Homologs in group_347

Help

7 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_12150 FBDBKF_12150 100.0 Morganella morganii S1 oxyR DNA-binding transcriptional regulator OxyR
EHELCC_14155 EHELCC_14155 100.0 Morganella morganii S2 oxyR DNA-binding transcriptional regulator OxyR
NLDBIP_15250 NLDBIP_15250 100.0 Morganella morganii S4 oxyR DNA-binding transcriptional regulator OxyR
LHKJJB_15360 LHKJJB_15360 100.0 Morganella morganii S3 oxyR DNA-binding transcriptional regulator OxyR
F4V73_RS16945 F4V73_RS16945 96.4 Morganella psychrotolerans oxyR DNA-binding transcriptional regulator OxyR
PMI_RS11770 PMI_RS11770 30.3 Proteus mirabilis HI4320 - LysR family transcriptional regulator
PMI_RS16025 PMI_RS16025 81.5 Proteus mirabilis HI4320 oxyR DNA-binding transcriptional regulator OxyR

Distribution of the homologs in the orthogroup group_347

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_347

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0ACQ4 0.0 508 81 0 299 1 oxyR DNA-binding transcriptional dual regulator OxyR Escherichia coli (strain K12)
P0ACQ5 0.0 508 81 0 299 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACQ6 0.0 508 81 0 299 3 oxyR Hydrogen peroxide-inducible genes activator Escherichia coli O157:H7
P71318 0.0 503 80 0 298 3 oxyR Hydrogen peroxide-inducible genes activator Pectobacterium carotovorum subsp. carotovorum
Q9X725 3.61e-180 501 81 0 293 3 oxyR Hydrogen peroxide-inducible genes activator Dickeya chrysanthemi
P44418 3.16e-150 426 67 0 289 3 oxyR Hydrogen peroxide-inducible genes activator Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q9X5P2 2.25e-50 172 40 2 276 2 oxyR Probable hydrogen peroxide-inducible genes activator Streptomyces viridosporus
P52667 2.9e-50 171 34 3 291 3 estR HTH-type transcriptional regulator EstR Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P52677 2.42e-48 166 35 1 298 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium avium
O87324 4.59e-48 166 37 2 295 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium marinum
P52678 3.04e-47 164 36 1 289 3 oxyR Probable hydrogen peroxide-inducible genes activator Mycobacterium leprae (strain TN)
P37499 1.14e-33 127 26 2 299 3 yybE Uncharacterized HTH-type transcriptional regulator YybE Bacillus subtilis (strain 168)
O87883 2.52e-30 116 37 0 180 3 oxyR Probable hydrogen peroxide-inducible genes activator (Fragment) Mycobacterium xenopi
P27111 2.72e-30 119 30 2 273 1 cynR HTH-type transcriptional regulator CynR Escherichia coli (strain K12)
P94387 5.66e-30 119 27 7 305 3 ycgK Uncharacterized HTH-type transcriptional regulator YcgK Bacillus subtilis (strain 168)
P20668 7.41e-29 115 28 1 243 1 gltC Transcriptional dual regulator GltC Bacillus subtilis (strain 168)
Q04778 1.38e-28 114 30 1 246 3 alsR HTH-type transcriptional regulator AlsR Bacillus subtilis (strain 168)
Q8X4M5 2.2e-28 114 29 2 276 3 cynR HTH-type transcriptional regulator CynR Escherichia coli O157:H7
P39592 1.2e-27 112 27 0 242 3 ywbI Uncharacterized HTH-type transcriptional regulator YwbI Bacillus subtilis (strain 168)
P52696 1.73e-26 109 29 2 246 3 ybhD Uncharacterized HTH-type transcriptional regulator YbhD Escherichia coli (strain K12)
O32255 4.55e-26 107 26 5 275 3 yvbU Uncharacterized HTH-type transcriptional regulator YvbU Bacillus subtilis (strain 168)
P25544 1.31e-24 103 27 5 280 3 rbcR RuBisCO operon transcriptional regulator Allochromatium vinosum
P20667 4.42e-24 102 30 10 286 3 catR HTH-type transcriptional regulator CatR Pseudomonas putida
P77559 2.02e-23 100 31 4 247 3 ynfL Uncharacterized HTH-type transcriptional regulator YnfL Escherichia coli (strain K12)
P0ACR8 3.49e-23 100 26 2 290 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Shigella flexneri
P0ACR7 3.49e-23 100 26 2 290 3 yfeR Uncharacterized HTH-type transcriptional regulator YfeR Escherichia coli (strain K12)
P45600 7.88e-23 99 25 3 250 1 cysB HTH-type transcriptional regulator CysB Klebsiella pneumoniae
P70785 8.68e-23 99 28 8 318 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q08597 9.47e-23 99 29 4 246 3 nac Nitrogen assimilation regulatory protein nac Klebsiella aerogenes
