Homologs in group_2266

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17065 FBDBKF_17065 100.0 Morganella morganii S1 dusA tRNA dihydrouridine(20/20a) synthase DusA
EHELCC_16525 EHELCC_16525 100.0 Morganella morganii S2 dusA tRNA dihydrouridine(20/20a) synthase DusA
NLDBIP_16735 NLDBIP_16735 100.0 Morganella morganii S4 dusA tRNA dihydrouridine(20/20a) synthase DusA
LHKJJB_16735 LHKJJB_16735 100.0 Morganella morganii S3 dusA tRNA dihydrouridine(20/20a) synthase DusA
F4V73_RS18545 F4V73_RS18545 90.8 Morganella psychrotolerans dusA tRNA dihydrouridine(20/20a) synthase DusA
PMI_RS13500 PMI_RS13500 79.7 Proteus mirabilis HI4320 dusA tRNA dihydrouridine(20/20a) synthase DusA

Distribution of the homologs in the orthogroup group_2266

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2266

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P32695 0.0 563 77 0 344 1 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli (strain K12)
Q8X5V6 0.0 563 77 0 344 3 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli O157:H7
Q8FB30 0.0 558 81 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7UBC5 0.0 557 81 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Shigella flexneri
Q8Z1T1 0.0 548 80 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Salmonella typhi
Q8ZKH4 0.0 545 80 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZJ14 0.0 533 77 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Yersinia pestis
Q87L85 0.0 519 73 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9KUX9 0.0 514 75 0 312 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q8CWK7 0.0 512 73 0 312 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio vulnificus (strain CMCP6)
Q9CL29 2.05e-179 503 74 1 315 3 dusA tRNA-dihydrouridine(20/20a) synthase Pasteurella multocida (strain Pm70)
P44794 4.22e-169 476 70 1 315 3 dusA tRNA-dihydrouridine(20/20a) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8EAJ0 3.84e-167 472 69 2 320 3 dusA tRNA-dihydrouridine(20/20a) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q7VNV2 5.01e-163 461 68 1 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q9I048 1.27e-137 397 61 2 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q884G7 1.18e-133 387 62 2 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88KX0 1.57e-132 384 59 2 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P72872 6.17e-123 360 55 2 317 3 dus2 tRNA-dihydrouridine(20/20a) synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8P3X4 3.99e-109 325 52 3 323 3 dusA tRNA-dihydrouridine(20/20a) synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PFF8 9.27e-104 311 53 3 323 3 dusA tRNA-dihydrouridine(20/20a) synthase Xanthomonas axonopodis pv. citri (strain 306)
Q87AY2 1.43e-97 295 52 2 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PGB5 7.86e-94 286 50 2 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Xylella fastidiosa (strain 9a5c)
Q5SMC7 1.32e-87 270 45 6 317 1 dus tRNA-dihydrouridine(20/20a) synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1RH84 1.38e-24 105 29 11 310 3 dus Probable tRNA-dihydrouridine synthase Rickettsia bellii (strain RML369-C)
Q9HUW1 3.52e-24 104 27 11 315 3 dusB tRNA-dihydrouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8PCH1 2.29e-23 102 27 12 330 3 dusB tRNA-dihydrouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P44965 6.94e-23 100 29 8 255 3 dusB tRNA-dihydrouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q92JQ6 1.66e-22 99 29 7 244 3 dus Probable tRNA-dihydrouridine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q8PP72 3.96e-22 98 26 12 330 3 dusB tRNA-dihydrouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
Q9ZED2 8.33e-22 97 30 7 240 3 dus Probable tRNA-dihydrouridine synthase Rickettsia prowazekii (strain Madrid E)
Q4UNJ4 8.42e-22 97 29 7 244 3 dus Probable tRNA-dihydrouridine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P45672 2.54e-21 96 30 6 237 3 dus Probable tRNA-dihydrouridine synthase Azospirillum brasilense
Q87KU1 3.91e-21 95 26 10 302 3 dusB tRNA-dihydrouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9CLW3 1.73e-20 94 26 11 312 3 dusB tRNA-dihydrouridine synthase B Pasteurella multocida (strain Pm70)
Q68XZ3 1.74e-20 94 29 7 240 3 dus Probable tRNA-dihydrouridine synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q7VNP2 1.8e-20 94 28 9 253 3 dusB tRNA-dihydrouridine synthase B Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q08111 2.01e-20 93 31 7 250 3 dus Probable tRNA-dihydrouridine synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
