 527 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 1.01e-19 96 33 4 209 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P9WQK3 9.99e-32 132 26 16 528 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 2.3e-05 50 27 6 216 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 9.99e-32 132 26 16 528 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 2.3e-05 50 27 6 216 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9USH9 5.45e-30 129 25 17 527 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9USH9 6.92e-23 107 29 2 217 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
D0MYB4 2.72e-24 111 29 15 381 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 7.69e-08 59 29 3 126 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 2.17e-07 57 35 0 74 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 3.93e-07 57 28 5 186 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.61e-05 52 35 2 74 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
O93796 1.27e-23 109 33 7 217 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.74e-10 67 27 2 177 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 3.05e-09 63 34 0 79 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.19e-08 62 34 0 79 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 1.45e-07 58 33 3 95 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q1Q889 6.42e-23 101 35 5 198 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 3.21e-10 64 30 8 190 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
O14134 1.62e-22 106 34 6 193 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 1.66e-12 74 33 3 125 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 2.09e-08 61 32 0 80 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 8.56e-08 59 28 5 181 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 4.18e-05 50 33 1 77 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2.76e-22 105 35 9 226 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2.26e-09 64 34 0 79 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2e-08 61 34 0 79 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.44e-06 55 39 2 73 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 2.74e-05 51 27 6 188 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P16521 3.49e-22 105 31 8 226 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.9e-09 64 32 0 87 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.46e-09 64 32 1 91 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 6.83e-09 62 28 1 177 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.81e-07 57 33 3 95 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q4FQ27 1.09e-21 97 36 5 198 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 5.59e-11 66 31 8 190 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q6FFL0 1.28e-21 98 35 5 184 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 7.43e-07 54 26 7 185 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P29551 1.28e-21 103 28 15 379 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 2.46e-08 60 31 0 79 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 6.8e-07 56 30 0 79 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.97e-06 54 27 5 184 3 TEF3 Elongation factor 3 Pneumocystis carinii
P12622 7.87e-21 96 35 13 270 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.25e-06 53 32 0 70 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 0.000143 47 30 2 129 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P53978 8.07e-21 100 31 8 226 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 4.6e-09 63 32 0 79 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 5.37e-09 63 34 0 79 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 2.14e-07 57 32 3 95 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 2.18e-07 57 25 1 177 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P45167 9.79e-21 99 33 4 206 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 3.44e-15 81 28 11 353 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q08972 1.31e-20 100 32 6 227 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.73e-10 67 29 3 147 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 2.51e-09 64 29 2 133 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 3.99e-09 63 30 5 183 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.83e-07 58 36 0 72 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q75EV6 1.75e-20 99 32 7 217 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 2.63e-08 60 35 0 76 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.46e-08 60 32 0 79 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 4.87e-07 56 37 2 74 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.59e-06 53 26 1 177 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
O34946 2.31e-20 93 31 7 197 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 1.84e-06 52 24 7 191 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
Q8U8D6 3e-20 94 33 6 206 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
P77622 5.57e-20 94 35 5 194 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
P25997 8.06e-20 97 33 7 215 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 9.73e-09 62 32 0 79 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 9.98e-08 58 32 0 79 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 3.21e-07 57 34 3 95 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.01e-05 52 25 3 178 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q32HA3 1.53e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 1.75e-09 62 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q3Z2L6 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 2.03e-19 91 30 7 253 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 7.3e-09 60 29 6 174 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 2.03e-19 91 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 7.3e-09 60 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q1GL85 2.53e-19 91 35 4 182 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1GL85 3.38e-11 67 29 5 184 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q6D4A8 6.49e-19 90 36 8 196 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 2.45e-11 67 30 6 192 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q89AJ0 6.5e-19 89 27 4 223 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 7.61e-07 53 28 7 161 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q83KR7 6.81e-19 89 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 1.08e-08 59 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 6.81e-19 89 30 7 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 1.08e-08 59 29 6 174 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q1BG75 1.19e-18 89 37 7 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 1.19e-18 89 37 7 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q7N545 3.41e-18 88 34 6 195 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 2.22e-09 62 30 6 176 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q8Z5W6 4.47e-18 87 28 8 262 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 1.82e-07 56 27 6 186 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q3IWB5 5.77e-18 87 33 4 183 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 6.45e-09 60 31 7 181 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q7MMN0 9.73e-18 86 34 3 185 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 2.51e-08 58 31 8 193 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 9.73e-18 86 34 3 185 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 2.51e-08 58 31 8 193 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q5PIA5 1.02e-17 86 28 8 262 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 1.69e-07 56 28 7 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 1.02e-17 86 28 8 262 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 1.69e-07 56 28 7 190 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
