Homologs in group_2266

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_17065 FBDBKF_17065 90.8 Morganella morganii S1 dusA tRNA dihydrouridine(20/20a) synthase DusA
EHELCC_16525 EHELCC_16525 90.8 Morganella morganii S2 dusA tRNA dihydrouridine(20/20a) synthase DusA
NLDBIP_16735 NLDBIP_16735 90.8 Morganella morganii S4 dusA tRNA dihydrouridine(20/20a) synthase DusA
LHKJJB_16735 LHKJJB_16735 90.8 Morganella morganii S3 dusA tRNA dihydrouridine(20/20a) synthase DusA
HKOGLL_18880 HKOGLL_18880 90.8 Morganella morganii S5 dusA tRNA dihydrouridine(20/20a) synthase DusA
PMI_RS13500 PMI_RS13500 76.7 Proteus mirabilis HI4320 dusA tRNA dihydrouridine(20/20a) synthase DusA

Distribution of the homologs in the orthogroup group_2266

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2266

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P32695 0.0 561 76 0 344 1 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli (strain K12)
Q8X5V6 0.0 561 76 0 344 3 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli O157:H7
Q8FB30 0.0 555 80 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q7UBC5 0.0 553 80 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Shigella flexneri
Q8Z1T1 0.0 549 77 0 330 3 dusA tRNA-dihydrouridine(20/20a) synthase Salmonella typhi
Q8ZKH4 0.0 546 77 0 330 3 dusA tRNA-dihydrouridine(20/20a) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZJ14 0.0 531 77 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Yersinia pestis
Q87L85 0.0 514 73 0 320 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q8CWK7 0.0 510 72 0 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio vulnificus (strain CMCP6)
Q9KUX9 0.0 509 74 0 315 3 dusA tRNA-dihydrouridine(20/20a) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q9CL29 1.09e-178 501 73 1 315 3 dusA tRNA-dihydrouridine(20/20a) synthase Pasteurella multocida (strain Pm70)
P44794 5.12e-171 481 70 1 315 3 dusA tRNA-dihydrouridine(20/20a) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q7VNV2 1.99e-165 467 68 1 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8EAJ0 2.73e-164 464 68 2 324 3 dusA tRNA-dihydrouridine(20/20a) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9I048 7.33e-135 390 60 2 318 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q884G7 1.63e-130 379 62 2 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88KX0 2.08e-128 374 57 2 316 3 dusA tRNA-dihydrouridine(20/20a) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
P72872 6.38e-123 360 56 2 316 3 dus2 tRNA-dihydrouridine(20/20a) synthase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8P3X4 1.92e-109 325 52 3 319 3 dusA tRNA-dihydrouridine(20/20a) synthase Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
Q8PFF8 1.3e-101 305 52 3 313 3 dusA tRNA-dihydrouridine(20/20a) synthase Xanthomonas axonopodis pv. citri (strain 306)
Q87AY2 2.49e-97 294 49 3 330 3 dusA tRNA-dihydrouridine(20/20a) synthase Xylella fastidiosa (strain Temecula1 / ATCC 700964)
Q9PGB5 5.55e-94 286 48 3 330 3 dusA tRNA-dihydrouridine(20/20a) synthase Xylella fastidiosa (strain 9a5c)
Q5SMC7 5.18e-88 271 45 6 317 1 dus tRNA-dihydrouridine(20/20a) synthase Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
Q1RH84 3.22e-22 98 30 7 244 3 dus Probable tRNA-dihydrouridine synthase Rickettsia bellii (strain RML369-C)
Q92JQ6 7.44e-22 97 26 8 300 3 dus Probable tRNA-dihydrouridine synthase Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q9ZED2 8.93e-22 97 27 8 300 3 dus Probable tRNA-dihydrouridine synthase Rickettsia prowazekii (strain Madrid E)