O52533 1.11e-18 89 25 8 334 3 dusB tRNA-dihydrouridine synthase B Proteus vulgaris
Q87VS1 6.62e-18 86 27 11 307 3 dusB tRNA-dihydrouridine synthase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q8CWL2 1.04e-17 85 27 11 302 3 dusB tRNA-dihydrouridine synthase B Vibrio vulnificus (strain CMCP6)
Q55724 1.1e-17 86 25 10 316 3 dus1 Probable tRNA-dihydrouridine synthase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0A2R6 1.95e-17 85 27 8 252 3 dusB tRNA-dihydrouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2R7 1.95e-17 85 27 8 252 3 dusB tRNA-dihydrouridine synthase B Salmonella typhi
P0ABT5 4.48e-17 84 27 8 252 1 dusB tRNA-dihydrouridine synthase B Escherichia coli (strain K12)
P0ABT6 4.48e-17 84 27 8 252 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABT7 4.48e-17 84 27 8 252 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O157:H7
Q88DK5 5.85e-17 84 27 7 251 3 dusB tRNA-dihydrouridine synthase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q9KV66 4.4e-16 81 27 6 251 3 dusB tRNA-dihydrouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q83PZ5 5.23e-16 81 26 8 252 3 dusB tRNA-dihydrouridine synthase B Shigella flexneri
O52536 5.54e-16 80 25 10 308 3 dusB tRNA-dihydrouridine synthase B Klebsiella pneumoniae
P41504 1.27e-15 80 27 7 234 3 dus Probable tRNA-dihydrouridine synthase Rhizobium leguminosarum bv. phaseoli
Q9HGN6 2.29e-15 80 26 10 243 1 dus1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
O52539 2.74e-15 79 24 8 253 3 dusB tRNA-dihydrouridine synthase B Pectobacterium carotovorum
Q8EJR8 3.04e-15 79 26 12 330 3 dusB tRNA-dihydrouridine synthase B Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P37567 4.98e-15 78 28 8 239 3 dus1 Probable tRNA-dihydrouridine synthase 1 Bacillus subtilis (strain 168)
O95620 1.04e-14 77 25 12 296 1 DUS4L tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Homo sapiens
Q8ZAX7 1.57e-14 76 26 8 251 3 dusB tRNA-dihydrouridine synthase B Yersinia pestis
O67533 3.1e-14 75 27 17 309 3 dus Probable tRNA-dihydrouridine synthase Aquifex aeolicus (strain VF5)
Q884C6 1.21e-13 74 30 6 193 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q32M08 1.42e-13 73 25 12 296 2 Dus4l tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Mus musculus
Q8EFG7 1.97e-13 73 27 7 244 3 dusC tRNA-dihydrouridine(16) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
P67717 4.04e-13 72 25 9 244 1 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain N315)
P67716 4.04e-13 72 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8C2P3 7.59e-13 72 22 8 284 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Mus musculus
Q6P1R4 7.7e-13 72 23 7 274 1 DUS1L tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Homo sapiens
Q9HZ95 8.75e-13 71 31 6 191 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q50049 1.62e-12 71 26 7 282 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium leprae (strain TN)
Q9CJW1 1.85e-12 70 26 11 322 3 dusC tRNA-dihydrouridine(16) synthase Pasteurella multocida (strain Pm70)
P9WNS7 1.88e-12 71 27 8 311 1 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNS6 1.88e-12 71 27 8 311 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q3KRC5 2.01e-12 71 27 4 192 2 Dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Rattus norvegicus
O31546 2.09e-12 70 26 11 250 3 dus2 Probable tRNA-dihydrouridine synthase 2 Bacillus subtilis (strain 168)
P44606 2.8e-12 70 24 11 316 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8K582 2.81e-12 70 22 8 284 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Rattus norvegicus
Q7UC91 3.3e-12 70 27 8 225 3 dusC tRNA-dihydrouridine(16) synthase Shigella flexneri
Q6GKK9 3.6e-12 70 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MRSA252)
Q8NYV4 3.91e-12 69 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MW2)
Q6GD38 3.91e-12 69 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MSSA476)
Q5HJT5 3.91e-12 69 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain COL)
Q8ZNM4 5.24e-12 69 27 10 288 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5B2 7.54e-12 68 28 8 226 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhi
Q8XEC6 9.03e-12 68 27 8 225 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O157:H7