P52595 1.23e-22 98 30 5 240 3 cbbR HTH-type transcriptional regulator CbbR Rhodospirillum rubrum
P0A9F3 1.82e-22 98 25 4 253 3 cysB HTH-type transcriptional regulator CysB Escherichia coli (strain K12)
P0A9F4 1.82e-22 98 25 4 253 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F5 1.82e-22 98 25 4 253 3 cysB HTH-type transcriptional regulator CysB Escherichia coli O157:H7
P42722 1.93e-22 98 30 4 246 3 cfxR HTH-type transcriptional regulator CfxR Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
Q47141 1.96e-22 97 29 3 246 1 hcaR Hca operon transcriptional activator HcaR Escherichia coli (strain K12)
O68014 3.27e-22 97 30 6 248 1 benM HTH-type transcriptional regulator BenM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P96725 1.86e-21 95 26 6 252 3 ywqM Uncharacterized HTH-type transcriptional regulator YwqM Bacillus subtilis (strain 168)
P06614 2.44e-21 95 25 3 250 1 cysB HTH-type transcriptional regulator CysB Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
O33945 4.19e-21 94 27 7 306 3 None Probable cat1 operon transcriptional activator Acinetobacter lwoffii
P73123 9.78e-21 94 26 6 295 3 rbcR Probable RuBisCO transcriptional regulator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3MCB5 1.01e-20 94 26 9 308 3 rbcR Probable RuBisCO transcriptional regulator Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q44311 2.2e-20 92 25 8 295 3 soxR HTH-type transcriptional regulator SoxR Arthrobacter sp. (strain TE1826)
P45105 8.53e-20 90 27 5 248 3 cysB HTH-type transcriptional regulator CysB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8YQ82 9.26e-20 91 26 9 308 3 rbcR Probable RuBisCO transcriptional regulator Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
P52669 1.54e-19 90 29 3 245 3 ttuA HTH-type transcriptional regulator TtuA Agrobacterium vitis
Q47005 3.45e-19 89 28 5 248 3 nac Nitrogen assimilation regulatory protein nac Escherichia coli (strain K12)
P94403 4.08e-19 88 26 7 269 3 bsdA HTH-type transcriptional regulator BsdA Bacillus subtilis (strain 168)
A2CI69 8.16e-19 88 24 7 303 3 rbcR Probable RuBisCO transcriptional regulator Chlorokybus atmophyticus
Q55459 9.3e-19 87 25 3 236 1 cmpR HTH-type transcriptional activator CmpR Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
O06703 2.75e-18 87 26 0 235 3 bbuR HTH-type transcriptional regulator BbuR Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
O78432 2.82e-18 86 23 7 297 3 rbcR Probable RuBisCO transcriptional regulator Guillardia theta
Q6B936 3.9e-18 86 25 9 314 3 rbcR Probable RuBisCO transcriptional regulator Gracilaria tenuistipitata var. liui
P94501 3.94e-18 85 26 4 255 1 gltR HTH-type transcriptional regulator GltR Bacillus subtilis (strain 168)
O19892 4.18e-18 86 25 5 260 3 rbcR Probable RuBisCO transcriptional regulator Cyanidium caldarium
P39647 4.49e-18 85 23 2 273 1 cysL HTH-type transcriptional regulator CysL Bacillus subtilis (strain 168)
B4E8V9 5.63e-18 85 25 3 254 1 cysB HTH-type transcriptional regulator CysB Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P0A2Q2 7.06e-18 85 28 2 261 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q3 7.06e-18 85 28 2 261 3 ilvY HTH-type transcriptional activator IlvY Salmonella typhi
P05827 1.06e-17 84 28 2 261 3 ilvY HTH-type transcriptional regulator IlvY Escherichia coli (strain K12)
Q5N5I5 2.1e-17 84 22 3 241 3 cmpR HTH-type transcriptional activator CmpR Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q9F1R2 2.1e-17 84 22 3 241 1 cmpR HTH-type transcriptional activator CmpR Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q06610 2.16e-17 84 25 3 291 3 rbcR RuBisCO operon transcriptional regulator Acidithiobacillus ferrooxidans
A0T0V5 2.17e-17 84 23 7 293 3 rbcR-A Probable RuBisCO transcriptional regulator Thalassiosira pseudonana
P71025 4.9e-17 82 25 5 248 3 czcR HTH-type transcriptional regulator CzcR Bacillus subtilis (strain 168)
P23841 1.35e-16 81 27 2 243 3 xapR HTH-type transcriptional regulator XapR Escherichia coli (strain K12)
O35038 2e-16 81 24 1 193 3 ytlI HTH-type transcriptional regulator YtlI Bacillus subtilis (strain 168)
Q4G384 5.15e-16 80 25 6 259 3 rbcR Probable RuBisCO transcriptional regulator Emiliania huxleyi