A0LCH8 1.18e-17 86 33 4 183 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 6.86e-12 69 27 6 186 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
Q8ZNV7 1.26e-17 86 28 8 262 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 2.1e-08 58 28 7 190 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5L222 1.51e-17 87 29 6 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q160Y9 1.86e-17 85 31 5 185 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 1.35e-07 56 28 7 187 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q9HYG4 2.61e-17 85 32 7 211 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q74I62 2.64e-17 89 24 21 528 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 9.4e-12 71 27 7 198 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A1B9K8 3.14e-17 85 33 7 193 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 1.23e-13 74 30 7 206 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q89ER4 3.37e-17 85 32 7 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q1R5D8 4.04e-17 85 29 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q1R5D8 1.34e-08 59 25 9 237 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 4.04e-17 85 29 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FCM9 1.34e-08 59 25 9 237 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 4.04e-17 85 29 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TBX8 1.34e-08 59 25 9 237 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q5HQ70 4.8e-17 86 27 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
A1JRI2 5e-17 84 34 4 185 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 2.49e-10 64 32 6 170 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q4K441 7.68e-17 84 33 7 211 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q5E6M2 7.69e-17 84 31 7 230 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 6.26e-11 66 34 9 175 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
O34392 7.71e-17 83 29 6 204 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
Q02QT1 1.03e-16 84 32 7 211 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q97KS6 1.06e-16 85 29 6 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q87RE5 1.12e-16 83 32 3 187 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 1.86e-10 65 33 8 175 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q2YVT7 1.16e-16 85 29 7 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q48CA0 1.2e-16 84 32 6 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A0A0H2ZLL3 1.24e-16 83 27 7 230 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8KZQ6 1.26e-16 83 35 8 211 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q88R93 1.55e-16 83 34 8 214 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q87UI3 1.67e-16 83 30 10 275 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q39LW7 1.72e-16 83 34 5 179 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q88ZZ2 1.87e-16 86 30 7 216 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 2.38e-13 76 24 22 557 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6GJL2 1.87e-16 84 29 7 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q3M5J9 1.91e-16 82 31 8 243 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q3M5J9 0.000178 47 29 7 190 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q5X627 1.93e-16 84 33 7 200 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q32AQ1 2.25e-16 82 28 5 229 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q32AQ1 3.48e-08 58 25 10 237 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q4ZLS1 2.52e-16 82 31 6 212 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q0S0X2 2.76e-16 82 33 6 193 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q0S0X2 0.000185 47 23 4 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q50966 2.84e-16 84 31 6 229 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae
Q7N0N3 2.91e-16 81 26 7 230 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
A0A0H2ZH52 3.12e-16 83 28 7 231 1 dppF Di/tripeptide transport ATP-binding protein DppF Pseudomonas aeruginosa (strain UCBPP-PA14)
Q31VE6 3.37e-16 82 28 5 229 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q31VE6 5.84e-07 54 24 10 237 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q6YRJ4 3.37e-16 85 31 6 215 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q0A9E2 3.4e-16 82 31 5 206 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 3.49e-05 49 27 6 178 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q7A7E3 3.67e-16 83 29 7 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 3.67e-16 83 29 7 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q831K6 3.73e-16 83 29 8 242 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q831K6 1.19e-05 51 25 8 213 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8CPN0 3.84e-16 84 27 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q66AT7 4.11e-16 81 30 5 223 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 1.91e-10 65 31 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q8X4L6 4.14e-16 82 28 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q8X4L6 1.49e-06 53 24 8 237 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q02SA6 4.96e-16 81 33 7 215 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q1CJG3 5.06e-16 81 30 5 223 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 1.87e-10 65 31 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 5.06e-16 81 30 5 223 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 1.87e-10 65 31 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 5.06e-16 81 30 5 223 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 1.87e-10 65 31 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q3YW48 5.14e-16 82 28 5 229 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q3YW48 2.1e-08 59 25 9 237 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q884I3 6.18e-16 80 32 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 2.93e-05 49 28 7 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
P33594 6.56e-16 81 29 6 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
P33594 1.3e-08 59 25 9 237 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q81CT8 6.64e-16 84 30 7 215 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81CT8 1.77e-07 57 20 21 545 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8NY21 6.93e-16 82 30 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 6.93e-16 82 30 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