Q9HUW1 1.24e-20 94 25 8 312 3 dusB tRNA-dihydrouridine synthase B Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q68XZ3 1.69e-20 94 26 8 300 3 dus Probable tRNA-dihydrouridine synthase Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q4UNJ4 4.23e-20 92 26 8 300 3 dus Probable tRNA-dihydrouridine synthase Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
P45672 1.79e-19 91 30 6 237 3 dus Probable tRNA-dihydrouridine synthase Azospirillum brasilense
Q8PCH1 2.16e-19 90 26 13 331 3 dusB tRNA-dihydrouridine synthase B Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
P44965 2.44e-19 90 25 11 315 3 dusB tRNA-dihydrouridine synthase B Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8PP72 2.07e-18 88 25 12 331 3 dusB tRNA-dihydrouridine synthase B Xanthomonas axonopodis pv. citri (strain 306)
Q08111 2.31e-18 87 30 7 250 3 dus Probable tRNA-dihydrouridine synthase Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003)
Q87KU1 3.03e-18 87 25 10 312 3 dusB tRNA-dihydrouridine synthase B Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7VNP2 4.95e-18 87 27 9 254 3 dusB tRNA-dihydrouridine synthase B Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q55724 9.23e-17 83 24 10 316 3 dus1 Probable tRNA-dihydrouridine synthase 1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q9CLW3 1.19e-16 83 24 12 312 3 dusB tRNA-dihydrouridine synthase B Pasteurella multocida (strain Pm70)
O52533 5.29e-15 78 25 6 252 3 dusB tRNA-dihydrouridine synthase B Proteus vulgaris
P0A2R6 7.25e-15 77 26 8 253 3 dusB tRNA-dihydrouridine synthase B Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2R7 7.25e-15 77 26 8 253 3 dusB tRNA-dihydrouridine synthase B Salmonella typhi
O67533 1.6e-14 76 26 16 319 3 dus Probable tRNA-dihydrouridine synthase Aquifex aeolicus (strain VF5)
Q8CWL2 1.77e-14 76 26 10 308 3 dusB tRNA-dihydrouridine synthase B Vibrio vulnificus (strain CMCP6)
P41504 1.82e-14 76 28 7 234 3 dus Probable tRNA-dihydrouridine synthase Rhizobium leguminosarum bv. phaseoli
Q9HGN6 2.66e-14 76 25 10 251 1 dus1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
P37567 3.81e-14 75 29 9 239 3 dus1 Probable tRNA-dihydrouridine synthase 1 Bacillus subtilis (strain 168)
Q8EFG7 5.59e-14 75 28 7 244 3 dusC tRNA-dihydrouridine(16) synthase Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9KV66 6.13e-14 75 25 10 313 3 dusB tRNA-dihydrouridine synthase B Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P0ABT5 7.41e-14 74 24 11 309 1 dusB tRNA-dihydrouridine synthase B Escherichia coli (strain K12)
P0ABT6 7.41e-14 74 24 11 309 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ABT7 7.41e-14 74 24 11 309 3 dusB tRNA-dihydrouridine synthase B Escherichia coli O157:H7
P67717 1.51e-13 73 26 9 244 1 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain N315)
P67716 1.51e-13 73 26 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q87VS1 1.53e-13 73 26 11 308 3 dusB tRNA-dihydrouridine synthase B Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q884C6 2.08e-13 73 30 6 196 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q88DK5 2.53e-13 73 25 7 252 3 dusB tRNA-dihydrouridine synthase B Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q88LF2 3.31e-13 72 31 6 196 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
O52536 4.74e-13 72 24 11 309 3 dusB tRNA-dihydrouridine synthase B Klebsiella pneumoniae
P9WNS7 9.19e-13 72 27 9 313 1 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WNS6 9.19e-13 72 27 9 313 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q83PZ5 9.32e-13 71 24 11 309 3 dusB tRNA-dihydrouridine synthase B Shigella flexneri
Q9JUP6 1.18e-12 71 27 11 268 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q6GKK9 1.4e-12 71 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MRSA252)
Q8NYV4 1.51e-12 71 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MW2)