A7Z5E4 5.61e-16 79 24 4 293 3 yofA HTH-type transcriptional regulator YofA Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
P07774 6.56e-16 79 33 3 174 1 catM HTH-type transcriptional regulator CatM Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
P52670 7.66e-16 79 26 6 278 3 ilvR HTH-type transcriptional regulator IlvR Caulobacter vibrioides (strain ATCC 19089 / CIP 103742 / CB 15)
P49518 3.23e-15 77 25 8 264 3 rbcR Probable RuBisCO transcriptional regulator Trieres chinensis
O34685 5.41e-15 77 23 3 291 1 yofA HTH-type transcriptional regulator YofA Bacillus subtilis (strain 168)
A0T0G2 6.5e-15 77 22 6 286 3 rbcR Probable RuBisCO transcriptional regulator Phaeodactylum tricornutum (strain CCAP 1055/1)
P52666 7.32e-15 76 27 4 249 3 budR HTH-type transcriptional regulator BudR Raoultella terrigena
B4E8S9 9.12e-15 76 23 5 293 1 ssuR HTH-type transcriptional regulator SsuR Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
P52686 2.4e-14 75 30 1 180 3 sdsB SDS degradation transcriptional activation protein Pseudomonas sp. (strain ATCC 19151)
Q81VJ1 4.2e-14 74 24 9 296 3 czcR HTH-type transcriptional regulator CzcR Bacillus anthracis
A4QH19 4.44e-14 74 26 4 244 1 shiR HTH-type transcriptional regulator ShiR Corynebacterium glutamicum (strain R)
P0A4T7 6.72e-14 74 26 1 179 3 pcaQ HTH-type transcriptional regulator PcaQ Rhizobium radiobacter
P0A4T6 6.72e-14 74 26 1 179 3 pcaQ HTH-type transcriptional regulator PcaQ Agrobacterium fabrum (strain C58 / ATCC 33970)
P52693 8.08e-14 73 22 5 308 3 ntcB Probable nitrogen assimilation transcriptional activator Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P56885 8.13e-14 73 24 2 274 3 cbbR HTH-type transcriptional regulator CbbR Sinorhizobium medicae (strain WSM419)
Q63H01 9.49e-14 73 23 9 296 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ZK / E33L)
Q73EY2 9.49e-14 73 23 9 296 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 10987 / NRS 248)
Q05840 9.81e-14 73 24 3 246 3 clcR HTH-type transcriptional regulator ClcR Pseudomonas putida
Q6HPH4 1.51e-13 72 23 9 296 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis subsp. konkukian (strain 97-27)
A0R8S0 1.53e-13 73 23 9 296 3 czcR HTH-type transcriptional regulator CzcR Bacillus thuringiensis (strain Al Hakam)
Q81IX0 1.54e-13 72 23 9 296 3 czcR HTH-type transcriptional regulator CzcR Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
Q47083 1.6e-13 73 25 3 243 1 cbl HTH-type transcriptional regulator cbl Escherichia coli (strain K12)
P42427 1.91e-13 71 28 1 178 3 tfdT HTH-type transcriptional regulator TfdT Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P55181 2.31e-13 72 25 0 155 3 yxjO Uncharacterized HTH-type transcriptional regulator YxjO Bacillus subtilis (strain 168)
P0A9G1 3.93e-13 72 26 3 247 3 metR HTH-type transcriptional regulator MetR Shigella flexneri
P0A9F9 3.93e-13 72 26 3 247 1 metR HTH-type transcriptional regulator MetR Escherichia coli (strain K12)
P0A9G0 3.93e-13 72 26 3 247 3 metR HTH-type transcriptional regulator MetR Escherichia coli O157:H7
P52665 4.9e-13 68 33 1 138 3 budR HTH-type transcriptional regulator BudR (Fragment) Klebsiella aerogenes
P58332 5.26e-13 71 24 2 274 3 cbbR HTH-type transcriptional regulator CbbR Rhizobium meliloti (strain 1021)
Q8VWE6 5.85e-13 71 26 6 294 3 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli O157:H7
P36771 8.02e-13 71 26 6 294 1 lrhA Probable HTH-type transcriptional regulator LrhA Escherichia coli (strain K12)
P52662 8.59e-13 71 25 3 268 3 pecT HTH-type transcriptional regulator PecT Dickeya dadantii (strain 3937)
P77744 1.52e-12 70 28 0 145 3 abgR HTH-type transcriptional regulator AbgR Escherichia coli (strain K12)
P37641 1.8e-12 70 29 2 164 3 yhjC Uncharacterized HTH-type transcriptional regulator YhjC Escherichia coli (strain K12)
Q9JXW7 2.53e-12 69 25 3 250 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q9JPU9 2.76e-12 69 25 3 250 1 crgA HTH-type transcriptional regulator CrgA Neisseria meningitidis serogroup C (strain 8013)