P53759 1.33e-11 68 24 9 242 1 DUS1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q8FFV5 1.44e-11 68 27 8 225 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q09504 1.65e-11 67 27 8 197 3 C45G9.2 Uncharacterized tRNA-dihydrouridine synthase-like protein C45G9.2 Caenorhabditis elegans
Q88LF2 1.84e-11 67 30 6 193 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q91XI1 2.19e-11 68 27 5 192 1 Dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Mus musculus
Q9JUP6 2.76e-11 67 26 11 268 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q28BT8 3.35e-11 68 27 5 192 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus tropicalis
P33371 3.46e-11 67 27 8 225 1 dusC tRNA-dihydrouridine(16) synthase Escherichia coli (strain K12)
Q9JZL5 5.58e-11 66 25 11 274 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
O25427 9.33e-11 65 24 8 249 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain ATCC 700392 / 26695)
Q7ZWS1 1.39e-10 66 27 5 192 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus laevis
Q96G46 1.45e-10 65 25 5 192 1 DUS3L tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Homo sapiens
Q5HKD5 1.46e-10 65 24 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q87N01 1.67e-10 65 28 8 183 3 dusC tRNA-dihydrouridine(16) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q9ZLB6 3.03e-10 64 23 8 249 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain J99 / ATCC 700824)
Q9AMN9 4.13e-10 63 27 6 194 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas alcaligenes
Q8ZGV2 4.61e-10 63 26 10 288 3 dusC tRNA-dihydrouridine(16) synthase Yersinia pestis
Q8CU07 5.71e-10 63 24 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
O68273 5.79e-10 63 28 8 199 3 dusC tRNA-dihydrouridine(16) synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q8XYX1 7.66e-10 62 28 6 186 3 dusC tRNA-dihydrouridine(16) synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q7VKU5 1.21e-09 62 22 11 322 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8DAH1 1.97e-09 61 27 7 183 3 dusC tRNA-dihydrouridine(16) synthase Vibrio vulnificus (strain CMCP6)
O52532 2.56e-09 61 24 9 308 3 dusB tRNA-dihydrouridine synthase B Serratia marcescens
Q9KT00 4e-09 60 28 7 183 3 dusC tRNA-dihydrouridine(16) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0CN28 2.13e-07 56 24 9 234 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
P0CN29 2.17e-07 56 24 9 234 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
Q6CWM0 3.94e-07 55 27 6 178 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A8NZY7 9.87e-07 54 25 7 200 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
Q9T0J6 1.07e-06 53 23 7 215 1 At4g38890 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Arabidopsis thaliana
Q7XT07 1.22e-06 53 25 8 217 2 Os04g0117600 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Oryza sativa subsp. japonica
Q757E3 1.71e-06 53 27 11 248 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A7TQ73 5.5e-06 52 26 5 173 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q6FJ14 6.03e-06 51 24 9 242 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q06053 7.57e-06 51 25 6 181 1 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7A1S5 7.57e-06 51 25 6 181 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain YJM789)
Q9NX74 2.44e-05 49 26 7 190 1 DUS2 tRNA-dihydrouridine(20) synthase [NAD(P)+]-like Homo sapiens
Q54CU9 2.85e-05 49 29 4 136 3 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Dictyostelium discoideum
Q5ALL3 3.56e-05 49 25 5 175 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Candida albicans (strain SC5314 / ATCC MYA-2876)
A8PTG4 4.48e-05 48 24 6 203 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q8TT55 0.000122 47 24 7 209 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
Q6C4K3 0.000126 47 36 2 86 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Yarrowia lipolytica (strain CLIB 122 / E 150)
Q9D7B1 0.000232 46 24 6 186 1 Dus2 tRNA-dihydrouridine(20) synthase [NAD(P)+]-like Mus musculus
Q7SG01 0.00034 46 26 9 204 3 dus-3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8PW56 0.000464 45 24 8 211 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q9UTH9 0.000742 45 27 3 111 1 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_18880
Feature type CDS
Gene dusA
Product tRNA dihydrouridine(20/20a) synthase DusA
Location 22142 - 23188 (strand: 1)
Length 1047 (nucleotides) / 348 (amino acids)
In genomic island -