Q5HIL5 7.13e-16 82 30 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 7.13e-16 82 30 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 7.13e-16 82 30 6 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q1AS06 9.23e-16 82 29 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q5LUR8 9.39e-16 80 31 3 187 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUR8 3.92e-12 70 29 7 194 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A0AGP9 1.04e-15 82 28 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AGP9 4.65e-05 49 27 9 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q48KI4 1.06e-15 80 31 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 0.000357 45 27 8 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q72D73 1.19e-15 80 33 7 220 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 2.68e-07 55 24 4 212 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q6LTB1 1.32e-15 80 32 4 185 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 2.67e-11 67 34 8 174 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
A1TXH7 1.66e-15 82 31 7 215 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q4ZV73 1.72e-15 79 31 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZV73 0.000437 45 28 9 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q9HY19 1.85e-15 81 29 6 227 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q82MV1 1.94e-15 80 34 6 187 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q60AI1 1.95e-15 82 30 5 217 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q9CN78 2.07e-15 79 29 6 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q9CN78 1.16e-07 56 28 8 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q2J3T0 2.08e-15 80 28 5 236 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q2J3T0 1.35e-05 50 28 9 201 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q8RD07 2.18e-15 79 28 7 217 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 1.21e-07 56 24 8 239 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q02R79 2.24e-15 81 29 6 227 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HX79 2.28e-15 79 33 7 213 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q2RS22 2.39e-15 80 29 7 241 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q2RS22 7.2e-06 51 23 11 267 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q3K506 2.47e-15 79 32 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q6N6K5 2.49e-15 80 30 6 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q1IGL4 2.52e-15 79 33 8 223 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q9WXX8 2.55e-15 79 26 5 197 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q9WXX8 4.99e-07 54 28 7 178 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
A0KPH6 2.63e-15 79 34 4 185 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 8.45e-07 54 29 7 186 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q18C09 2.85e-15 80 26 4 216 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q18C09 1.34e-05 51 22 6 254 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q5FA19 3.05e-15 80 30 6 226 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q92DL6 3.54e-15 80 27 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92DL6 5.95e-05 49 26 7 185 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q31I51 3.77e-15 79 29 4 205 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 1.83e-07 56 25 6 195 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q9HZL7 3.9e-15 78 30 7 213 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 0.000335 45 28 9 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8RGC8 3.97e-15 80 27 7 220 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q21XJ9 4.02e-15 79 31 7 211 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q21XJ9 0.00017 47 25 6 195 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q8NR42 4.31e-15 78 36 8 206 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q64Z80 4.37e-15 77 31 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q5LI72 4.49e-15 77 31 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q217B2 4.57e-15 79 35 5 177 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q1R155 4.67e-15 78 31 4 185 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 4.73e-06 51 27 6 191 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q5WKG4 4.7e-15 78 32 6 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q5WKG4 0.000568 45 24 6 190 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q0SBZ1 4.75e-15 80 28 4 211 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q4L5B3 4.82e-15 80 27 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus haemolyticus (strain JCSC1435)
Q2W4W1 4.85e-15 79 37 10 204 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2W4W1 6.65e-07 54 29 7 184 3 znuC Zinc import ATP-binding protein ZnuC Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
O31711 5.43e-15 78 28 9 217 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q0SZJ3 5.53e-15 79 27 5 230 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q0SZJ3 4.57e-06 52 26 11 238 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q4W575 5.58e-15 80 30 7 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 5.58e-15 80 30 7 231 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q48PV0 5.64e-15 78 35 5 176 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PV0 5.12e-11 67 29 7 195 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
O32169 5.9e-15 80 29 9 242 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q722B1 6.16e-15 80 27 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q722B1 6.94e-06 52 28 10 189 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q83J77 6.42e-15 78 27 5 230 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q83J77 5.19e-06 52 25 12 238 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
Q8PP41 6.66e-15 78 34 7 196 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q74DN5 6.71e-15 78 27 5 216 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 9.24e-07 53 27 6 187 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8Y8T6 6.75e-15 80 27 3 198 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8T6 1.42e-06 54 29 9 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q1LNM0 6.77e-15 79 32 6 185 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1LNM0 5.94e-05 48 25 6 200 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q1B8U4 7.43e-15 77 32 10 224 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q14Q07 7.46e-15 79 28 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q14Q07 6.13e-06 52 26 6 187 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
Q8PHQ3 7.57e-15 79 30 6 209 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q57QD7 7.77e-15 77 30 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q57QD7 4.84e-08 57 27 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q9KQB8 7.9e-15 78 32 4 185 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 2.67e-10 64 31 6 173 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q28VN1 8.59e-15 77 29 3 183 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 5.03e-10 63 27 6 202 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q8RI39 8.64e-15 79 31 8 201 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q11SW8 8.84e-15 77 28 8 221 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q11SW8 0.000208 46 26 8 198 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
Q8REG7 9.28e-15 77 25 4 231 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q832R5 9.33e-15 80 30 7 197 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q832R5 2.15e-14 79 23 20 536 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q8GDV4 9.35e-15 77 27 6 228 3 pstB Phosphate import ATP-binding protein PstB (Fragment) Heliobacterium mobile