Q6GD38 1.51e-12 71 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain MSSA476)
Q5HJT5 1.51e-12 71 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus aureus (strain COL)
Q8ZAX7 1.81e-12 70 25 8 252 3 dusB tRNA-dihydrouridine synthase B Yersinia pestis
O95620 3.93e-12 69 27 10 237 1 DUS4L tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Homo sapiens
Q3KRC5 4.39e-12 70 27 4 192 2 Dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Rattus norvegicus
O52539 5.41e-12 69 23 8 254 3 dusB tRNA-dihydrouridine synthase B Pectobacterium carotovorum
Q50049 6.99e-12 69 27 8 284 3 dus Probable tRNA-dihydrouridine synthase Mycobacterium leprae (strain TN)
Q8EJR8 7.34e-12 68 24 12 329 3 dusB tRNA-dihydrouridine synthase B Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q9JZL5 8.36e-12 68 27 11 274 3 dusC tRNA-dihydrouridine(16) synthase Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
P44606 1.11e-11 68 25 12 316 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q87N01 1.37e-11 68 26 11 248 3 dusC tRNA-dihydrouridine(16) synthase Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
O31546 1.97e-11 67 23 9 251 3 dus2 Probable tRNA-dihydrouridine synthase 2 Bacillus subtilis (strain 168)
Q9HZ95 2.09e-11 67 30 6 191 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8ZNM4 2.63e-11 67 26 10 288 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z5B2 2.78e-11 67 27 8 226 3 dusC tRNA-dihydrouridine(16) synthase Salmonella typhi
Q9AMN9 3.79e-11 66 29 6 191 3 dusC tRNA-dihydrouridine(16) synthase Pseudomonas alcaligenes
Q32M08 4.94e-11 66 27 10 237 2 Dus4l tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+]-like Mus musculus
Q8XYX1 5.29e-11 66 30 7 186 3 dusC tRNA-dihydrouridine(16) synthase Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
Q91XI1 7.32e-11 67 26 5 210 1 Dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Mus musculus
O68273 8.27e-11 65 30 8 195 3 dusC tRNA-dihydrouridine(16) synthase Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
P53759 9.14e-11 66 23 8 260 1 DUS1 tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Q7UC91 1.23e-10 65 26 11 288 3 dusC tRNA-dihydrouridine(16) synthase Shigella flexneri
Q6P1R4 1.55e-10 65 23 7 276 1 DUS1L tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Homo sapiens
Q5HKD5 1.93e-10 64 25 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q09504 2.31e-10 64 27 9 199 3 C45G9.2 Uncharacterized tRNA-dihydrouridine synthase-like protein C45G9.2 Caenorhabditis elegans
Q8XEC6 3.52e-10 63 26 11 288 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O157:H7
Q9KT00 5.03e-10 63 31 8 183 3 dusC tRNA-dihydrouridine(16) synthase Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
Q28BT8 5.11e-10 64 26 5 192 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus tropicalis
Q8K582 5.19e-10 63 22 10 304 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Rattus norvegicus
Q8FFV5 5.24e-10 63 26 11 288 3 dusC tRNA-dihydrouridine(16) synthase Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q8C2P3 6.43e-10 63 22 7 276 2 Dus1l tRNA-dihydrouridine(16/17) synthase [NAD(P)(+)]-like Mus musculus
Q8CU07 7.12e-10 63 24 9 244 3 dus Probable tRNA-dihydrouridine synthase Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q9CJW1 7.18e-10 62 25 13 323 3 dusC tRNA-dihydrouridine(16) synthase Pasteurella multocida (strain Pm70)
Q96G46 1.05e-09 63 25 4 192 1 DUS3L tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Homo sapiens
P33371 1.13e-09 62 26 11 288 1 dusC tRNA-dihydrouridine(16) synthase Escherichia coli (strain K12)
Q8ZGV2 1.69e-09 61 25 10 288 3 dusC tRNA-dihydrouridine(16) synthase Yersinia pestis
