Homologs in group_762

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_02905 FBDBKF_02905 85.1 Morganella morganii S1 uup ATPase components of ABC transporters with duplicated ATPase domains
EHELCC_03375 EHELCC_03375 85.1 Morganella morganii S2 uup ATPase components of ABC transporters with duplicated ATPase domains
NLDBIP_00085 NLDBIP_00085 85.1 Morganella morganii S4 uup ATPase components of ABC transporters with duplicated ATPase domains
LHKJJB_01950 LHKJJB_01950 85.1 Morganella morganii S3 uup ATPase components of ABC transporters with duplicated ATPase domains
HKOGLL_01990 HKOGLL_01990 85.1 Morganella morganii S5 uup ATPase components of ABC transporters with duplicated ATPase domains
PMI_RS05995 PMI_RS05995 67.2 Proteus mirabilis HI4320 - ABC-F family ATP-binding cassette domain-containing protein

Distribution of the homologs in the orthogroup group_762

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_762

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
O05519 1.73e-62 220 30 14 539 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 3.59e-25 113 31 4 229 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O05519 1.06e-17 90 29 5 218 3 ydiF Putative ATP-binding protein YdiF Bacillus subtilis (strain 168)
O34512 7.47e-59 207 29 14 530 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 1.46e-20 99 30 2 187 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
O34512 5.2e-12 72 24 10 310 3 yfmM Uncharacterized ABC transporter ATP-binding protein YfmM Bacillus subtilis (strain 168)
P63389 2.67e-57 206 30 11 528 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63389 5.49e-24 110 35 2 201 1 yheS Probable ATP-binding protein YheS Escherichia coli (strain K12)
P63390 2.67e-57 206 30 11 528 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
P63390 5.49e-24 110 35 2 201 3 yheS Probable ATP-binding protein YheS Escherichia coli O157:H7
A0A0H2VBH0 3.27e-57 206 30 11 528 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VBH0 1.12e-23 108 35 2 201 1 yheS Probable ATP-binding protein YheS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U3 6.11e-54 194 29 16 547 1 ybiT Probable ATP-binding protein YbiT Escherichia coli (strain K12)
P0A9U4 6.11e-54 194 29 16 547 1 ybiT Probable ATP-binding protein YbiT Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9U5 6.11e-54 194 29 16 547 3 ybiT Probable ATP-binding protein YbiT Escherichia coli O157:H7
P39115 9.29e-51 186 27 9 504 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 8.36e-26 115 31 3 201 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
P39115 1.65e-12 73 32 6 181 1 vmlR Ribosome protection protein VmlR Bacillus subtilis (strain 168)
O42943 7.05e-50 185 28 15 528 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O42943 4.49e-22 103 33 5 195 1 SPBC16H5.08c Uncharacterized ABC transporter ATP-binding protein C16H5.08c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q8K9I3 1.79e-49 184 26 15 528 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8T6B7 1.62e-48 181 30 16 529 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
Q8T6B7 2.3e-22 104 33 2 200 3 abcF2 ABC transporter F family member 2 Dictyostelium discoideum
P43672 3.32e-48 181 29 15 547 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
P43672 6.77e-27 119 36 2 196 1 uup ATP-binding protein Uup Escherichia coli (strain K12)
Q9M1H3 9.15e-48 181 28 21 563 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 8.29e-25 112 31 3 219 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
Q9M1H3 3.01e-07 57 26 5 216 2 ABCF4 ABC transporter F family member 4 Arabidopsis thaliana
O59672 2.32e-47 180 29 15 547 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O59672 3.14e-24 111 31 4 214 3 SPBC29A3.09c Uncharacterized ABC transporter ATP-binding protein C29A3.09c Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O06476 1.27e-46 176 29 16 548 3 yfmR Uncharacterized ABC transporter ATP-binding protein YfmR Bacillus subtilis (strain 168)
Q99LE6 1.85e-46 176 28 13 543 1 Abcf2 ATP-binding cassette sub-family F member 2 Mus musculus
Q9FIB4 2.81e-46 176 28 13 550 3 ABCF2 ABC transporter F family member 2 Arabidopsis thaliana
Q9UG63 4.25e-46 175 28 13 543 1 ABCF2 ATP-binding cassette sub-family F member 2 Homo sapiens
Q8H0V6 4.39e-46 176 28 17 549 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 5.22e-25 113 35 3 204 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q8H0V6 0.000172 48 26 1 113 1 ABCF3 ABC transporter F family member 3 Arabidopsis thaliana
Q9FJH6 5.83e-46 174 27 15 550 2 ABCF1 ABC transporter F family member 1 Arabidopsis thaliana
Q2KJA2 5.97e-46 174 28 14 536 2 ABCF2 ATP-binding cassette sub-family F member 2 Bos taurus
Q5R9Z5 4.82e-45 173 28 16 551 2 ABCF3 ATP-binding cassette sub-family F member 3 Pongo abelii
Q8K268 9.57e-45 172 28 16 551 1 Abcf3 ATP-binding cassette sub-family F member 3 Mus musculus
P40024 1.93e-44 170 27 14 535 1 ARB1 ABC transporter ATP-binding protein ARB1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P57445 2.04e-44 169 24 15 599 3 uup ATP-binding protein Uup Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P45127 2.42e-44 169 28 19 544 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45127 2.22e-20 98 32 2 189 1 ettA Energy-dependent translational throttle protein EttA Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9LV93 3.14e-44 170 27 11 545 2 ABCF5 ABC transporter F family member 5 Arabidopsis thaliana
P43535 5.12e-44 170 28 13 531 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 5.8e-24 110 29 4 214 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P43535 4.59e-09 63 27 8 253 1 GCN20 Protein GCN20 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q9NUQ8 8.14e-44 169 28 16 551 1 ABCF3 ATP-binding cassette sub-family F member 3 Homo sapiens
A0A0H2VFI8 1.15e-43 167 28 19 551 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A0A0H2VFI8 4.63e-22 103 32 3 205 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9W5 1.5e-43 166 28 19 551 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W5 6.89e-23 106 33 3 205 3 ettA Energy-dependent translational throttle protein EttA Shigella flexneri
P0A9W3 1.5e-43 166 28 19 551 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W3 6.89e-23 106 33 3 205 1 ettA Energy-dependent translational throttle protein EttA Escherichia coli (strain K12)
P0A9W4 1.5e-43 166 28 19 551 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
P0A9W4 6.89e-23 106 33 3 205 3 ettA Energy-dependent translational throttle protein EttA Escherichia coli O157:H7
Q57242 1.64e-43 168 27 19 634 3 uup ATP-binding protein Uup Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8T6B4 1.71e-43 170 27 17 535 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 4.3e-22 104 31 5 205 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
Q8T6B4 0.000127 48 30 1 96 3 abcF4 ABC transporter F family member 4 Dictyostelium discoideum
O31716 2.07e-43 166 26 16 531 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
O31716 1.56e-10 67 23 6 237 3 ykpA Uncharacterized ABC transporter ATP-binding protein YkpA Bacillus subtilis (strain 168)
Q66H39 2.71e-43 168 27 16 551 2 Abcf3 ATP-binding cassette sub-family F member 3 Rattus norvegicus
Q8SRV5 9.16e-41 159 28 15 491 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q8SRV5 2.65e-21 101 32 3 201 3 ECU05_1190 Probable ATP-binding cassette sub-family F member 3 homolog Encephalitozoon cuniculi (strain GB-M1)
Q6MG08 1.71e-39 157 27 11 511 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 1.56e-17 90 30 6 207 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q6MG08 1.06e-08 62 26 5 215 1 Abcf1 ATP-binding cassette sub-family F member 1 Rattus norvegicus
Q767L0 3.12e-39 157 26 12 514 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 7.88e-18 91 30 6 207 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q767L0 7.55e-09 62 27 6 213 3 ABCF1 ATP-binding cassette sub-family F member 1 Sus scrofa
Q8NE71 5.68e-39 156 26 12 514 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 9.63e-18 90 30 6 207 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q8NE71 1.09e-08 62 26 5 214 1 ABCF1 ATP-binding cassette sub-family F member 1 Homo sapiens
Q7YR37 1.79e-38 154 26 12 514 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 7.22e-18 91 30 6 207 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q7YR37 5.92e-08 59 25 5 215 3 ABCF1 ATP-binding cassette sub-family F member 1 Pan troglodytes
Q6P542 4.49e-38 153 26 11 518 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 1.92e-17 90 30 6 204 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
Q6P542 5.67e-07 56 33 0 96 1 Abcf1 ATP-binding cassette sub-family F member 1 Mus musculus
P0DX93 4.98e-37 147 25 10 498 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 3.97e-18 91 28 5 189 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P0DX93 3.09e-14 79 30 6 182 1 msrD Probable macrolide resistance translation factor MsrD Streptococcus pneumoniae
P25256 1.77e-35 143 30 19 527 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 3.55e-17 88 34 4 179 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
P25256 8.65e-12 71 28 6 222 3 tlrC Tylosin resistance ATP-binding protein TlrC Streptomyces fradiae
Q9USH9 3.87e-35 144 26 18 529 1 SPCC825.01 Uncharacterized ABC transporter ATP-binding protein C825.01 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P23212 2.55e-34 139 25 13 498 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 6.25e-19 93 31 5 193 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