Q4ZZS2 9.36e-15 78 32 5 183 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 8.04e-10 63 28 6 189 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q81PZ8 9.79e-15 80 31 10 219 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q0BUR6 1.09e-14 77 33 6 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q57554 1.13e-14 77 30 7 213 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P61482 1.25e-14 77 29 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61482 6.27e-08 57 27 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 1.25e-14 77 29 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
P61481 6.27e-08 57 27 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 1.25e-14 77 29 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGR6 6.27e-08 57 27 7 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q15TB1 1.29e-14 77 30 4 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q15TB1 7.43e-05 48 28 10 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
P57403 1.38e-14 77 31 4 185 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57403 2.66e-05 49 29 6 172 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q73P93 1.51e-14 80 22 20 515 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 4.85e-14 78 28 6 212 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q93SH7 1.52e-14 77 30 6 223 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q93SH7 7.72e-09 60 27 8 206 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5YZY9 1.53e-14 78 28 7 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
O57872 1.72e-14 77 28 7 221 3 PH0132 Putative ABC transporter ATP-binding protein PH0132 Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q38WL5 1.73e-14 78 28 7 230 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q32EX7 1.77e-14 76 30 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q32EX7 4.88e-08 57 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q8YCN7 1.78e-14 77 32 7 205 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YCN7 4.42e-06 52 25 12 271 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 1.78e-14 77 32 7 205 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q578S7 4.42e-06 52 25 12 271 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 1.78e-14 77 32 7 205 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q2YL69 4.42e-06 52 25 12 271 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
P42246 1.83e-14 77 28 6 211 3 ycbN Uncharacterized ABC transporter ATP-binding protein YcbN Bacillus subtilis (strain 168)
Q88CL2 1.92e-14 78 29 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8NWT6 2e-14 76 30 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q8NWT6 0.000186 47 23 8 216 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 2e-14 76 30 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q6G9I1 0.000186 47 23 8 216 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q7A5Q9 2.08e-14 76 30 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q7A5Q9 0.000489 45 22 7 213 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 2.08e-14 76 30 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99UA3 0.000489 45 22 7 213 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
P24693 2.13e-14 76 32 8 190 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
P75957 2.14e-14 76 30 9 210 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P75957 6.27e-08 57 28 8 228 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
A1B9H9 2.19e-14 76 32 6 208 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q6F9A8 2.19e-14 78 28 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q83F44 2.28e-14 78 28 6 233 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q83F44 2.56e-06 53 24 6 228 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q8FVN0 2.29e-14 77 32 7 205 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q8FVN0 4.26e-06 52 25 12 271 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q87UN0 2.59e-14 76 32 5 183 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 1.44e-10 65 28 7 195 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q0S0Z3 2.66e-14 78 29 4 187 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q2RZ08 2.67e-14 77 28 9 246 3 hmuV Hemin import ATP-binding protein HmuV Salinibacter ruber (strain DSM 13855 / M31)
Q65M64 2.79e-14 76 33 6 191 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8ES39 2.81e-14 79 29 4 216 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 1.32e-06 55 28 6 189 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q4FU75 2.91e-14 79 30 11 253 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q88RL5 3e-14 77 27 10 289 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q6MU19 3.05e-14 77 27 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 1.49e-06 54 26 8 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9KUI0 3.1e-14 78 29 6 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q6MD10 3.14e-14 75 29 7 191 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
Q6MD10 1.67e-08 58 28 7 195 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
Q88AS5 3.22e-14 77 28 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q65TB7 3.23e-14 75 30 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q65TB7 7e-07 53 28 7 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q5HG41 3.37e-14 75 30 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q5HG41 0.000285 46 23 8 216 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 3.37e-14 75 30 5 191 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FYQ8 0.000285 46 23 8 216 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 3.37e-14 75 30 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q2FH58 0.000285 46 23 8 216 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q6GH28 3.43e-14 75 30 5 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q6GH28 0.000375 45 22 8 216 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q6LR20 3.48e-14 77 29 6 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
Q65F80 3.49e-14 77 26 6 229 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
Q8XK20 3.54e-14 79 22 18 520 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 2.08e-13 76 27 7 214 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q2S3A3 3.63e-14 76 30 8 227 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q2NVW9 3.71e-14 75 33 7 183 3 thiQ Thiamine import ATP-binding protein ThiQ Sodalis glossinidius (strain morsitans)
P07821 3.78e-14 76 31 7 219 1 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Escherichia coli (strain K12)
Q6HI76 3.85e-14 79 31 10 219 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q0RYP7 3.9e-14 77 30 4 187 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q2SSS4 3.97e-14 77 27 5 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 1.91e-06 53 26 8 182 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q5WCI1 4.01e-14 75 31 5 197 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q47C66 4.07e-14 75 32 7 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q47C66 8.89e-06 50 27 5 192 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q0SRL2 4.16e-14 77 23 6 271 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q1QE80 4.19e-14 78 29 6 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q5NQX0 4.19e-14 75 35 7 185 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q5NQX0 1.82e-05 49 30 7 174 3 ccmA Cytochrome c biogenesis ATP-binding export protein CcmA Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q6D8T5 4.6e-14 79 29 7 234 3 macB Macrolide export ATP-binding/permease protein MacB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D8T5 9.07e-05 49 26 7 194 3 macB Macrolide export ATP-binding/permease protein MacB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q737I0 5.1e-14 78 30 9 219 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q50294 5.1e-14 76 28 7 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