Q7ZWS1 1.98e-09 62 24 7 241 2 dus3l tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Xenopus laevis
Q8DAH1 2.67e-09 61 28 7 183 3 dusC tRNA-dihydrouridine(16) synthase Vibrio vulnificus (strain CMCP6)
O74553 3.29e-09 60 25 11 239 1 dus4 tRNA-dihydrouridine(20a/20b) synthase [NAD(P)+] Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Q9ZLB6 2.47e-08 58 22 8 249 3 dus Probable tRNA-dihydrouridine synthase Helicobacter pylori (strain J99 / ATCC 700824)
O52532 3.37e-08 58 24 11 302 3 dusB tRNA-dihydrouridine synthase B Serratia marcescens
Q7VKU5 8.95e-08 56 22 6 248 3 dusC tRNA-dihydrouridine(16) synthase Haemophilus ducreyi (strain 35000HP / ATCC 700724)
P0CN29 9.83e-08 57 25 10 234 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain B-3501A)
P0CN28 9.91e-08 57 25 10 234 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565)
Q6CWM0 3.9e-07 55 27 6 184 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Kluyveromyces lactis (strain ATCC 8585 / CBS 2359 / DSM 70799 / NBRC 1267 / NRRL Y-1140 / WM37)
A8NZY7 4.07e-07 55 24 6 200 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Coprinopsis cinerea (strain Okayama-7 / 130 / ATCC MYA-4618 / FGSC 9003)
Q757E3 1.51e-06 53 28 7 187 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Eremothecium gossypii (strain ATCC 10895 / CBS 109.51 / FGSC 9923 / NRRL Y-1056)
A7TQ73 1.94e-06 53 27 6 191 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Vanderwaltozyma polyspora (strain ATCC 22028 / DSM 70294 / BCRC 21397 / CBS 2163 / NBRC 10782 / NRRL Y-8283 / UCD 57-17)
Q06053 5.37e-06 52 26 6 186 1 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
A7A1S5 5.37e-06 52 26 6 186 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Saccharomyces cerevisiae (strain YJM789)
A8PTG4 6.41e-06 51 24 4 200 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Malassezia globosa (strain ATCC MYA-4612 / CBS 7966)
Q6FJ14 8.07e-06 51 25 9 243 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Candida glabrata (strain ATCC 2001 / BCRC 20586 / JCM 3761 / NBRC 0622 / NRRL Y-65 / CBS 138)
Q9T0J6 1.74e-05 50 23 6 213 1 At4g38890 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Arabidopsis thaliana
Q6C4K3 2.52e-05 49 26 8 224 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Yarrowia lipolytica (strain CLIB 122 / E 150)
Q7XT07 3.67e-05 49 23 6 213 2 Os04g0117600 tRNA-dihydrouridine(47) synthase [NAD(P)(+)]-like Oryza sativa subsp. japonica
Q7SG01 9.69e-05 47 23 8 214 3 dus-3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
Q8TT55 0.000155 46 27 8 203 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Methanosarcina acetivorans (strain ATCC 35395 / DSM 2834 / JCM 12185 / C2A)
A5IK84 0.000241 45 25 10 202 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Thermotoga petrophila (strain ATCC BAA-488 / DSM 13995 / JCM 10881 / RKU-1)
Q9WYG8 0.000241 45 25 10 202 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q8PW56 0.000336 45 26 8 207 3 pyrD Dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q4P1U2 0.000354 46 34 2 88 3 DUS3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Ustilago maydis (strain 521 / FGSC 9021)
Q9UTH9 0.00047 45 31 2 89 1 dus3 tRNA-dihydrouridine(47) synthase [NAD(P)(+)] Schizosaccharomyces pombe (strain 972 / ATCC 24843)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS18545
Feature type CDS
Gene dusA
Product tRNA dihydrouridine(20/20a) synthase DusA
Location 46293 - 47339 (strand: -1)
Length 1047 (nucleotides) / 348 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000009
Length 74461 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2266
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01207 Dihydrouridine synthase (Dus)