P23212 9.06e-15 80 33 7 180 3 msrA Erythromycin resistance ATP-binding protein MsrA Staphylococcus epidermidis
Q45978 2.63e-33 138 29 18 509 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
Q45978 3e-19 95 33 3 209 3 uup ATP-binding protein Uup Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P9WQK3 6.54e-32 133 26 16 520 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 1.15e-18 93 33 1 177 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK3 2.41e-06 54 28 5 215 1 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQK2 6.54e-32 133 26 16 520 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 1.15e-18 93 33 1 177 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P9WQK2 2.41e-06 54 28 5 215 3 ettA Energy-dependent translational throttle protein EttA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P44808 2.65e-29 126 35 6 264 1 yheS Probable ATP-binding protein YheS Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
D0MYB4 9.58e-25 113 30 15 373 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 6.86e-11 69 29 5 188 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 4.73e-08 60 32 0 80 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 6.01e-08 59 30 1 98 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
D0MYB4 1.39e-05 52 34 2 81 1 TEF3 Elongation factor 3 Phytophthora infestans (strain T30-4)
O94489 9.81e-25 113 39 6 187 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.06e-10 68 32 3 114 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 5.42e-07 56 38 2 73 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 1.01e-06 55 31 0 79 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O94489 9.57e-06 52 26 5 189 1 tef3 Elongation factor 3 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O93796 6.76e-24 110 33 8 226 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.15e-11 70 27 2 179 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 4.27e-09 63 29 2 107 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 6.86e-09 62 35 3 95 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O93796 2.8e-07 57 32 0 79 3 TEF3 Elongation factor 3 Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
O14134 5.1e-23 107 35 6 193 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 3.67e-10 66 30 4 182 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 4e-10 66 31 3 125 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 4.25e-08 60 34 1 87 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O14134 5.99e-06 53 36 1 77 1 elf1 mRNA export factor elf1 Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P16521 2.73e-22 105 32 8 229 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.19e-08 62 35 3 95 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 1.7e-08 61 29 0 87 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 2.04e-08 61 26 2 179 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P16521 3.94e-07 57 32 0 79 1 YEF3 Elongation factor 3A Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P29551 2.87e-22 105 26 11 371 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 2.17e-08 61 29 3 116 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.01e-07 58 28 7 190 3 TEF3 Elongation factor 3 Pneumocystis carinii
P29551 1.99e-06 54 30 0 79 3 TEF3 Elongation factor 3 Pneumocystis carinii
Q1Q889 4.9e-22 99 36 5 194 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q1Q889 1.34e-08 59 32 9 187 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q6FFL0 9.83e-22 98 36 5 186 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q6FFL0 1.62e-06 53 25 7 185 3 znuC Zinc import ATP-binding protein ZnuC Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q4FQ27 1.38e-21 97 38 6 194 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q4FQ27 3.01e-09 61 32 9 187 3 znuC Zinc import ATP-binding protein ZnuC Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q75EV6 7.38e-21 100 32 7 220 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 3.19e-08 60 35 3 95 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 6.56e-08 59 28 2 107 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 2.7e-07 57 26 2 179 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
Q75EV6 4.08e-07 57 32 0 79 3 TEF3 Elongation factor 3 Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
P53978 1.4e-20 100 31 8 226 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 2.76e-09 63 27 2 179 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.08e-08 62 34 3 95 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.29e-08 62 29 1 94 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P53978 1.41e-07 58 32 0 79 1 HEF3 Elongation factor 3B Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
P25997 3.5e-20 99 33 8 227 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.04e-08 62 29 2 107 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 1.29e-08 62 36 3 95 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 2.67e-06 54 25 4 181 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
P25997 2.84e-06 54 31 0 79 1 CEF3 Elongation factor 3 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q08972 4.19e-20 98 35 6 191 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 6.53e-11 69 30 5 184 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 9.71e-10 65 36 0 79 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.71e-09 64 36 0 80 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q08972 1.05e-07 58 39 0 66 1 NEW1 [NU+] prion formation protein 1 Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A0LCH8 1.7e-19 92 35 5 190 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A0LCH8 1.64e-10 65 26 7 216 3 znuC Zinc import ATP-binding protein ZnuC Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
P45167 1.42e-18 92 32 3 202 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P45167 1.12e-15 83 25 15 445 3 uup-B ATP-binding protein Uup-like Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q88ZZ2 2.69e-18 92 30 7 236 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q88ZZ2 7.21e-13 75 23 16 528 3 lp_0149 Putative ABC transporter ATP-binding protein lp_0149 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
O34946 4.27e-18 87 32 5 181 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
O34946 3.12e-06 52 22 6 192 1 znuC High-affinity zinc uptake system ATP-binding protein ZnuC Bacillus subtilis (strain 168)
P12622 4.37e-18 88 33 11 266 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 1.09e-06 54 33 0 71 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
P12622 8.13e-05 48 36 0 82 3 chvD ATP-binding protein ChvD (Fragment) Rhizobium radiobacter
O34392 4.39e-18 87 30 7 204 2 ytrE ABC transporter ATP-binding protein YtrE Bacillus subtilis (strain 168)
A1B9K8 9.71e-18 86 34 6 188 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
A1B9K8 7.31e-10 63 29 8 209 3 znuC Zinc import ATP-binding protein ZnuC Paracoccus denitrificans (strain Pd 1222)
Q6D4A8 1.18e-17 86 35 7 196 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D4A8 6.58e-11 66 32 5 170 3 znuC Zinc import ATP-binding protein ZnuC Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q32HA3 1.69e-17 85 29 7 255 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q32HA3 1.01e-08 60 31 7 174 3 znuC Zinc import ATP-binding protein ZnuC Shigella dysenteriae serotype 1 (strain Sd197)
Q8TSC8 2.06e-17 89 24 20 555 3 MA_0870 Putative ABC transporter ATP-binding protein MA_0870 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q3Z2L6 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q3Z2L6 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Shigella sonnei (strain Ss046)
Q322E8 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q322E8 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Shigella boydii serotype 4 (strain Sb227)
Q1RAS6 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
Q1RAS6 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain UTI89 / UPEC)
P0A9X1 2.14e-17 85 29 6 253 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X1 1.63e-08 59 30 5 170 1 znuC Zinc import ATP-binding protein ZnuC Escherichia coli (strain K12)
P0A9X2 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9X2 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TGX4 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TGX4 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1AC19 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
A1AC19 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O1:K1 / APEC
P0A9X3 2.14e-17 85 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
P0A9X3 1.63e-08 59 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Escherichia coli O157:H7
Q1GL85 2.9e-17 85 35 5 185 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q1GL85 9.61e-11 65 29 6 210 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria sp. (strain TM1040)
Q8RD07 3.19e-17 84 30 7 218 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q8RD07 5.24e-07 54 25 11 232 3 TTE0246 Putative ABC transporter ATP-binding protein TTE0246 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q5PIA5 3.37e-17 85 30 2 185 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PIA5 5e-07 54 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57NA5 3.37e-17 85 30 2 185 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q57NA5 5e-07 54 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Salmonella choleraesuis (strain SC-B67)