Q6CYU2 5.18e-14 75 31 6 208 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q4KKK4 5.28e-14 75 32 4 176 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 1.44e-09 62 27 6 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q55463 5.34e-14 76 32 12 203 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P9WQM1 5.37e-14 77 32 5 186 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 5.37e-14 77 32 5 186 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 5.37e-14 77 32 5 186 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q8D385 5.41e-14 75 28 3 164 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8D385 2.21e-07 55 27 6 161 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q631Y4 5.72e-14 77 24 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q631Y4 9.48e-06 51 25 8 206 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q6HBS0 5.82e-14 77 24 6 296 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HBS0 3e-05 50 25 8 206 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 5.87e-14 76 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HLQ9 0.000124 48 22 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q46ZU5 6.01e-14 76 32 6 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
O57896 6.1e-14 77 30 4 171 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3)
Q0I3C2 6.16e-14 74 28 7 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q0I3C2 6.82e-08 57 28 5 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Histophilus somni (strain 129Pt)
Q8UF79 6.18e-14 76 32 7 206 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q8UF79 7.54e-07 54 28 6 182 3 znuC Zinc import ATP-binding protein ZnuC Agrobacterium fabrum (strain C58 / ATCC 33970)
Q63E84 6.31e-14 76 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q63E84 0.000126 48 22 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ZK / E33L)
Q73BM0 6.31e-14 76 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q73BM0 0.000126 48 22 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 10987 / NRS 248)
A0RBB0 6.31e-14 76 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
A0RBB0 0.000126 48 22 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus thuringiensis (strain Al Hakam)
Q8A1M1 6.32e-14 74 28 5 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q7NWX3 6.32e-14 77 27 7 277 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q63TW1 6.61e-14 76 31 3 177 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain K96243)
Q81XL3 6.74e-14 76 24 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q81XL3 9.65e-06 51 25 8 206 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
O68106 6.81e-14 75 30 8 224 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O34977 6.88e-14 75 37 5 143 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
O34977 7.91e-05 48 24 8 183 3 ythP Uncharacterized ABC transporter ATP-binding protein YthP Bacillus subtilis (strain 168)
Q62K56 6.97e-14 76 31 3 177 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia mallei (strain ATCC 23344)
Q4KKK8 7.04e-14 76 27 11 311 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q2NHA1 7.14e-14 75 29 9 242 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q5QU46 7.16e-14 74 30 9 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q48QM2 7.31e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M28 (strain MGAS6180)
Q1JJC9 7.31e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS9429)
P0C0E8 7.31e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M1
Q8XIZ5 7.32e-14 76 26 5 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 7.32e-14 76 26 5 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
P31548 7.61e-14 74 29 8 204 1 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain K12)
P0C0E9 7.73e-14 75 27 7 239 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Streptococcus pyogenes
P0CZ29 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain SSI-1)
A2RH11 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1J449 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M4 (strain MGAS10750)
Q1JEC8 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q7CMM7 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M18 (strain MGAS8232)
Q5X9B5 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
P0CZ28 7.73e-14 75 27 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
Q92P76 7.78e-14 75 32 5 203 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q92P76 1.16e-05 51 28 8 186 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium meliloti (strain 1021)
Q9Z8J5 7.81e-14 75 30 6 207 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q8A883 7.93e-14 77 26 6 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q8A883 0.000405 47 26 7 175 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q92WJ0 8.08e-14 76 31 7 213 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q2K6Q4 8.43e-14 75 29 5 211 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K6Q4 8.34e-05 48 27 5 179 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q64SQ6 8.44e-14 77 26 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
Q64SQ6 0.000179 48 26 7 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain YCH46)
P0C0E2 8.64e-14 74 28 6 208 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes
P0C0E3 8.64e-14 74 28 6 208 3 srtF Lantibiotic transport ATP-binding protein SrtF Streptococcus pyogenes serotype M1
Q3Z300 8.67e-14 74 29 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q3Z300 6.16e-08 57 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 8.67e-14 74 29 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q1RD37 6.16e-08 57 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 8.67e-14 74 29 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FIM7 6.16e-08 57 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 8.67e-14 74 29 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIV6 6.16e-08 57 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q660M8 8.71e-14 76 30 8 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q660M8 0.000109 48 25 7 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Borrelia garinii subsp. bavariensis (strain ATCC BAA-2496 / DSM 23469 / PBi)
Q254K9 9.03e-14 76 28 14 289 3 metN Methionine import ATP-binding protein MetN Chlamydia felis (strain Fe/C-56)
Q1QDA8 9.11e-14 78 31 12 253 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q0B6I6 9.17e-14 77 30 6 206 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0B6I6 7.47e-05 48 25 7 210 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q815Y7 9.2e-14 76 24 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q815Y7 5.87e-06 52 25 8 206 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q73XU8 9.63e-14 76 28 5 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
O34314 9.65e-14 75 34 6 180 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