P44821 3.43e-12 68 23 4 274 3 ilvY HTH-type transcriptional activator IlvY Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P30864 6.16e-12 68 29 10 267 3 yafC Uncharacterized HTH-type transcriptional regulator YafC Escherichia coli (strain K12)
Q9HWH8 7.31e-12 68 26 3 195 3 nmoR HTH-type transcriptional regulator NmoR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
O07906 8.5e-12 67 26 2 174 3 yraN Uncharacterized HTH-type transcriptional regulator YraN Bacillus subtilis (strain 168)
P39127 1.38e-11 67 23 6 251 3 citR HTH-type transcriptional regulator CitR Bacillus subtilis (strain 168)
P0A2Q4 1.91e-11 67 26 3 247 3 metR HTH-type transcriptional regulator MetR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q5 1.91e-11 67 26 3 247 3 metR HTH-type transcriptional regulator MetR Salmonella typhi
Q8KA72 4.57e-11 65 23 5 297 3 metR HTH-type transcriptional regulator MetR Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
P0ACQ9 8.34e-11 65 23 5 230 3 tdcA HTH-type transcriptional regulator TdcA Shigella flexneri
P0ACQ7 8.34e-11 65 23 5 230 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli (strain K12)
P0ACQ8 8.34e-11 65 23 5 230 3 tdcA HTH-type transcriptional regulator TdcA Escherichia coli O157:H7
P52661 9.06e-11 65 30 1 176 1 gbpR HTH-type transcriptional regulator GbpR Azospirillum brasilense
P74422 9.24e-11 65 24 2 204 3 ntcB Probable nitrogen assimilation transcriptional activator Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
P0A4T3 1.8e-10 63 27 3 200 1 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium radiobacter
P0A4T4 1.8e-10 63 27 3 200 1 occR Octopine catabolism/uptake operon regulatory protein OccR Agrobacterium tumefaciens (strain Ach5)
O34701 2.23e-10 63 25 8 256 3 yoaU Uncharacterized HTH-type transcriptional regulator YoaU Bacillus subtilis (strain 168)
P16400 3.6e-10 63 25 7 258 3 mleR Malolactic fermentation system transcriptional activator Lactococcus lactis subsp. lactis (strain IL1403)
O32186 5.19e-10 62 24 6 261 3 yusT Uncharacterized HTH-type transcriptional regulator YusT Bacillus subtilis (strain 168)
P77309 5.68e-10 62 22 3 251 3 yneJ Uncharacterized HTH-type transcriptional regulator YneJ Escherichia coli (strain K12)
O33812 6.47e-10 62 24 2 145 3 None Uncharacterized HTH-type transcriptional regulator in lacR 5'region (Fragment) Staphylococcus xylosus
Q46M54 2.02e-09 60 25 3 216 1 tfdS HTH-type transcriptional regulator TfdS Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q46M57 2.13e-09 60 25 3 216 1 tfdR HTH-type transcriptional regulator TdfR Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
P94678 2.93e-09 60 31 4 180 1 tsaR HTH-type transcriptional regulator TsaR Comamonas testosteroni
Q88JX7 4.97e-09 60 28 4 174 3 galR HTH-type transcriptional regulator GalR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A0A0H2ZDG9 7.56e-09 59 27 5 173 3 PA14_22550 HTH-type transcriptional repressor PA14_22550 Pseudomonas aeruginosa (strain UCBPP-PA14)
P77171 7.6e-09 59 26 3 178 3 ydcI Uncharacterized HTH-type transcriptional regulator YdcI Escherichia coli (strain K12)
P0DV33 7.76e-09 59 23 0 165 1 admX HTH-type transcriptional regulator AdmX Serratia plymuthica
P44876 8.84e-09 59 20 6 298 3 HI_0775 Uncharacterized HTH-type transcriptional regulator HI_0775 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P52690 1.27e-08 58 23 5 247 3 cbbR HTH-type transcriptional regulator CbbR Cereibacter sphaeroides
P43161 1.54e-08 58 27 4 200 3 mprR Small neutral protease regulatory protein Streptomyces lividans
P0ACR4 1.89e-08 58 20 2 240 1 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli (strain K12)
P0ACR5 1.89e-08 58 20 2 240 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0ACR6 1.89e-08 58 20 2 240 3 yeiE Uncharacterized HTH-type transcriptional regulator YeiE Escherichia coli O157:H7
P0A9F6 2.12e-08 58 29 1 117 1 gcvA Glycine cleavage system transcriptional activator Escherichia coli (strain K12)
P0A9F7 2.12e-08 58 29 1 117 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A9F8 2.12e-08 58 29 1 117 3 gcvA Glycine cleavage system transcriptional activator Escherichia coli O157:H7