Q8Z5W6 3.56e-17 84 30 2 185 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q8Z5W6 2.65e-07 55 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Salmonella typhi
Q7N545 3.71e-17 85 32 5 194 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7N545 1.32e-08 59 30 6 182 3 znuC Zinc import ATP-binding protein ZnuC Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q83KR7 4.11e-17 84 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q83KR7 6.18e-08 57 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri
Q0T3U8 4.11e-17 84 29 6 253 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q0T3U8 6.18e-08 57 30 5 170 3 znuC Zinc import ATP-binding protein ZnuC Shigella flexneri serotype 5b (strain 8401)
Q8ZNV7 4.23e-17 84 30 2 185 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZNV7 6.59e-08 57 30 5 170 2 znuC Zinc import ATP-binding protein ZnuC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q5L222 4.24e-17 86 28 5 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Geobacillus kaustophilus (strain HTA426)
Q831K6 4.98e-17 86 28 8 245 1 metN2 Methionine import ATP-binding protein MetN 2 Enterococcus faecalis (strain ATCC 700802 / V583)
O32169 6.04e-17 85 29 9 244 1 metN Methionine import ATP-binding protein MetN Bacillus subtilis (strain 168)
Q1R5D8 6.07e-17 84 29 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain UTI89 / UPEC)
Q8FCM9 6.07e-17 84 29 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TBX8 6.07e-17 84 29 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q6HBS0 7e-17 85 25 6 296 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus thuringiensis subsp. konkukian (strain 97-27)
P57403 7.16e-17 83 32 3 185 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P57403 0.00018 47 28 6 171 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
Q631Y4 7.82e-17 85 25 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ZK / E33L)
Q31I51 7.83e-17 84 29 5 207 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q31I51 4.8e-06 52 25 7 206 3 znuC Zinc import ATP-binding protein ZnuC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
Q81XL3 8.27e-17 85 25 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus anthracis
Q7MMN0 8.97e-17 84 33 3 187 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q7MMN0 1.01e-07 57 32 7 171 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain YJ016)
Q8DFQ4 8.97e-17 84 33 3 187 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8DFQ4 1.01e-07 57 32 7 171 3 znuC Zinc import ATP-binding protein ZnuC Vibrio vulnificus (strain CMCP6)
Q8U8D6 9.99e-17 84 31 5 204 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q9HYG4 1.01e-16 84 33 8 218 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8TIW9 1.11e-16 84 30 7 226 3 MA_4021 Putative ABC transporter ATP-binding protein MA_4021 Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q89AJ0 1.27e-16 83 30 3 185 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q89AJ0 7.41e-06 51 25 6 178 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q72Y96 1.3e-16 85 25 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q815Y7 1.31e-16 85 25 6 296 3 metN3 Methionine import ATP-binding protein MetN 3 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
A1B9H9 1.35e-16 83 32 6 210 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Paracoccus denitrificans (strain Pd 1222)
Q87UN0 1.59e-16 83 30 6 233 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UN0 5.79e-10 63 29 8 191 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q87UI3 2.19e-16 83 30 10 275 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
A1JRI2 2.25e-16 82 33 4 187 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A1JRI2 1.87e-09 62 31 5 170 3 znuC Zinc import ATP-binding protein ZnuC Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
Q0A9E2 2.47e-16 82 31 6 222 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q0A9E2 1.81e-05 50 28 5 176 3 znuC Zinc import ATP-binding protein ZnuC Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q02QT1 2.5e-16 82 31 6 216 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas aeruginosa (strain UCBPP-PA14)
Q48CA0 2.83e-16 82 30 10 275 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q928L8 3.09e-16 84 26 6 233 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q18C09 3.44e-16 83 27 5 216 3 metN Methionine import ATP-binding protein MetN Clostridioides difficile (strain 630)
Q9WXX8 3.62e-16 81 28 5 197 3 TM_0124 Probable metal transport system ATP-binding protein TM_0124 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
P77622 3.74e-16 83 28 3 194 2 ddpF Probable D,D-dipeptide transport ATP-binding protein DdpF Escherichia coli (strain K12)
Q32AQ1 4.77e-16 82 28 5 229 3 nikE Nickel import ATP-binding protein NikE Shigella dysenteriae serotype 1 (strain Sd197)
Q71X09 4.85e-16 83 27 6 233 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serotype 4b (strain F2365)
Q8NR42 4.85e-16 81 36 8 209 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Corynebacterium glutamicum (strain ATCC 13032 / DSM 20300 / JCM 1318 / BCRC 11384 / CCUG 27702 / LMG 3730 / NBRC 12168 / NCIMB 10025 / NRRL B-2784 / 534)
Q160Y9 4.86e-16 81 35 4 157 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q160Y9 7.68e-08 57 28 6 187 3 znuC Zinc import ATP-binding protein ZnuC Roseobacter denitrificans (strain ATCC 33942 / OCh 114)
Q4ZLS1 4.88e-16 82 30 10 275 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Pseudomonas syringae pv. syringae (strain B728a)
Q48PV0 5.59e-16 81 30 7 233 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48PV0 5.97e-10 63 31 8 187 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q87RE5 6.24e-16 81 30 4 226 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q87RE5 2.23e-08 58 32 7 175 3 znuC Zinc import ATP-binding protein ZnuC Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q5HQ70 6.67e-16 83 26 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q31VE6 8.08e-16 81 27 4 229 3 nikE Nickel import ATP-binding protein NikE Shigella boydii serotype 4 (strain Sb227)
Q8X4L6 9.56e-16 81 27 4 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli O157:H7
Q3YW48 1.11e-15 80 28 5 229 3 nikE Nickel import ATP-binding protein NikE Shigella sonnei (strain Ss046)
Q0S0X2 1.14e-15 80 33 4 192 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q0S0X2 0.000625 45 24 4 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Rhodococcus jostii (strain RHA1)
Q8Y4L8 1.22e-15 82 26 6 233 3 metN2 Methionine import ATP-binding protein MetN 2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q5X627 1.28e-15 82 32 7 197 3 potA Spermidine/putrescine import ATP-binding protein PotA Legionella pneumophila (strain Paris)
Q6LTB1 1.28e-15 80 34 5 186 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6LTB1 1.94e-10 65 34 8 175 3 znuC Zinc import ATP-binding protein ZnuC Photobacterium profundum (strain SS9)
Q6D201 1.33e-15 81 28 6 222 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q65F80 1.36e-15 82 27 6 229 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
P33594 1.45e-15 80 28 5 229 3 nikE Nickel import ATP-binding protein NikE Escherichia coli (strain K12)
Q5E6M2 1.5e-15 80 31 3 187 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q5E6M2 5.54e-09 60 30 5 173 3 znuC1 Zinc import ATP-binding protein ZnuC 1 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q4ZZS2 1.72e-15 80 30 7 233 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q4ZZS2 4.97e-10 63 30 8 182 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas syringae pv. syringae (strain B728a)
Q07LQ4 1.75e-15 80 31 5 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Rhodopseudomonas palustris (strain BisA53)
Q50294 1.79e-15 80 28 6 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)
P54537 1.88e-15 79 27 5 215 1 artM Arginine transport ATP-binding protein ArtM Bacillus subtilis (strain 168)
Q8PHQ3 2.11e-15 80 30 5 204 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Xanthomonas axonopodis pv. citri (strain 306)
Q02SA6 2.24e-15 79 32 8 214 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain UCBPP-PA14)
Q9HX79 2.28e-15 79 32 8 214 3 tauB Taurine import ATP-binding protein TauB Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q1BG75 2.72e-15 79 35 7 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia orbicola (strain AU 1054)
A0KE71 2.72e-15 79 35 7 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia cenocepacia (strain HI2424)
Q2GFZ6 3.04e-15 79 30 6 186 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia chaffeensis (strain ATCC CRL-10679 / Arkansas)
Q5YZY9 3.09e-15 80 28 5 218 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Nocardia farcinica (strain IFM 10152)
Q82MV1 3.17e-15 79 34 6 187 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Streptomyces avermitilis (strain ATCC 31267 / DSM 46492 / JCM 5070 / NBRC 14893 / NCIMB 12804 / NRRL 8165 / MA-4680)
Q66AT7 3.28e-15 79 31 6 231 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q66AT7 9.32e-11 65 33 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pseudotuberculosis serotype I (strain IP32953)
Q3IWB5 3.64e-15 79 32 4 183 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
Q3IWB5 1.45e-09 62 30 8 184 3 znuC Zinc import ATP-binding protein ZnuC Cereibacter sphaeroides (strain ATCC 17023 / DSM 158 / JCM 6121 / CCUG 31486 / LMG 2827 / NBRC 12203 / NCIMB 8253 / ATH 2.4.1.)