Contig

Accession ZDB_708
Length 23617 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2266
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01207 Dihydrouridine synthase (Dus)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0042 Translation, ribosomal structure and biogenesis (J) J tRNA-dihydrouridine synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05539 tRNA-dihydrouridine synthase A [EC:1.-.-.-] - -

Protein Sequence

MHQNTPTEKTTENQQLRTTGGYKNLNRFSVAPMLDWTDRHCRYFHRKLSRHALLYTEMVTTGAILFGKGDYLAYNEAEHPVALQLGGSDPAALAQCAKIAQERGYDEINLNVGCPSDRVQNGMFGACLMGNASLVADCVAAMRDVTDIPVTVKTRIGIDDQDSYEFLCDFVGTVADRGGCEMFVIHGRKAWLSGLSPKENREIPPLDYPRVYQLKKDFPHLTMALNGGIKTLEEAKTHLQYMDGVMVGREAYQNPSILAQVDNVLFDAALPVTDTVAAVEAMYPYIEAELATGTYLGHITRHMLGIFQGIPGARQWRRHLSENAHKAGADLRVIEAALEFVTRKNITE

Flanking regions ( +/- flanking 50bp)

TCCGCCTTTGTTTTTCTTTCTGACTGATGTACTGAGATCCCGGATACACCATGCACCAAAACACACCAACAGAAAAAACCACTGAAAACCAGCAGTTACGCACCACCGGCGGCTATAAGAACCTTAACCGTTTCTCCGTGGCACCGATGCTGGACTGGACTGATCGCCATTGCCGTTATTTTCACCGTAAACTCAGCCGCCACGCGCTGCTGTATACCGAAATGGTGACCACTGGGGCGATTCTGTTCGGGAAAGGGGATTATCTGGCGTATAACGAAGCGGAGCACCCGGTTGCATTGCAACTCGGCGGCAGTGACCCGGCGGCACTGGCTCAGTGTGCGAAAATCGCACAGGAACGCGGTTATGATGAAATCAACCTGAATGTCGGCTGTCCGTCTGACCGTGTGCAGAACGGAATGTTCGGTGCCTGTCTGATGGGGAATGCTTCATTGGTGGCGGATTGTGTCGCAGCGATGCGGGATGTGACGGATATTCCTGTTACGGTCAAAACCCGGATCGGGATTGATGATCAGGACAGTTATGAGTTTCTGTGTGATTTTGTCGGTACGGTGGCGGATCGCGGCGGTTGTGAGATGTTTGTTATTCATGGCCGTAAAGCCTGGCTCTCCGGCCTGAGCCCGAAAGAGAACCGGGAAATTCCGCCGCTGGATTACCCGCGCGTGTATCAGCTGAAAAAAGATTTTCCGCATCTGACCATGGCGCTTAACGGCGGCATTAAAACATTGGAAGAGGCGAAAACCCACCTGCAGTATATGGACGGCGTGATGGTCGGGCGTGAGGCCTATCAGAATCCGTCAATCCTGGCGCAGGTCGATAATGTGCTGTTTGATGCTGCCCTGCCGGTGACCGATACGGTCGCGGCGGTGGAAGCGATGTATCCTTATATTGAGGCGGAACTGGCGACAGGGACTTATCTCGGCCATATCACCCGCCATATGCTGGGGATTTTCCAGGGGATCCCGGGGGCGCGTCAGTGGCGTCGTCATCTGAGTGAAAATGCCCATAAAGCCGGGGCAGATCTGCGTGTGATTGAAGCGGCACTGGAATTTGTTACCCGAAAAAATATAACTGAATAATTATCAGATGAATAATGAACTCTCTGAACAGAGAGTTCATTTTGTTTCAA