Q9L127 2.19e-08 58 27 4 200 3 mprR Small neutral protease regulatory protein Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P52691 2.29e-08 57 26 4 253 3 lrrA Probable HTH-type transcriptional regulator LrrA Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P72294 2.54e-08 57 25 3 198 3 occR Octopine catabolism/uptake operon regulatory protein OccR Rhizobium meliloti
Q00678 3.46e-08 57 21 0 237 3 nocR Regulatory protein NocR Agrobacterium fabrum (strain C58 / ATCC 33970)
P16931 5.52e-08 56 29 1 147 3 dgdR HTH-type transcriptional regulator DgdR Burkholderia cepacia
P43160 9.83e-08 56 26 3 200 3 mprR Small neutral protease regulatory protein Streptomyces coelicolor
P45349 1.1e-07 55 26 2 190 3 metR HTH-type transcriptional regulator MetR Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P35112 1.39e-07 55 20 0 220 3 nocR Regulatory protein NocR Agrobacterium tumefaciens (strain T37)
O34827 1.73e-07 55 25 2 147 3 ykuM Uncharacterized HTH-type transcriptional regulator YkuM Bacillus subtilis (strain 168)
P25547 1.76e-07 55 25 5 204 3 gbpR HTH-type transcriptional regulator GbpR Rhizobium radiobacter
P39376 1.83e-07 55 25 9 265 1 yjiE HTH-type transcriptional regulator YjiE Escherichia coli (strain K12)
Q765S2 2.88e-07 54 43 0 67 3 allS HTH-type transcriptional activator AllS Klebsiella pneumoniae
P0A2Q0 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2Q1 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella typhi
B5BIR0 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain AKU_12601)
C0Q2U0 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi C (strain RKS4594)
A9MXD5 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
Q5PJZ0 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella paratyphi A (strain ATCC 9150 / SARB42)
B4TAZ8 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella heidelberg (strain SL476)
B5EZ22 4.38e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella agona (strain SL483)
B4SYF7 4.63e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella newport (strain SL254)
B4TNR5 5.18e-07 53 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella schwarzengrund (strain CVM19633)
Q57748 5.53e-07 53 21 6 257 3 MJ0300 Uncharacterized HTH-type transcriptional regulator MJ0300 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
P72131 7.88e-07 53 33 4 147 1 ptxR HTH-type transcriptional regulator PtxR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P67662 9.6e-07 53 27 0 122 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli (strain K12)
P67663 9.6e-07 53 27 0 122 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P67664 9.6e-07 53 27 0 122 3 aaeR HTH-type transcriptional activator AaeR Escherichia coli O157:H7
P52684 1.21e-06 52 23 8 286 3 mauR Malonate utilization transcriptional regulator Klebsiella pneumoniae
P03030 1.42e-06 52 22 7 293 3 lysR Transcriptional activator protein LysR Escherichia coli (strain K12)
B5FN59 1.58e-06 52 25 6 244 3 hdfR HTH-type transcriptional regulator HdfR Salmonella dublin (strain CT_02021853)
P27102 2.35e-06 51 41 0 72 3 tcbR HTH-type transcriptional regulator TcbR Pseudomonas sp. (strain P51)
Q1R4H3 3.73e-06 51 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain UTI89 / UPEC)
P59369 3.73e-06 51 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TAV4 3.73e-06 51 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O6:K15:H31 (strain 536 / UPEC)
B7N260 3.73e-06 51 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O81 (strain ED1a)
B7MGH6 3.73e-06 51 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O45:K1 (strain S88 / ExPEC)
O69055 4.15e-06 50 27 3 194 3 ptxE Putative HTH-type transcriptional regulator protein PtxE (Fragment) Stutzerimonas stutzeri
B7NF72 5.68e-06 50 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P52675 7.83e-06 48 27 2 135 3 cysB HTH-type transcriptional regulator CysB (Fragment) Thiocapsa roseopersicina
B7NU32 8.28e-06 50 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
P52660 9.89e-06 49 29 6 137 3 blaA HTH-type transcriptional regulator BlaA Proteus vulgaris
P25545 1.09e-05 50 22 4 242 3 cbbR HTH-type transcriptional regulator CbbR Xanthobacter flavus
Q08598 1.11e-05 49 23 3 245 3 cbl HTH-type transcriptional regulator cbl Klebsiella aerogenes