O34900 3.98e-15 79 28 6 218 1 tcyN L-cystine import ATP-binding protein TcyN Bacillus subtilis (strain 168)
Q1CJG3 4.11e-15 79 31 6 231 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CJG3 8.98e-11 66 33 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Nepal516)
Q7CIC2 4.11e-15 79 31 6 231 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q7CIC2 8.98e-11 66 33 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis
Q1C812 4.11e-15 79 31 6 231 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C812 8.98e-11 66 33 5 171 3 znuC Zinc import ATP-binding protein ZnuC Yersinia pestis bv. Antiqua (strain Antiqua)
Q97KZ3 4.12e-15 78 28 6 215 3 CA_C0773 Putative ABC transporter ATP-binding protein CA_C0773 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5WKG4 4.4e-15 78 33 9 212 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Shouchella clausii (strain KSM-K16)
Q55463 4.52e-15 79 32 11 201 2 cmpD Bicarbonate transport ATP-binding protein CmpD Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q38WL5 4.55e-15 80 29 7 230 3 metN Methionine import ATP-binding protein MetN Latilactobacillus sakei subsp. sakei (strain 23K)
Q8CPN0 5.25e-15 80 26 6 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q927N9 5.4e-15 79 29 7 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q60AI1 6.36e-15 80 33 7 213 3 potA Spermidine/putrescine import ATP-binding protein PotA Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q8RI39 6.37e-15 80 28 11 284 3 potA Spermidine/putrescine import ATP-binding protein PotA Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
Q4K441 6.37e-15 78 31 10 244 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q71WH8 6.81e-15 79 29 7 225 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria monocytogenes serotype 4b (strain F2365)
Q884I3 6.89e-15 77 33 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884I3 6.07e-07 54 28 9 203 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q5FA19 6.96e-15 79 31 6 218 1 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
Q89ER4 7.19e-15 78 31 5 204 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q5E3B8 7.23e-15 78 28 6 224 3 pstB2 Phosphate import ATP-binding protein PstB 2 Aliivibrio fischeri (strain ATCC 700601 / ES114)
Q57QD7 7.84e-15 77 32 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q57QD7 4.06e-06 52 27 10 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella choleraesuis (strain SC-B67)
Q0P9C4 8.23e-15 81 31 10 216 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q0P9C4 3.06e-06 53 25 10 208 1 pglK Protein glycosylation K Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q5QU46 8.65e-15 77 30 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q5QU46 0.001 44 25 6 184 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
Q14Q07 9.24e-15 79 27 5 229 3 potA Spermidine/putrescine import ATP-binding protein PotA Spiroplasma citri
A0KPH6 9.67e-15 77 31 3 185 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
A0KPH6 5.62e-06 51 29 7 181 3 znuC Zinc import ATP-binding protein ZnuC Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
Q9HZL7 9.7e-15 77 31 7 214 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HZL7 1.34e-05 50 27 7 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Y455 9.71e-15 78 33 4 159 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q6MU19 9.76e-15 79 27 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6MU19 5.26e-05 49 22 7 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q6YRJ4 1.02e-14 80 29 7 215 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q6YRJ4 1.27e-05 52 20 19 538 3 PAM_020 Putative ABC transporter ATP-binding protein PAM_020 Onion yellows phytoplasma (strain OY-M)
Q0SZJ3 1.07e-14 78 27 4 230 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri serotype 5b (strain 8401)
Q2SSS4 1.14e-14 79 27 5 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q2SSS4 6.17e-05 49 22 7 211 3 potA Spermidine/putrescine import ATP-binding protein PotA Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q11SW8 1.21e-14 76 28 7 222 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Cytophaga hutchinsonii (strain ATCC 33406 / DSM 1761 / CIP 103989 / NBRC 15051 / NCIMB 9469 / D465)
P61482 1.25e-14 77 32 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61482 5.06e-06 51 27 10 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P61481 1.25e-14 77 32 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
P61481 5.06e-06 51 27 10 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella typhi
Q5PGR6 1.25e-14 77 32 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q5PGR6 5.06e-06 51 27 10 226 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q9CN78 1.27e-14 77 30 6 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q9CN78 1.86e-06 52 26 7 197 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pasteurella multocida (strain Pm70)
Q5KVK2 1.27e-14 79 27 6 238 3 metN Methionine import ATP-binding protein MetN Geobacillus kaustophilus (strain HTA426)
Q72D73 1.31e-14 77 31 6 218 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q72D73 4.51e-10 64 25 4 212 3 DVU_1056 Putative ABC transporter ATP-binding protein DVU_1056 Nitratidesulfovibrio vulgaris (strain ATCC 29579 / DSM 644 / CCUG 34227 / NCIMB 8303 / VKM B-1760 / Hildenborough)
Q1R155 1.38e-14 77 35 3 159 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1R155 3.59e-06 52 25 5 188 3 znuC Zinc import ATP-binding protein ZnuC Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q1AS06 1.39e-14 79 28 6 225 3 potA Spermidine/putrescine import ATP-binding protein PotA Rubrobacter xylanophilus (strain DSM 9941 / NBRC 16129 / PRD-1)
Q88AS5 1.41e-14 78 28 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8XK20 1.42e-14 80 27 7 218 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q8XK20 1.5e-10 67 21 18 523 3 CPE1583 Putative ABC transporter ATP-binding protein CPE1583 Clostridium perfringens (strain 13 / Type A)
Q48KI4 1.44e-14 76 32 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q48KI4 5.66e-06 51 26 8 201 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q83J77 1.49e-14 77 27 4 230 3 nikE Nickel import ATP-binding protein NikE Shigella flexneri
A0ALT6 1.55e-14 77 33 4 159 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q4W575 1.64e-14 78 31 6 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JVH1 1.64e-14 78 31 6 219 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
D4GSY7 1.71e-14 77 29 6 233 3 HVO_1886 Probable anion import ATP-binding protein HVO_1886 Haloferax volcanii (strain ATCC 29605 / DSM 3757 / JCM 8879 / NBRC 14742 / NCIMB 2012 / VKM B-1768 / DS2)
Q7N6Z2 1.76e-14 79 29 6 230 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q7NWX3 1.78e-14 79 28 9 277 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q93D97 1.92e-14 79 28 7 218 3 sdcBA Putative ABC transporter ATP-binding protein SMU_1934c Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
Q46ZU5 1.92e-14 77 31 6 194 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q6LU82 2.08e-14 77 29 5 223 3 pstB1 Phosphate import ATP-binding protein PstB 1 Photobacterium profundum (strain SS9)
Q32EX7 2.1e-14 76 32 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q32EX7 9.21e-06 50 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella dysenteriae serotype 1 (strain Sd197)
Q1B8U4 2.26e-14 76 31 7 220 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q1B8U4 0.000571 45 33 4 136 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium sp. (strain MCS)
Q3K9F9 2.37e-14 76 31 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
Q3K9F9 0.000129 47 27 7 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain Pf0-1)
P75957 2.42e-14 76 32 9 209 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
P75957 1.25e-05 50 27 10 225 1 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain K12)
Q28VN1 2.45e-14 76 32 4 168 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q28VN1 4.2e-09 60 28 6 180 3 znuC Zinc import ATP-binding protein ZnuC Jannaschia sp. (strain CCS1)
Q2FVF1 2.46e-14 76 27 4 209 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q81PZ8 2.61e-14 79 30 9 218 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q81PZ8 9.66e-05 48 25 6 207 3 BA_2641 Putative ABC transporter ATP-binding protein BA_2641/GBAA_2641/BAS2461 Bacillus anthracis
Q4ZV73 2.65e-14 75 32 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q4ZV73 5.82e-06 51 26 9 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas syringae pv. syringae (strain B728a)
Q73XU8 2.78e-14 78 29 5 211 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
Q0VTB6 2.92e-14 76 31 6 227 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q0VTB6 8.36e-10 63 29 7 218 3 znuC Zinc import ATP-binding protein ZnuC Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q8ES39 2.93e-14 79 27 5 257 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q8ES39 2.43e-06 53 27 6 189 3 OB0804 Putative ABC transporter ATP-binding protein OB0804 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
Q88R93 2.97e-14 76 32 8 212 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q21XJ9 3.03e-14 77 31 7 227 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
A0A0H3JT74 3.15e-14 76 27 4 209 1 cntF Metal-staphylopine import system ATP-binding protein CntF Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5LUR8 3.2e-14 76 34 3 184 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LUR8 9.97e-11 65 29 6 188 3 znuC Zinc import ATP-binding protein ZnuC Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8KZQ6 3.41e-14 76 33 10 211 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas putida
Q3A6U0 3.51e-14 76 29 8 226 3 pstB Phosphate import ATP-binding protein PstB Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