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0042 Translation, ribosomal structure and biogenesis (J) J tRNA-dihydrouridine synthase

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K05539 tRNA-dihydrouridine synthase A [EC:1.-.-.-] - -

Protein Sequence

MHQNTPTEKITENQQPRAVSGYKNLNRFSVAPMLDWTDRHCRYFHRKLSRHALLYTEMVTTGAILFGKGDYLAYNEAEHPVALQLGGSDPVALAECAKLAQARGYDEINLNVGCPSDRVQNGMFGACLMGNAGLVADCVAAMRDVADIPVTVKTRIGIDDQDSYEFLCDFVGTVAGSGGCEMFIIHARKAWLSGLSPKENREIPPLDYPRVYQLKKDFPHLTMALNGGVKTLEDAKTHLQYMDGVMVGREAYQNPSILAQVDNALFDDALPVTDTIAAIESMYPYIEEELAKGMYLGHVTRHMLGIFQGIPGARQWRRHLSENAHKAGADVKVIEAALAFVTRKGNEE

Flanking regions ( +/- flanking 50bp)

TGTCCCTACTGGTGTCCTGATAAAGAGAAAACAGACCAAAAAGACCCGATATGCACCAAAATACGCCAACAGAAAAAATCACCGAAAACCAGCAACCACGCGCCGTCAGCGGCTATAAGAACCTTAACCGCTTTTCCGTTGCACCGATGCTGGACTGGACTGATCGTCATTGCCGGTATTTTCACCGTAAACTCAGCCGCCATGCCCTTTTATATACAGAAATGGTGACGACCGGGGCAATTTTGTTCGGTAAAGGTGACTATCTGGCGTATAACGAGGCTGAACATCCGGTTGCCCTGCAATTGGGCGGCAGTGACCCGGTCGCACTCGCTGAATGTGCGAAGCTTGCGCAGGCGCGCGGATACGATGAAATCAACCTCAATGTGGGTTGTCCTTCTGACCGTGTGCAAAATGGTATGTTTGGTGCGTGTCTGATGGGAAATGCCGGGCTGGTTGCAGATTGTGTTGCCGCGATGCGCGATGTGGCGGATATCCCGGTGACAGTAAAAACCCGGATTGGTATTGACGATCAGGACAGTTATGAATTTCTCTGTGATTTTGTCGGCACAGTAGCAGGTAGCGGGGGATGTGAAATGTTTATTATCCATGCCCGCAAAGCCTGGCTCTCCGGGCTCAGCCCGAAAGAGAACCGCGAGATCCCGCCACTGGATTATCCGCGGGTTTATCAGCTGAAAAAAGATTTTCCGCACCTGACAATGGCGCTGAATGGCGGGGTTAAAACCTTAGAAGACGCAAAAACTCATCTGCAATATATGGATGGGGTAATGGTCGGACGCGAAGCGTATCAGAATCCGTCGATTCTGGCACAGGTGGATAATGCGTTATTTGATGATGCGTTGCCGGTCACTGATACCATCGCGGCGATTGAATCAATGTATCCGTATATTGAAGAAGAACTGGCGAAGGGAATGTATCTGGGGCATGTCACCCGTCATATGCTGGGTATTTTCCAGGGTATTCCCGGCGCGCGCCAGTGGCGGCGTCATCTGAGCGAAAATGCACATAAAGCGGGAGCGGATGTGAAAGTCATTGAAGCGGCGCTGGCATTTGTTACCCGAAAGGGTAATGAAGAATAATATAAATTATGAATGAACTCTCCGACCGGAGAGTTCATTCATATGTATTA