P45099 1.3e-05 49 26 6 181 3 gcvA Glycine cleavage system transcriptional activator homolog Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q3YVK2 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Shigella sonnei (strain Ss046)
P0A8S0 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri
Q0SYV7 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Shigella flexneri serotype 5b (strain 8401)
Q31UM0 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 4 (strain Sb227)
B1LLU0 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SMS-3-5 / SECEC)
P0A8R9 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12)
B1IWY2 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
A8A6M0 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O9:H4 (strain HS)
B1X9Y2 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / DH10B)
C4ZZ35 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain K12 / MC4100 / BW2952)
B7UMM1 1.33e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q329U3 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Shigella dysenteriae serotype 1 (strain Sd197)
B6I4A0 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain SE11)
B7M5B2 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O8 (strain IAI1)
B5YY14 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XAW1 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O157:H7
B7L8A6 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli (strain 55989 / EAEC)
A7ZTW7 1.47e-05 49 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Escherichia coli O139:H28 (strain E24377A / ETEC)
P76369 2.07e-05 48 29 0 107 3 yeeY Uncharacterized HTH-type transcriptional regulator YeeY Escherichia coli (strain K12)
P55576 3.86e-05 48 28 3 130 3 NGR_a02420 Uncharacterized HTH-type transcriptional regulator y4mQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
B7LUJ5 4.7e-05 47 24 6 245 3 hdfR HTH-type transcriptional regulator HdfR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
B2TU26 7.97e-05 47 24 7 258 3 hdfR HTH-type transcriptional regulator HdfR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
P0ACR0 0.000164 46 23 9 305 1 allS HTH-type transcriptional activator AllS Escherichia coli (strain K12)
P0ACR1 0.000164 46 23 9 305 3 allS HTH-type transcriptional activator AllS Escherichia coli O157:H7
B1JQ39 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66G51 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype I (strain IP32953)
A4TRF4 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis (strain Pestoides F)
Q1CNN4 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Nepal516)
A9R8E7 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Angola)
Q8ZAA7 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis
B2JZG4 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1CBT5 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pestis bv. Antiqua (strain Antiqua)
A7FD20 0.000191 45 28 3 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
A1JI47 0.000224 45 28 4 150 3 hdfR HTH-type transcriptional regulator HdfR Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
P77333 0.000233 45 36 1 83 1 pgrR HTH-type transcriptional regulator PgrR Escherichia coli (strain K12)
P46068 0.00029 45 26 1 110 2 dsdC HTH-type transcriptional regulator DsdC Escherichia coli (strain K12)
Q01610 0.000482 44 35 1 85 3 PA2220 Putative transcriptional regulator Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q8FK66 0.000696 44 23 9 305 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TKD7 0.000696 44 23 9 305 3 allS HTH-type transcriptional activator AllS Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P11720 0.000739 44 28 4 132 1 trpI HTH-type transcriptional regulator TrpI Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P52676 0.000759 44 28 4 136 3 nmcR Carbapenem-hydrolyzing beta-lactamase transcriptional activator Enterobacter cloacae
Q1RF30 0.000864 43 23 9 305 3 allS HTH-type transcriptional activator AllS Escherichia coli (strain UTI89 / UPEC)
A1A8H0 0.000864 43 23 9 305 3 allS HTH-type transcriptional activator AllS Escherichia coli O1:K1 / APEC