Q3K506 3.57e-14 76 31 11 244 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas fluorescens (strain Pf0-1)
Q8NWT6 3.7e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MW2)
Q6G9I1 3.7e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MSSA476)
Q57554 3.75e-14 76 29 5 216 3 MJ0089 Uncharacterized ABC transporter ATP-binding protein MJ0089 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P9WQM1 3.77e-14 77 31 5 196 1 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WQM0 3.77e-14 77 31 5 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0A4W3 3.77e-14 77 31 5 196 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
Q13RD3 3.85e-14 75 30 5 214 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Paraburkholderia xenovorans (strain LB400)
Q5WVL8 3.87e-14 77 31 8 227 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
Q5WVL8 7.67e-06 52 23 7 223 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Lens)
P16679 3.95e-14 75 31 4 161 1 phnL Alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL Escherichia coli (strain K12)
P16679 0.000297 46 25 4 174 1 phnL Alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnL Escherichia coli (strain K12)
Q217B2 3.98e-14 76 34 4 177 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain BisB18)
Q3M5J9 3.99e-14 75 31 10 241 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q63TY1 4.02e-14 77 31 7 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia pseudomallei (strain K96243)
Q5ZUG5 4.24e-14 77 31 8 227 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5ZUG5 8.53e-06 52 23 7 226 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q4ZQE3 4.28e-14 76 31 7 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas syringae pv. syringae (strain B728a)
Q9HPH7 4.4e-14 75 30 6 214 3 VNG_1631G Putative ABC transporter ATP-binding protein VNG_1631G Halobacterium salinarum (strain ATCC 700922 / JCM 11081 / NRC-1)
Q0SRL2 4.44e-14 77 23 8 272 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain SM101 / Type A)
Q6MD10 4.46e-14 75 29 8 196 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
Q6MD10 9.77e-07 53 27 6 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Protochlamydia amoebophila (strain UWE25)
Q7A5Q9 4.47e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain N315)
Q99UA3 4.47e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q93SH7 4.51e-14 76 33 5 181 3 hmuV Hemin import ATP-binding protein HmuV Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q4KKK4 4.76e-14 75 29 5 231 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KKK4 2.57e-10 64 28 7 209 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q1IGL4 4.87e-14 76 30 9 239 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pseudomonas entomophila (strain L48)
Q6GH28 4.92e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain MRSA252)
Q92VJ2 4.95e-14 77 29 7 215 3 cysA2 Sulfate/thiosulfate import ATP-binding protein CysA 2 Rhizobium meliloti (strain 1021)
A0ALT7 5.04e-14 76 34 5 154 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q73YZ5 5.1e-14 75 33 5 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycolicibacterium paratuberculosis (strain ATCC BAA-968 / K-10)
A0QFE1 5.1e-14 75 33 5 192 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Mycobacterium avium (strain 104)
Q62K82 5.38e-14 77 31 7 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Burkholderia mallei (strain ATCC 23344)
Q0B6I6 5.45e-14 77 30 6 205 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q2YVT7 5.47e-14 77 26 6 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q5HG41 5.67e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain COL)
Q2FYQ8 5.67e-14 75 29 5 191 1 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH58 5.67e-14 75 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain USA300)
Q8PP41 6.03e-14 75 36 8 183 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Xanthomonas axonopodis pv. citri (strain 306)
Q74DN5 6.08e-14 75 29 6 218 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q74DN5 1.21e-06 53 26 6 190 3 GSU1281 Putative ABC transporter ATP-binding protein GSU1281 Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q0SBZ1 6.4e-14 77 29 5 211 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhodococcus jostii (strain RHA1)
Q15TB1 6.46e-14 74 32 5 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q15TB1 0.000152 47 26 8 202 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
Q8E3S6 6.5e-14 78 28 8 221 3 gbs1680 Putative ABC transporter ATP-binding protein gbs1680 Streptococcus agalactiae serotype III (strain NEM316)
Q8U4L3 6.7e-14 75 29 6 203 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q8U4L3 3.85e-06 52 23 7 210 3 PF0068 Putative ABC transporter ATP-binding protein PF0068 Pyrococcus furiosus (strain ATCC 43587 / DSM 3638 / JCM 8422 / Vc1)
Q9HY19 6.77e-14 77 30 3 192 3 potA2 Spermidine/putrescine import ATP-binding protein PotA 2 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P47425 6.82e-14 75 28 10 206 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma genitalium (strain ATCC 33530 / DSM 19775 / NCTC 10195 / G37)
Q8REG7 7.04e-14 75 24 4 231 3 phnC Phosphonates import ATP-binding protein PhnC Fusobacterium nucleatum subsp. nucleatum (strain ATCC 25586 / DSM 15643 / BCRC 10681 / CIP 101130 / JCM 8532 / KCTC 2640 / LMG 13131 / VPI 4355)
P0A2V9 7.11e-14 75 28 9 246 1 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A2V8 7.11e-14 75 28 9 246 3 pstB3 Phosphate import ATP-binding protein PstB 3 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q5X484 7.2e-14 76 31 8 227 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q5X484 8.02e-06 52 23 7 226 3 metN Methionine import ATP-binding protein MetN Legionella pneumophila (strain Paris)
Q8YCN7 7.26e-14 75 30 6 210 3 nikE Nickel import ATP-binding protein NikE Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q578S7 7.26e-14 75 30 6 210 3 nikE Nickel import ATP-binding protein NikE Brucella abortus biovar 1 (strain 9-941)
Q2YL69 7.26e-14 75 30 6 210 3 nikE Nickel import ATP-binding protein NikE Brucella abortus (strain 2308)
Q02R79 7.35e-14 77 30 3 192 3 potA Spermidine/putrescine import ATP-binding protein PotA Pseudomonas aeruginosa (strain UCBPP-PA14)
O34314 8.08e-14 75 31 7 205 3 ytlC Uncharacterized ABC transporter ATP-binding protein YtlC Bacillus subtilis (strain 168)
A1WXT0 8.55e-14 75 29 4 198 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
A1WXT0 3.71e-05 49 27 6 195 3 znuC Zinc import ATP-binding protein ZnuC Halorhodospira halophila (strain DSM 244 / SL1)
Q1RDS4 8.62e-14 75 31 7 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain UTI89 / UPEC)
A1A9L0 8.62e-14 75 31 7 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O1:K1 / APEC
Q8YDJ8 8.77e-14 75 27 5 244 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q8YDJ8 7.87e-12 70 30 6 181 3 znuC Zinc import ATP-binding protein ZnuC Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q6GJL2 8.89e-14 76 26 6 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MRSA252)
Q3KKA1 9.18e-14 75 33 5 178 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q3KKA1 1.85e-10 65 30 7 185 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas fluorescens (strain Pf0-1)
Q1LNM0 9.24e-14 75 32 7 196 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q9HT73 9.41e-14 75 29 5 231 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9HT73 8.25e-09 60 28 6 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q02DK9 9.41e-14 75 29 5 231 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q02DK9 8.25e-09 60 28 6 210 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas aeruginosa (strain UCBPP-PA14)
Q88RL5 9.45e-14 76 30 8 230 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q8GDV4 9.74e-14 74 27 7 229 3 pstB Phosphate import ATP-binding protein PstB (Fragment) Heliobacterium mobile
A0A0H2ZLL3 9.81e-14 74 27 5 215 3 egtUA Probable ergothioneine transport ATP-binding protein EgtUA Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q6HI76 9.89e-14 77 30 9 218 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q6HI76 4.44e-05 50 28 9 209 3 BT9727_2424 Putative ABC transporter ATP-binding protein BT9727_2424 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q1QDA8 9.92e-14 77 30 11 252 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q49WM4 1.02e-13 76 25 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q3Z300 1.03e-13 74 31 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q3Z300 9.56e-06 50 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella sonnei (strain Ss046)
Q1RD37 1.03e-13 74 31 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q1RD37 9.56e-06 50 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli (strain UTI89 / UPEC)
Q8FIM7 1.03e-13 74 31 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8FIM7 9.56e-06 50 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TIV6 1.03e-13 74 31 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q0TIV6 9.56e-06 50 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q8G838 1.04e-13 78 24 20 548 3 BL0043 Putative ABC transporter ATP-binding protein BL0043 Bifidobacterium longum (strain NCC 2705)
Q8FVN0 1.06e-13 75 30 6 210 2 nikE Nickel import ATP-binding protein NikE Brucella suis biovar 1 (strain 1330)
Q5WCI1 1.07e-13 74 31 6 198 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Shouchella clausii (strain KSM-K16)
Q04DA7 1.07e-13 76 27 9 229 3 metN2 Methionine import ATP-binding protein MetN 2 Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
Q88CL2 1.13e-13 75 27 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q74I62 1.15e-13 77 22 19 532 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
Q74I62 5.35e-11 68 26 7 200 3 LJ_1704 Putative ABC transporter ATP-binding protein LJ_1704 Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