Q5LBT4 9.91e-14 77 26 5 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q5LBT4 0.000174 48 26 7 174 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q0BFQ0 1.01e-13 75 31 3 177 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q72Y96 1.03e-13 76 24 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q72Y96 5.77e-06 52 25 8 206 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q1MEG2 1.03e-13 75 32 6 198 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1MEG2 1.59e-05 50 27 6 208 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q1CDR0 1.04e-13 75 34 6 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 1.04e-13 75 34 6 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 1.04e-13 75 34 6 174 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q2YXZ0 1.05e-13 74 30 5 200 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2YXZ0 0.000166 47 23 8 216 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q73YZ5 1.06e-13 74 31 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 1.06e-13 74 31 7 229 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q73R11 1.11e-13 77 24 4 223 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 2.16e-08 60 24 6 202 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 6.32e-08 58 26 6 193 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q3KKA1 1.11e-13 74 32 4 176 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 4.86e-10 63 28 6 194 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q928L8 1.13e-13 75 26 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q3JSR6 1.15e-13 75 31 3 177 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia pseudomallei (strain 1710b)
Q1J982 1.16e-13 75 26 7 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Streptococcus pyogenes serotype M12 (strain MGAS2096)
Q8XA06 1.19e-13 74 30 8 204 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O157:H7
Q39IE7 1.2e-13 75 28 12 311 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q2FRT7 1.2e-13 76 30 8 204 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q2FRT7 1.39e-05 51 28 7 196 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Methanospirillum hungatei JF-1 (strain ATCC 27890 / DSM 864 / NBRC 100397 / JF-1)
Q326G9 1.24e-13 73 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella boydii serotype 4 (strain Sb227)
Q9HT73 1.26e-13 74 32 4 176 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 2e-09 62 27 5 186 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 1.26e-13 74 32 4 176 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 2e-09 62 27 5 186 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q6N7Y6 1.27e-13 74 29 9 240 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N7Y6 1.35e-09 62 28 10 243 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8U4L3 1.28e-13 74 27 6 202 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 6.54e-07 54 25 7 210 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q4QK57 1.32e-13 76 26 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q18AM3 1.32e-13 75 25 5 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridioides difficile (strain 630)
Q8UH62 1.34e-13 75 29 6 202 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q98DT6 1.34e-13 74 29 6 208 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q63TY1 1.41e-13 75 30 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q0P9C4 1.44e-13 77 31 10 215 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q0P9C4 2.33e-05 50 25 10 208 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q7A169 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 1.49e-13 75 28 6 228 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 1.49e-13 75 28 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
P55476 1.51e-13 75 36 3 160 3 nodI Nod factor export ATP-binding protein I Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q92CK1 1.51e-13 74 27 5 227 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92CK1 1.69e-08 59 27 7 197 3 lin1170 Putative ABC transporter ATP-binding protein lin1170 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8PY26 1.52e-13 74 28 8 213 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q1BR30 1.59e-13 76 30 6 206 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
Q1BR30 0.000209 47 25 7 210 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 1.59e-13 76 30 6 206 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
A0B344 0.000209 47 25 7 210 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q3Z5U5 1.65e-13 73 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella sonnei (strain Ss046)
Q62K82 1.68e-13 75 30 6 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q8DZJ0 1.74e-13 75 26 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q8E554 1.74e-13 75 26 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype III (strain NEM316)
Q3K0Y6 1.74e-13 75 26 6 221 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q1MFL8 1.74e-13 74 30 7 214 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
Q8EBC3 1.78e-13 75 28 6 218 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q8FL82 1.85e-13 73 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8Y0X3 1.87e-13 75 32 7 203 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q8Y0X3 0.001 45 25 8 224 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q13LD8 1.89e-13 75 28 7 210 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q13LD8 3.48e-05 50 25 8 224 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q81TH8 1.9e-13 75 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
Q81TH8 3.19e-05 50 22 6 238 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus anthracis
P45051 1.94e-13 75 28 5 203 3 oppF Oligopeptide transport ATP-binding protein OppF Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q73KK2 1.96e-13 76 27 4 217 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q32K28 2.01e-13 73 30 8 204 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella dysenteriae serotype 1 (strain Sd197)
Q0T8D1 2.05e-13 73 30 6 196 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri serotype 5b (strain 8401)
Q1RGD0 2.05e-13 73 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli (strain UTI89 / UPEC)
C0SP98 2.16e-13 75 28 7 217 3 ykfD Putative oligopeptide transport ATP-binding protein YkfD Bacillus subtilis (strain 168)
Q0TLS2 2.17e-13 73 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q92VJ2 2.18e-13 75 32 6 197 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
Q3ISC1 2.19e-13 73 35 5 170 3 phnC1 Phosphonates import ATP-binding protein PhnC 1 Natronomonas pharaonis (strain ATCC 35678 / DSM 2160 / CIP 103997 / JCM 8858 / NBRC 14720 / NCIMB 2260 / Gabara)
Q0K9I2 2.28e-13 74 29 6 206 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q47T99 2.34e-13 75 30 9 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Thermobifida fusca (strain YX)
Q83MG3 2.39e-13 73 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Shigella flexneri
P38046 2.54e-13 73 33 7 178 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P57383 2.59e-13 73 28 5 190 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
O51587 2.62e-13 75 29 8 203 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
O51587 0.000102 48 25 7 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Borreliella burgdorferi (strain ATCC 35210 / DSM 4680 / CIP 102532 / B31)