A1TXH7 1.18e-13 76 28 4 218 3 potA Spermidine/putrescine import ATP-binding protein PotA Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q832Y6 1.19e-13 76 24 5 211 3 metN1 Methionine import ATP-binding protein MetN 1 Enterococcus faecalis (strain ATCC 700802 / V583)
Q0K9I2 1.2e-13 75 30 6 203 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q2J3T0 1.27e-13 74 27 6 241 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q2J3T0 0.000654 45 27 8 200 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain HaA2)
Q6N7Y6 1.3e-13 74 29 10 243 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q6N7Y6 3.01e-08 58 28 8 206 3 hmuV Hemin import ATP-binding protein HmuV Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
Q8PY26 1.33e-13 75 30 8 213 3 MM_1038 Putative ABC transporter ATP-binding protein MM_1038 Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q8D653 1.44e-13 75 27 7 231 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Vibrio vulnificus (strain CMCP6)
Q7N0N3 1.45e-13 73 25 6 229 3 plu3849 Putative ABC transporter ATP-binding protein plu3849 Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
Q885N4 1.48e-13 74 31 7 202 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q2SRI1 1.49e-13 76 27 7 210 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Mycoplasma capricolum subsp. capricolum (strain California kid / ATCC 27343 / NCTC 10154)
Q6HPN0 1.53e-13 74 34 6 172 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis subsp. konkukian (strain 97-27)
Q81VQ2 1.53e-13 74 34 6 172 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus anthracis
A0R8K8 1.53e-13 74 34 6 172 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus thuringiensis (strain Al Hakam)
Q2YXZ0 1.56e-13 73 29 5 191 3 nikE Nickel import system ATP-binding protein NikE Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q63H62 1.56e-13 74 34 6 172 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ZK / E33L)
Q8XIZ5 1.74e-13 75 26 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain 13 / Type A)
Q0TNZ3 1.74e-13 75 26 6 219 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q8DQY5 1.77e-13 77 27 7 228 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8DQY5 1.46e-08 61 22 21 533 3 spr0430 Putative ABC transporter ATP-binding protein spr0430 Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q8FJ95 1.79e-13 73 31 7 201 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q71WH7 1.82e-13 74 33 5 154 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serotype 4b (strain F2365)
Q576K0 1.86e-13 74 27 5 244 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q576K0 8.63e-12 69 30 6 181 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus biovar 1 (strain 9-941)
Q2YJH4 1.86e-13 74 27 5 244 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q2YJH4 8.63e-12 69 30 6 181 3 znuC Zinc import ATP-binding protein ZnuC Brucella abortus (strain 2308)
Q2NHA1 1.87e-13 74 30 7 220 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanosphaera stadtmanae (strain ATCC 43021 / DSM 3091 / JCM 11832 / MCB-3)
Q97KS6 1.89e-13 75 27 4 220 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q97KS6 0.000494 46 26 9 183 3 potA Spermidine/putrescine import ATP-binding protein PotA Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8DY60 1.89e-13 76 28 8 220 3 SAG1633 Putative ABC transporter ATP-binding protein SAG1633 Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q7A7E3 1.9e-13 75 26 6 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain N315)
Q99WE1 1.9e-13 75 26 6 211 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q927N8 1.93e-13 74 33 5 154 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q8Y454 1.98e-13 74 33 5 154 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P38046 2.09e-13 74 34 5 175 1 nrtD Nitrate import ATP-binding protein NrtD Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q55740 2.1e-13 74 30 5 211 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q55740 4.59e-06 52 36 0 71 3 sll0385 Putative ABC transporter ATP-binding protein sll0385 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q4FU75 2.17e-13 76 30 11 252 3 macB Macrolide export ATP-binding/permease protein MacB Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
Q8E3S0 2.18e-13 75 28 9 239 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype III (strain NEM316)
Q1BR30 2.31e-13 75 29 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia orbicola (strain AU 1054)
A0B344 2.31e-13 75 29 7 233 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia cenocepacia (strain HI2424)
Q1QSE9 2.31e-13 73 28 6 224 3 pstB2 Phosphate import ATP-binding protein PstB 2 Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
Q0S0Z3 2.32e-13 75 32 5 186 3 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Rhodococcus jostii (strain RHA1)
Q73F67 2.33e-13 74 34 6 172 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q8R7Y4 2.35e-13 74 29 7 193 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
Q737I0 2.35e-13 76 28 9 222 3 BCE_2668 Putative ABC transporter ATP-binding protein BCE_2668 Bacillus cereus (strain ATCC 10987 / NRS 248)
P37774 2.37e-13 73 27 8 222 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
P37774 1.7e-05 50 23 6 210 1 tcyN L-cystine transport system ATP-binding protein TcyN Escherichia coli (strain K12)
Q1IGY7 2.38e-13 73 28 7 235 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q1IGY7 1.88e-07 56 26 9 213 3 znuC Zinc import ATP-binding protein ZnuC Pseudomonas entomophila (strain L48)
Q48FT0 2.38e-13 73 31 7 202 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q73KK2 2.45e-13 76 27 5 220 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q81CT8 2.48e-13 76 28 8 219 3 BC_2655 Putative ABC transporter ATP-binding protein BC_2655 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q6F9A8 2.53e-13 75 26 5 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
Q1CDR0 2.58e-13 73 29 7 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Nepal516)
Q74PI5 2.58e-13 73 29 7 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis
Q1C1S0 2.58e-13 73 29 7 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pestis bv. Antiqua (strain Antiqua)
Q6LR20 2.6e-13 75 29 5 196 3 potA Spermidine/putrescine import ATP-binding protein PotA Photobacterium profundum (strain SS9)
O31711 2.66e-13 73 28 7 215 1 yknY Uncharacterized ABC transporter ATP-binding protein YknY Bacillus subtilis (strain 168)
Q31DV4 2.79e-13 73 32 2 165 3 phnC Phosphonates import ATP-binding protein PhnC Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
A0AGP9 2.83e-13 75 25 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
A0AGP9 0.000284 47 26 9 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q13LD8 2.95e-13 75 28 7 204 3 metN2 Methionine import ATP-binding protein MetN 2 Paraburkholderia xenovorans (strain LB400)
Q9K789 2.97e-13 74 25 6 251 3 metN Methionine import ATP-binding protein MetN Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
Q832R5 2.99e-13 76 29 8 201 3 EF_2153 Putative ABC transporter ATP-binding protein EF_2153 Enterococcus faecalis (strain ATCC 700802 / V583)
Q88XV1 3.06e-13 73 30 6 214 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
Q6AE21 3.13e-13 74 27 7 211 3 metN Methionine import ATP-binding protein MetN Leifsonia xyli subsp. xyli (strain CTCB07)
Q8NY21 3.28e-13 74 26 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MW2)
Q6GC27 3.28e-13 74 26 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain MSSA476)
P24693 3.29e-13 73 31 8 190 3 lptB Lipopolysaccharide export system ATP-binding protein LptB Acidithiobacillus ferridurans
Q084V3 3.33e-13 73 27 6 245 3 pstB Phosphate import ATP-binding protein PstB Shewanella frigidimarina (strain NCIMB 400)
Q5HIL5 3.37e-13 74 26 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain COL)
Q2G0V2 3.37e-13 74 26 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJI0 3.37e-13 74 26 5 200 3 metN1 Methionine import ATP-binding protein MetN 1 Staphylococcus aureus (strain USA300)
Q6LX68 3.42e-13 73 29 7 222 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q6LX68 0.000695 45 21 5 204 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanococcus maripaludis (strain DSM 14266 / JCM 13030 / NBRC 101832 / S2 / LL)
Q92DL6 3.42e-13 74 25 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q92DL6 0.000367 46 26 9 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
Q39IE7 3.46e-13 74 28 13 335 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39IE7 5.19e-05 49 24 9 217 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8A1M1 3.55e-13 72 30 7 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides thetaiotaomicron (strain ATCC 29148 / DSM 2079 / JCM 5827 / CCUG 10774 / NCTC 10582 / VPI-5482 / E50)
Q83F44 3.57e-13 74 26 3 228 3 metN Methionine import ATP-binding protein MetN Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
Q722B1 3.64e-13 74 25 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q722B1 3.45e-05 50 27 9 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serotype 4b (strain F2365)
Q9Z8J5 3.67e-13 73 30 6 207 3 CPn_0348 Probable metal transport system ATP-binding protein CPn_0348/CP_0412/CPj0348/CpB0355 Chlamydia pneumoniae
Q8D385 3.69e-13 72 26 3 164 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q8D385 3.45e-08 58 29 8 162 3 znuC Zinc import ATP-binding protein ZnuC Wigglesworthia glossinidia brevipalpis
Q3YSK9 3.74e-13 72 30 6 186 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia canis (strain Jake)
Q2LVM2 3.81e-13 72 30 10 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Syntrophus aciditrophicus (strain SB)
Q0RYP7 3.89e-13 74 30 5 186 3 fbpC3 Fe(3+) ions import ATP-binding protein FbpC 3 Rhodococcus jostii (strain RHA1)
Q63GR8 3.9e-13 74 26 9 280 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ZK / E33L)
Q92WJ0 3.98e-13 74 30 7 215 3 fbpC1 Fe(3+) ions import ATP-binding protein FbpC 1 Rhizobium meliloti (strain 1021)
Q97SA3 4.04e-13 75 26 7 228 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q97SA3 9.14e-09 62 22 21 530 3 SP_0483 Putative ABC transporter ATP-binding protein SP_0483 Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
O34338 4.08e-13 72 32 8 195 2 mntB Manganese transport system ATP-binding protein MntB Bacillus subtilis (strain 168)
Q032H3 4.43e-13 73 30 10 222 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Lactococcus lactis subsp. cremoris (strain SK11)
Q1IGZ0 4.51e-13 74 30 10 233 3 metN2 Methionine import ATP-binding protein MetN 2 Pseudomonas entomophila (strain L48)
Q0BH79 4.59e-13 74 27 13 335 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q0BH79 6.79e-06 52 24 6 208 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
Q1CI46 4.6e-13 72 29 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q1CI46 0.000672 45 23 4 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Nepal516)
Q8ZFR4 4.6e-13 72 29 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q8ZFR4 0.000672 45 23 4 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis
Q1C6Q8 4.6e-13 72 29 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q1C6Q8 0.000672 45 23 4 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pestis bv. Antiqua (strain Antiqua)
Q39AT4 4.8e-13 74 29 6 205 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q39AT4 0.00073 45 24 6 218 3 metN2 Methionine import ATP-binding protein MetN 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q8G5P8 5.02e-13 74 28 5 199 3 metN Methionine import ATP-binding protein MetN Bifidobacterium longum (strain NCC 2705)
Q5WDP1 5.17e-13 73 26 6 243 3 metN3 Methionine import ATP-binding protein MetN 3 Shouchella clausii (strain KSM-K16)
Q8T664 5.28e-13 75 26 10 269 3 abcH2 ABC transporter H family member 2 Dictyostelium discoideum
Q9I6L0 5.31e-13 73 28 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P15031 5.32e-13 72 34 5 170 1 fecE Fe(3+) dicitrate transport ATP-binding protein FecE Escherichia coli (strain K12)
Q5HCL3 5.54e-13 75 28 7 199 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q5HCL3 1.64e-07 57 20 16 530 3 SACOL2708 Putative ABC transporter ATP-binding protein SACOL2708 Staphylococcus aureus (strain COL)
Q73R11 5.58e-13 75 26 6 225 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73R11 6.85e-09 62 27 7 190 3 TDE_0282 Putative ABC transporter ATP-binding protein TDE_0282 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q9JZW0 5.7e-13 73 28 8 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q4KFA2 5.74e-13 72 31 8 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q4KFA2 2.93e-05 49 28 8 183 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q8FZV2 5.87e-13 72 31 5 217 3 BR1368 Putative ABC transporter ATP-binding protein BR1368/BS1330_I1363 Brucella suis biovar 1 (strain 1330)
Q6D5H7 5.93e-13 73 26 4 200 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q6D5H7 9.06e-07 54 24 9 226 3 metN1 Methionine import ATP-binding protein MetN 1 Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q99QV7 6e-13 75 28 7 199 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q99QV7 1.8e-07 57 20 16 530 3 SAV2684 Putative ABC transporter ATP-binding protein SAV2684 Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q7A342 6e-13 75 28 7 199 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q7A342 1.8e-07 57 20 16 530 3 SA2476 Putative ABC transporter ATP-binding protein SA2476 Staphylococcus aureus (strain N315)
Q8FUU5 6.12e-13 73 27 5 244 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q8FUU5 3.21e-11 68 30 6 181 3 znuC Zinc import ATP-binding protein ZnuC Brucella suis biovar 1 (strain 1330)
Q83RS0 6.12e-13 72 30 9 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q83RS0 2.99e-06 52 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella flexneri
Q47C66 6.16e-13 72 32 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
Q47C66 1.59e-06 53 27 5 193 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Dechloromonas aromatica (strain RCB)
P10346 6.19e-13 72 29 7 217 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
P10346 2.61e-05 49 24 8 202 1 glnQ Glutamine transport ATP-binding protein GlnQ Escherichia coli (strain K12)
Q3BV68 6.38e-13 72 26 8 248 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q4ZZR8 6.5e-13 73 30 10 233 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas syringae pv. syringae (strain B728a)
Q4KKK8 6.56e-13 73 28 12 308 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q81J16 6.79e-13 72 33 6 172 3 ecfA1 Energy-coupling factor transporter ATP-binding protein EcfA1 Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q8X8E3 6.86e-13 72 31 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8X8E3 2.21e-05 49 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Escherichia coli O157:H7
Q8PM59 6.87e-13 72 26 8 248 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas axonopodis pv. citri (strain 306)
O68106 6.92e-13 72 28 5 225 1 cbiO Cobalt import ATP-binding protein CbiO Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q58488 6.96e-13 72 28 8 223 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q58488 2.18e-05 50 23 8 208 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q8Y0X3 7.14e-13 73 31 8 232 3 metN Methionine import ATP-binding protein MetN Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q6CYU2 7.24e-13 72 33 5 186 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q31ZH4 7.26e-13 72 30 9 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q31ZH4 9.56e-06 50 27 10 225 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shigella boydii serotype 4 (strain Sb227)
Q8K9M6 7.58e-13 72 31 7 244 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q8K9M6 2.04e-05 49 28 6 178 3 znuC Zinc import ATP-binding protein ZnuC Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q2JGF5 7.63e-13 73 30 5 205 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Frankia casuarinae (strain DSM 45818 / CECT 9043 / HFP020203 / CcI3)
Q2RS22 7.65e-13 72 29 6 231 3 nikE Nickel import ATP-binding protein NikE Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q5HBR8 7.79e-13 72 27 4 185 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Welgevonden)
Q5FHB0 7.79e-13 72 27 4 185 3 znuC Zinc import ATP-binding protein ZnuC Ehrlichia ruminantium (strain Gardel)
Q0A8P9 7.84e-13 72 31 7 211 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
Q5WBL0 8.03e-13 72 28 7 219 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
Q5WBL0 0.000358 46 24 5 189 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Shouchella clausii (strain KSM-K16)
A3CRB8 8.07e-13 72 28 10 226 3 ecfA2 Energy-coupling factor transporter ATP-binding protein EcfA2 Streptococcus sanguinis (strain SK36)
Q665B6 8.12e-13 72 28 7 209 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Yersinia pseudotuberculosis serotype I (strain IP32953)
Q47MA5 8.13e-13 72 27 6 248 3 hmuV Hemin import ATP-binding protein HmuV Thermobifida fusca (strain YX)
Q9JUX4 8.57e-13 73 28 8 246 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q73P93 8.65e-13 74 29 6 212 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
Q73P93 9.5e-09 61 27 5 193 3 TDE_0906 Putative ABC transporter ATP-binding protein TDE_0906 Treponema denticola (strain ATCC 35405 / DSM 14222 / CIP 103919 / JCM 8153 / KCTC 15104)
P44513 8.66e-13 73 33 4 168 1 fbpC2 Fe(3+) ions import ATP-binding protein FbpC 2 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q65T42 8.79e-13 73 28 5 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
Q4QK57 9.06e-13 73 27 5 212 3 potA Spermidine/putrescine import ATP-binding protein PotA Haemophilus influenzae (strain 86-028NP)
Q89UD2 9.08e-13 73 31 5 214 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q89UD2 0.000127 48 24 5 209 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Bradyrhizobium diazoefficiens (strain JCM 10833 / BCRC 13528 / IAM 13628 / NBRC 14792 / USDA 110)
Q3KK97 9.19e-13 73 29 11 255 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas fluorescens (strain Pf0-1)
Q0RT43 9.26e-13 72 31 5 205 3 ssuB1 Aliphatic sulfonates import ATP-binding protein SsuB 1 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q8UH62 9.32e-13 73 29 6 202 3 cysA1 Sulfate/thiosulfate import ATP-binding protein CysA 1 Agrobacterium fabrum (strain C58 / ATCC 33970)
Q39LW7 9.33e-13 72 32 6 180 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q6D8T5 9.45e-13 74 29 6 214 3 macB Macrolide export ATP-binding/permease protein MacB Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7A169 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MW2)
Q6GAB5 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MSSA476)
Q6GHY6 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain MRSA252)
Q7A679 9.71e-13 73 27 5 228 1 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain N315)
Q99V03 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q5HGY5 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain COL)
Q2YX74 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q2G2A7 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHY1 9.71e-13 73 27 5 228 3 potA Spermidine/putrescine import ATP-binding protein PotA Staphylococcus aureus (strain USA300)
Q8DY54 9.92e-13 73 27 9 239 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3JZP8 9.92e-13 73 27 9 239 3 metN Methionine import ATP-binding protein MetN Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
Q8ENU2 9.96e-13 73 25 11 328 3 metN2 Methionine import ATP-binding protein MetN 2 Oceanobacillus iheyensis (strain DSM 14371 / CIP 107618 / JCM 11309 / KCTC 3954 / HTE831)