Q05596 2.73e-13 73 26 6 243 1 cbiO Cobalt import ATP-binding protein CbiO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q05596 0.000451 45 24 6 206 1 cbiO Cobalt import ATP-binding protein CbiO Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q58488 2.77e-13 73 29 8 217 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58488 1.31e-05 50 24 8 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q665B6 2.8e-13 73 32 6 187 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q2SVN0 2.9e-13 74 32 4 184 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q2SVN0 0.000183 47 25 6 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q71X09 2.91e-13 74 26 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q2JGF5 2.92e-13 74 29 6 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q8YDJ8 2.97e-13 74 28 7 241 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YDJ8 1.26e-11 69 29 7 185 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q39AT4 3e-13 75 30 6 206 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39AT4 0.00014 48 25 7 210 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q9K876 3.01e-13 75 28 8 225 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q2SPI3 3.09e-13 73 33 4 169 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q2SPI3 1.14e-06 53 28 7 203 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Hahella chejuensis (strain KCTC 2396)
Q88XV1 3.15e-13 73 31 8 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88XV1 0.000601 45 23 6 216 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q045Z7 3.29e-13 73 26 6 227 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
Q5E882 3.34e-13 72 30 7 203 3 thiQ Thiamine import ATP-binding protein ThiQ Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q8Z5N5 3.35e-13 73 26 6 243 3 cbiO Cobalt import ATP-binding protein CbiO Salmonella typhi
Q8Z5N5 0.000641 45 24 6 207 3 cbiO Cobalt import ATP-binding protein CbiO Salmonella typhi
P0DTT6 3.6e-13 73 27 5 219 1 xylG Xylose/arabinose import ATP-binding protein XylG Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770)
Q5PDU4 3.67e-13 73 26 6 243 3 cbiO Cobalt import ATP-binding protein CbiO Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PDU4 0.000658 45 24 6 207 3 cbiO Cobalt import ATP-binding protein CbiO Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5NZT6 3.68e-13 72 29 9 224 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
Q8R7Y5 3.75e-13 73 27 5 238 1 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q13RD3 3.79e-13 73 30 5 214 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paraburkholderia xenovorans (strain LB400)
Q9Z8Q8 3.85e-13 74 28 9 228 3 metN Methionine import ATP-binding protein MetN Chlamydia pneumoniae
Q4ZZR8 3.86e-13 74 27 13 302 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
P37494 3.87e-13 72 27 4 187 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q0BH79 3.89e-13 74 28 12 311 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BH79 0.000391 46 25 10 224 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q81GC1 3.92e-13 74 26 6 226 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q81GC1 0.000123 48 23 7 240 3 potA Spermidine/putrescine import ATP-binding protein PotA Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A9CKL2 3.93e-13 75 27 7 209 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
A9CKL2 6.83e-12 71 22 20 547 3 yejF Peptidoglycan transport ATP-binding protein YejF Agrobacterium fabrum (strain C58 / ATCC 33970)
Q57TF5 3.99e-13 72 29 8 207 3 thiQ Thiamine import ATP-binding protein ThiQ Salmonella choleraesuis (strain SC-B67)
Q0AGF4 4.11e-13 74 29 6 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8Y4L8 4.11e-13 74 26 7 238 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q0SK28 4.23e-13 72 29 5 217 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Rhodococcus jostii (strain RHA1)
Q2GFZ6 4.3e-13 72 27 5 188 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q1IGZ0 4.34e-13 74 26 10 289 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
P16679 4.5e-13 72 29 7 200 1 phnL Alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL Escherichia coli (strain K12)
P16679 0.00021 46 24 5 201 1 phnL Alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL Escherichia coli (strain K12)
Q21JQ9 4.57e-13 72 26 7 215 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q21JQ9 1.97e-05 49 24 6 199 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
Q6FFZ1 4.6e-13 73 29 5 202 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
D5AQY6 4.68e-13 72 30 7 227 1 nikO Nickel import ATP-binding protein NikO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q8CQS7 4.89e-13 73 26 4 200 3 metN2 Methionine import ATP-binding protein MetN 2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRU5 4.89e-13 73 26 4 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q48PU6 4.98e-13 73 27 10 298 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A0ALT7 5.02e-13 73 33 3 151 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q9I1C8 5.24e-13 74 29 6 208 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I1C8 5.66e-07 55 23 8 235 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q13ZK7 5.3e-13 73 30 4 185 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paraburkholderia xenovorans (strain LB400)
Q4KFA2 5.33e-13 72 30 8 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
P42065 5.5e-13 73 26 4 210 3 appF Oligopeptide transport ATP-binding protein AppF Bacillus subtilis (strain 168)
Q8ELR4 5.52e-13 74 25 5 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q6D5H7 5.97e-13 73 28 6 201 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D5H7 2.65e-06 53 24 8 209 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q927N9 6e-13 73 29 7 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
P33982 6.09e-13 73 29 10 222 3 AZC_3926 Probable ABC transporter ATP-binding protein AZC_3926 Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
A3CMQ7 6.28e-13 74 27 8 223 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus sanguinis (strain SK36)
Q83RS0 6.36e-13 72 28 9 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q83RS0 2.87e-08 58 26 7 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q98G43 6.43e-13 73 27 6 227 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
Q0RT43 6.56e-13 72 30 5 184 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q71WH8 6.65e-13 73 29 7 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria monocytogenes serotype 4b (strain F2365)
Q73DH7 6.67e-13 74 28 7 218 3 rbsA Ribose import ATP-binding protein RbsA Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8X8E3 6.73e-13 72 29 9 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8X8E3 1.63e-07 55 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8R7Y4 6.77e-13 72 25 9 239 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q31ZH4 6.86e-13 72 28 9 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q31ZH4 3.04e-08 58 28 8 228 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q1BWL4 7.06e-13 73 30 3 177 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
Q1BWL4 0.00051 46 28 8 192 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia orbicola (strain AU 1054)
A0K739 7.06e-13 73 30 3 177 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
A0K739 0.00051 46 28 8 192 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Burkholderia cenocepacia (strain HI2424)
P16678 7.12e-13 72 29 9 227 1 phnK Putative phosphonates utilization ATP-binding protein PhnK Escherichia coli (strain K12)
Q576K0 7.28e-13 73 28 7 241 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q576K0 1.19e-11 69 29 7 185 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 7.28e-13 73 28 7 241 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q2YJH4 1.19e-11 69 29 7 185 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q8FV85 7.32e-13 73 28 5 207 3 metN Methionine import ATP-binding protein MetN Brucella suis biovar 1 (strain 1330)