P37494 1.01e-12 71 27 5 190 3 yybJ Uncharacterized ABC transporter ATP-binding protein YybJ Bacillus subtilis (strain 168)
Q7VZ31 1.01e-12 71 30 7 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W8T0 1.01e-12 71 30 7 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WK40 1.01e-12 71 30 7 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
Q7UPK3 1.01e-12 72 30 9 224 3 lolD2 Lipoprotein-releasing system ATP-binding protein LolD 2 Rhodopirellula baltica (strain DSM 10527 / NCIMB 13988 / SH1)
Q4QP85 1.03e-12 73 33 4 168 3 fbpC Fe(3+) ions import ATP-binding protein FbpC Haemophilus influenzae (strain 86-028NP)
Q2S3A3 1.07e-12 72 31 7 206 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q2S3A3 0.000324 46 28 5 185 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Salinibacter ruber (strain DSM 13855 / M31)
Q8NUH8 1.09e-12 74 28 7 199 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q8NUH8 7.98e-07 55 20 16 530 3 MW2603 Putative ABC transporter ATP-binding protein MW2603 Staphylococcus aureus (strain MW2)
Q6G5Z1 1.09e-12 74 28 7 199 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q6G5Z1 7.98e-07 55 20 16 530 3 SAS2569 Putative ABC transporter ATP-binding protein SAS2569 Staphylococcus aureus (strain MSSA476)
Q8VNL9 1.1e-12 72 27 7 215 3 ecfA Energy-coupling factor transporter ATP-binding protein EcfA Enterococcus faecium
Q2YQP3 1.11e-12 71 31 5 217 3 BAB1_1388 Putative ABC transporter ATP-binding protein BAB1_1388 Brucella abortus (strain 2308)
Q57CD8 1.11e-12 71 31 5 217 3 BruAb1_1365 Putative ABC transporter ATP-binding protein BruAb1_1365 Brucella abortus biovar 1 (strain 9-941)
Q8Y8T6 1.12e-12 73 24 5 205 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q8Y8T6 3.16e-05 50 27 9 188 3 potA Spermidine/putrescine import ATP-binding protein PotA Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q73EL7 1.12e-12 73 25 9 280 3 metN2 Methionine import ATP-binding protein MetN 2 Bacillus cereus (strain ATCC 10987 / NRS 248)
Q63S19 1.13e-12 73 27 13 335 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain K96243)
Q3JPZ4 1.13e-12 73 27 13 335 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia pseudomallei (strain 1710b)
Q62M41 1.13e-12 73 27 13 335 3 metN1 Methionine import ATP-binding protein MetN 1 Burkholderia mallei (strain ATCC 23344)
Q8XZP8 1.15e-12 73 28 6 207 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q0HJG0 1.15e-12 71 29 9 204 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella sp. (strain MR-4)
Q9AT00 1.16e-12 73 27 6 233 1 TGD3 Protein TRIGALACTOSYLDIACYLGLYCEROL 3, chloroplastic Arabidopsis thaliana
Q9G4F5 1.17e-12 73 28 6 223 3 CYSA Sulfate/thiosulfate import ATP-binding protein cysA Cucumis sativus
Q97KD5 1.2e-12 72 27 8 244 3 metN Methionine import ATP-binding protein MetN Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q5NN23 1.21e-12 71 31 9 217 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
Q669P3 1.22e-12 71 29 7 209 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q669P3 0.000654 45 23 4 194 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Yersinia pseudotuberculosis serotype I (strain IP32953)
Q56342 1.22e-12 73 25 5 221 3 mglA Galactose/methyl galactoside import ATP-binding protein MglA Treponema pallidum (strain Nichols)
Q8X5I6 1.25e-12 71 30 7 239 3 tauB Taurine import ATP-binding protein TauB Escherichia coli O157:H7
Q5H002 1.25e-12 72 26 8 248 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q2P2Y5 1.25e-12 72 26 8 248 3 pstB Phosphate import ATP-binding protein PstB Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q2K6Q4 1.27e-12 72 31 3 173 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q2K6Q4 5.9e-05 48 27 7 212 3 znuC Zinc import ATP-binding protein ZnuC Rhizobium etli (strain ATCC 51251 / DSM 11541 / JCM 21823 / NBRC 15573 / CFN 42)
Q8ZR89 1.28e-12 72 27 5 198 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q9KQB8 1.33e-12 71 30 4 185 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9KQB8 7e-10 63 32 6 173 3 znuC Zinc import ATP-binding protein ZnuC Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q48PU6 1.35e-12 72 31 9 207 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
Q5LI72 1.37e-12 70 30 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain ATCC 25285 / DSM 2151 / CCUG 4856 / JCM 11019 / LMG 10263 / NCTC 9343 / Onslow / VPI 2553 / EN-2)
Q13GD4 1.37e-12 71 30 5 214 3 ssuB3 Aliphatic sulfonates import ATP-binding protein SsuB 3 Paraburkholderia xenovorans (strain LB400)
Q57S53 1.38e-12 72 27 5 198 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella choleraesuis (strain SC-B67)
P39459 1.39e-12 71 32 8 182 3 nasD Nitrate transport protein NasD Klebsiella oxytoca
O29527 1.4e-12 72 28 6 215 3 AF_0731 Putative ABC transporter ATP-binding protein AF_0731 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
P0AAI1 1.41e-12 71 31 5 199 1 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli (strain K12)
P0AAI2 1.41e-12 71 31 5 199 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Escherichia coli O157:H7
Q28VL7 1.42e-12 70 30 8 222 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q28VL7 1.4e-05 50 24 8 198 3 thiQ Thiamine import ATP-binding protein ThiQ Jannaschia sp. (strain CCS1)
Q9I1C8 1.43e-12 73 28 5 207 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9I1C8 3.37e-06 53 25 8 232 3 metN1 Methionine import ATP-binding protein MetN 1 Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8Z8R5 1.46e-12 72 27 5 198 3 metN2 Methionine import ATP-binding protein MetN 2 Salmonella typhi
Q0RKH4 1.47e-12 71 32 6 203 3 ssuB2 Aliphatic sulfonates import ATP-binding protein SsuB 2 Frankia alni (strain DSM 45986 / CECT 9034 / ACN14a)
Q64Z80 1.47e-12 70 30 8 210 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Bacteroides fragilis (strain YCH46)
Q0BTP1 1.51e-12 72 27 7 208 3 pstB Phosphate import ATP-binding protein PstB Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
Q12NL5 1.51e-12 70 29 10 219 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q2SVN0 1.57e-12 72 33 6 180 3 ssuB Aliphatic sulfonates import ATP-binding protein SsuB Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q32IZ6 1.57e-12 71 29 8 240 3 tauB Taurine import ATP-binding protein TauB Shigella dysenteriae serotype 1 (strain Sd197)
Q93DX8 1.58e-12 71 29 6 217 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA (Fragment) Burkholderia cepacia
Q5NHP2 1.59e-12 70 28 8 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q2A4V5 1.59e-12 70 28 8 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. holarctica (strain LVS)
Q14J44 1.59e-12 70 28 8 208 3 lolD Lipoprotein-releasing system ATP-binding protein LolD Francisella tularensis subsp. tularensis (strain FSC 198)
Q8F6Z1 1.6e-12 72 29 6 215 3 cysA Sulfate/thiosulfate import ATP-binding protein CysA Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS05350
Feature type CDS
Gene -
Product ABC-F family ATP-binding cassette domain-containing protein
Location 1134081 - 1135832 (strand: 1)
Length 1752 (nucleotides) / 583 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_762
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00005 ABC transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0488 General function prediction only (R) R ATPase components of ABC transporters with duplicated ATPase domains

Protein Sequence

MSTLLSTRNLSFHPGHTPLLTDISVALNQGEKIGLIGHNGCGKSTLMKLLSGQLMPDEGTVTPANRVIVAYIEQHLPESLQSVTLIDAVLEKLPAELRVSDMWRAEMLLTETGFDSAQWSLPLSALSGGQHTRLLLARALIINPDLLLLDEPSNHLDLPTILWLEQFLVSWRGSFILVSHDNTLLDHVTNCTWILRDGTISVFRLPCSQAREALVAQDESDEHRHSAQQKEIDRIAQSAKRLAIWGKVYDNEALSRKAKQMEKQVGRLQDDQVELSAGSQWQLKLTGDALRADRLCAFNQLAVIPADNCPPLYVTDNLSVKSGDRIAVTGANGTGKSSLLRMIWAQSQQENVTLPDSPLVLHPRVHLGYYDQKLAQLNDTDSLMDALKPFAPLIDEQRKMALIGAGFPYLRHQQTVGSLSGGERARLLFVGLSLAKYSLLMLDEPTNHLDMDGKSALADEISRFAGGLMLVSHDRELIEKSCNRFWYIDGSRLTEYHDLDQVYDAIRHLNADQSPDAVTQSLAATGETTEVADDEEKKLAALIALEERLAADVQRKPGHQKPALQQQWQAEIATLRAQLGLDE

Flanking regions ( +/- flanking 50bp)

TATCGCTTTTATGACCCAGGGCGTTGTTACGCCAAAAATTTGAGTAAGCTATGAGTACATTATTATCAACCCGTAATCTGTCATTCCACCCCGGTCACACACCCCTGTTAACCGATATTTCTGTTGCCCTGAATCAGGGAGAGAAAATTGGCCTGATTGGTCATAACGGTTGCGGAAAAAGTACCCTGATGAAATTATTATCCGGACAATTAATGCCGGATGAAGGCACTGTCACACCGGCAAACCGCGTGATAGTGGCCTATATTGAGCAACATCTGCCTGAATCATTACAGTCTGTGACACTAATTGATGCGGTACTGGAAAAACTGCCTGCGGAGCTGCGTGTCTCTGACATGTGGCGGGCGGAAATGTTACTAACCGAAACCGGTTTTGACAGCGCACAGTGGTCTTTGCCGCTTTCCGCACTGAGCGGCGGGCAGCATACCCGTTTGTTACTGGCGCGGGCGCTGATTATCAATCCGGATTTGCTGCTGCTGGATGAACCAAGTAACCATCTCGATTTACCGACTATTCTGTGGCTGGAGCAGTTTTTGGTAAGCTGGCGCGGCAGTTTTATCCTGGTATCTCACGATAATACCCTGCTCGACCATGTAACAAACTGCACCTGGATATTGCGTGACGGCACTATTTCTGTGTTCCGGCTACCTTGTTCACAAGCGCGGGAAGCGCTCGTTGCACAGGATGAAAGTGATGAGCATCGTCACAGTGCGCAGCAAAAAGAGATAGACCGCATAGCGCAGAGTGCAAAACGTCTGGCTATCTGGGGAAAAGTGTATGATAACGAAGCACTTTCCCGTAAAGCCAAACAAATGGAAAAACAGGTCGGACGTTTGCAGGATGATCAGGTTGAACTGTCAGCCGGCAGTCAGTGGCAACTGAAACTGACCGGCGATGCCCTGCGGGCAGATCGTCTCTGTGCATTTAATCAGTTAGCCGTTATCCCGGCCGATAATTGCCCACCGCTGTATGTAACGGATAATTTATCGGTGAAAAGTGGCGACCGCATCGCTGTTACGGGTGCAAACGGCACAGGGAAATCCTCATTGCTGCGAATGATTTGGGCGCAGTCACAGCAGGAGAATGTCACCTTACCCGACAGCCCGCTGGTACTGCATCCACGGGTTCATTTGGGTTATTACGACCAGAAACTGGCGCAACTGAATGATACTGATTCATTAATGGATGCACTAAAACCGTTTGCTCCGCTGATTGATGAACAGCGGAAAATGGCCTTGATCGGCGCAGGATTTCCCTATCTGCGCCACCAGCAAACTGTCGGCTCACTGAGCGGTGGTGAACGGGCACGACTGCTGTTTGTCGGGTTAAGCCTGGCGAAATATTCGCTTCTGATGCTGGATGAACCGACCAACCATCTGGATATGGACGGTAAATCCGCGCTGGCAGATGAAATCAGCCGGTTTGCCGGTGGTTTGATGCTGGTCAGCCATGACCGGGAACTGATTGAAAAAAGCTGTAACCGGTTTTGGTACATCGACGGCTCACGGCTGACCGAGTATCACGATTTGGATCAGGTTTATGATGCTATCCGGCATCTGAATGCTGATCAGTCCCCGGATGCAGTAACACAGTCACTTGCCGCAACAGGTGAAACGACCGAGGTTGCAGATGATGAAGAGAAAAAACTGGCGGCGCTGATCGCGCTGGAAGAAAGGCTTGCTGCCGATGTACAGCGCAAACCCGGACACCAGAAACCCGCACTTCAGCAGCAATGGCAGGCAGAAATTGCCACTTTGCGTGCACAATTAGGGTTAGATGAGTAATTAAGTAAGGCGGATATCTTTCGGTATCCGCTTTTTCTTTTCTCTTATTT