Q8YD40 7.32e-13 73 28 5 207 3 metN Methionine import ATP-binding protein MetN Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q579H8 7.32e-13 73 28 5 207 3 metN Methionine import ATP-binding protein MetN Brucella abortus biovar 1 (strain 9-941)
Q2YIV5 7.32e-13 73 28 5 207 3 metN Methionine import ATP-binding protein MetN Brucella abortus (strain 2308)
Q9KHT9 7.45e-13 73 27 5 217 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes
G2JZ44 7.45e-13 73 27 5 217 1 opuCA Carnitine transport ATP-binding protein OpuCA Listeria monocytogenes serotype 1/2a (strain 10403S)
Q6D4E2 7.62e-13 73 28 6 207 3 potA Spermidine/putrescine import ATP-binding protein PotA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q04DA7 7.83e-13 73 28 11 227 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
A0PY57 7.89e-13 73 26 5 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium novyi (strain NT)
Q9A502 7.93e-13 73 31 7 212 3 metN Methionine import ATP-binding protein MetN Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q5JEB0 8.07e-13 73 32 6 168 3 wtpC Molybdate/tungstate import ATP-binding protein WtpC Thermococcus kodakarensis (strain ATCC BAA-918 / JCM 12380 / KOD1)
Q9V2E4 8.08e-13 72 29 6 191 3 PYRAB01300 Putative ABC transporter ATP-binding protein PYRAB01300 Pyrococcus abyssi (strain GE5 / Orsay)
Q1BY14 8.2e-13 73 27 11 311 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
Q1BY14 0.000275 47 25 9 224 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia orbicola (strain AU 1054)
A0K5N5 8.2e-13 73 27 11 311 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
A0K5N5 0.000275 47 25 9 224 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia cenocepacia (strain HI2424)
Q58903 8.43e-13 71 29 8 208 3 MJ1508 Uncharacterized ABC transporter ATP-binding protein MJ1508 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8FZV2 8.55e-13 71 31 4 214 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q8E3S0 8.56e-13 73 26 9 244 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q0A8P9 8.62e-13 71 30 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0HJG0 8.64e-13 71 29 8 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q9JZW0 8.78e-13 73 29 6 227 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O34756 8.9e-13 72 26 3 210 3 yjkB Putative ABC transporter ATP-binding protein YjkB Bacillus subtilis (strain 168)
O34756 7.59e-05 48 26 8 212 3 yjkB Putative ABC transporter ATP-binding protein YjkB Bacillus subtilis (strain 168)
Q02ME3 9.09e-13 73 29 6 208 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02ME3 6.69e-07 55 24 8 234 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q8TI15 9.14e-13 72 28 6 208 3 MA_4342 Putative ABC transporter ATP-binding protein MA_4342 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A1WXT0 9.21e-13 72 27 3 198 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 0.000168 47 27 6 192 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q110U3 9.42e-13 73 28 9 224 3 potA Spermidine/putrescine import ATP-binding protein PotA Trichodesmium erythraeum (strain IMS101)
Q9X1Z1 9.52e-13 72 27 6 218 1 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q7VNG4 9.56e-13 73 27 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8Y455 9.63e-13 72 29 7 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P45247 9.66e-13 71 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45247 2.83e-07 55 29 6 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q4QKQ9 9.66e-13 71 27 6 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q4QKQ9 2.83e-07 55 29 6 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Haemophilus influenzae (strain 86-028NP)
Q08381 9.7e-13 73 32 9 190 3 modC Molybdenum import ATP-binding protein ModC Rhodobacter capsulatus
Q93DX8 9.84e-13 72 28 5 216 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q03JH1 9.87e-13 73 28 9 216 3 potA Spermidine/putrescine import ATP-binding protein PotA Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q63GR8 1e-12 73 25 6 221 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q63GR8 0.000161 47 22 9 234 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
P49938 1.03e-12 72 27 4 219 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)
P49938 5.94e-06 51 27 10 193 3 fhuC Iron(3+)-hydroxamate import ATP-binding protein FhuC Bacillus subtilis (strain 168)

  • Number of RefSeq hits:

General

Source Morganella morganii S3
Locus tag LHKJJB_01950
Feature type CDS
Gene uup
Product ATPase components of ABC transporters with duplicated ATPase domains
Location 374317 - 376056 (strand: 1)
Length 1740 (nucleotides) / 579 (amino acids)
In genomic island -

Contig

Accession ZDB_359
Length 392768 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_762
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Protein Sequence

MSTLLSTRNLSFHPGHTPLLTDISVALNQGEKIGLIGHNGCGKSTLMKLLSGQLTPDEGTITPANRVIMAYIEQHLPESLNTLSLADAVLEKLPAELHLSEMWRAEMLLTEMGFDPVQWQLPVTALSGGQHTRLLLARALISQPDLLLLDEPSNHLDLPTILWLEQFLKNWRGSFILVSHDNALLDHVTNCTWVLRDGNVSVFRLPCTQAREALAQQDESDEHRHNAQQKEIDRIAVSAKRLAIWGKVYDNEALSRKAKQMEKQIDRLQDDQVELAIGSQWQLKLTGDTLRADRLCSFNQLSVIPADNCPPLYVTDNVSVKSGDRIAVMGANGTGKSSLLRMIWSQSQKPEVTLPDSPLVLHPRVHLGYYDQKLVQLNDSDSLMDALKPFARLIDEQRKMALISAGFPYLRHQQTVSALSGGERARLLFVGLSLANYSLLILDEPTNHLDMDGKLALAEEISRFEGGLILVSHDRELIEKSCNRFWYIDGNRLTEYHDLDQVYDAIRALNADSGTGNSVLPAVPEPSVPVSDEEDSLAALITLEEKLAADLQRKPAHQKPVLQQQWREQIAQLRDELGL

Flanking regions ( +/- flanking 50bp)

ATCGCGTTTTATGACCCATGGCATTGTTATGCCTGAAATTTGAGTAAGCTATGAGCACATTATTATCAACCCGTAATCTGTCATTCCATCCCGGTCATACACCACTGTTAACCGATATTTCTGTCGCCCTTAATCAGGGGGAAAAGATCGGCCTGATCGGGCATAACGGCTGCGGAAAAAGTACCCTGATGAAGCTGTTGTCCGGCCAGCTGACACCGGATGAAGGCACGATTACCCCGGCGAACCGCGTCATTATGGCGTATATCGAACAGCATCTGCCGGAATCCCTCAATACCTTGTCACTGGCGGATGCCGTGCTGGAAAAATTACCGGCGGAACTGCATCTGTCCGAGATGTGGCGGGCGGAAATGCTGCTGACAGAGATGGGATTTGACCCGGTACAGTGGCAGTTACCGGTCACCGCACTGAGCGGCGGCCAGCATACCCGGCTGTTACTGGCACGGGCGCTGATCAGTCAGCCGGATTTATTATTGCTGGATGAACCGAGCAACCATCTGGATCTGCCGACCATTTTGTGGCTCGAGCAGTTCCTGAAAAACTGGCGCGGCAGTTTTATCCTGGTTTCTCATGATAACGCCCTGCTTGATCACGTCACCAACTGCACCTGGGTGCTGCGGGACGGTAACGTTTCAGTGTTCCGTCTGCCCTGCACACAGGCGCGGGAAGCACTGGCGCAGCAGGATGAAAGTGATGAGCACCGCCACAATGCGCAGCAGAAAGAGATCGACCGCATTGCGGTAAGTGCCAAACGGCTGGCGATATGGGGGAAAGTGTATGATAACGAAGCCCTTTCCCGTAAAGCCAAACAGATGGAAAAACAGATAGACCGGTTGCAGGATGATCAGGTTGAACTGGCGATCGGCAGTCAGTGGCAGCTTAAGCTGACCGGGGATACCCTGCGGGCAGACCGGCTGTGTTCCTTTAATCAGCTGTCCGTGATCCCGGCAGACAATTGTCCGCCGCTGTATGTGACAGACAATGTGTCTGTGAAATCCGGCGACCGCATTGCGGTGATGGGCGCAAACGGCACCGGAAAATCCTCACTGCTGCGGATGATCTGGTCACAGTCTCAGAAACCGGAGGTAACACTGCCGGACAGCCCGCTGGTGCTGCATCCCCGTGTGCATCTGGGGTATTACGACCAGAAACTGGTGCAACTGAATGACAGTGATTCACTGATGGATGCGCTGAAACCATTCGCGCGACTGATTGATGAGCAGCGGAAAATGGCACTGATCAGCGCCGGTTTCCCGTATCTGCGCCATCAGCAGACGGTATCTGCCCTGAGCGGCGGTGAACGGGCGCGGCTGTTGTTTGTCGGACTGAGCCTGGCCAACTATTCCCTGCTGATACTGGATGAGCCGACCAACCACCTGGATATGGACGGAAAACTGGCGCTGGCGGAGGAAATCAGCCGGTTTGAGGGCGGGCTGATTCTGGTCAGTCACGACCGGGAGCTGATCGAAAAAAGCTGTAACCGCTTCTGGTATATCGACGGTAACCGACTGACGGAATATCACGATCTGGATCAGGTCTATGATGCTATCCGTGCTCTGAATGCAGATTCCGGCACCGGCAACAGCGTGTTACCGGCGGTCCCGGAGCCATCCGTTCCGGTCAGTGATGAAGAGGATTCGCTGGCGGCACTGATTACGCTGGAGGAAAAACTGGCGGCGGATTTGCAGCGCAAACCCGCACATCAGAAACCGGTTCTGCAACAGCAGTGGCGCGAACAGATTGCGCAACTGCGGGATGAGCTGGGGCTGTAATACGCCATTATAAATGCAGGCCGTTACTTTTTTGTAACGGCCTTTTTAAT