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_14480
Feature type CDS
Gene oxyR
Product DNA-binding transcriptional regulator OxyR
Location 72106 - 73017 (strand: -1)
Length 912 (nucleotides) / 303 (amino acids)

Contig

Accession ZDB_693
Length 123756 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_347
Orthogroup size 8
N. genomes 7

Actions

Genomic region

Domains

PF00126 Bacterial regulatory helix-turn-helix protein, lysR family
PF03466 LysR substrate binding domain

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0583 Transcription (K) K DNA-binding transcriptional regulator, LysR family

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K04761 LysR family transcriptional regulator, hydrogen peroxide-inducible genes activator Biofilm formation - Escherichia coli -

Protein Sequence

MNIRDLEYLVALSEHNHFRRAADACHVSQPTLSGQIRKLEDELGVMLLERTSRKVLFTQQGMLLVDQARTILREVKILEEMASLQGESMAGPLHIGLIPTIAPYLLPHIIPELHRLWPKLEMYLHEAQTHQLLAQLDSGKLDCAILARVKETGSFIEEPLFNEPMKLAIYDEHPWASRQEVEMHELAGEKLLMLEDGHCLRDQAMGFCFQAGAREDTHFRATSMETLRNMVAAGSGITLLPDLAIPPEHKRDGVCYLSCTNPEPFREVILVYRPGSPLRSRYSQLAEAIRAKMCAYYQQEPAA

Flanking regions ( +/- flanking 50bp)

TGATAGTTATCAATTGATTTTATCTATTAATCGCAGACGGAGACACAGGCATGAATATCCGGGATTTGGAATATCTGGTGGCACTTTCTGAGCATAATCACTTTCGCCGCGCGGCAGATGCCTGTCATGTCAGCCAGCCGACACTGAGCGGACAGATCCGCAAGCTCGAGGATGAACTGGGTGTGATGCTGCTGGAGCGCACCAGCCGCAAAGTCCTGTTTACCCAGCAGGGAATGCTGCTGGTGGATCAGGCCCGGACCATTCTGCGGGAAGTGAAAATTCTTGAGGAAATGGCCTCCCTTCAGGGAGAAAGCATGGCAGGGCCGCTGCATATCGGGCTGATCCCGACCATCGCCCCGTATCTGTTGCCGCATATCATTCCGGAACTGCACCGGCTGTGGCCGAAGCTCGAGATGTATCTGCATGAAGCCCAGACCCATCAGCTGCTGGCGCAACTGGACAGCGGGAAACTCGACTGCGCGATTCTGGCGCGGGTAAAAGAAACCGGCAGCTTTATTGAAGAGCCGCTGTTTAATGAGCCGATGAAACTGGCGATTTATGATGAGCACCCGTGGGCATCCCGTCAGGAAGTGGAAATGCATGAGCTGGCCGGGGAAAAACTGCTGATGCTGGAAGACGGGCACTGTCTGCGTGATCAGGCGATGGGATTCTGTTTCCAGGCCGGTGCGCGGGAAGATACCCACTTCCGGGCGACAAGTATGGAAACCCTGCGCAATATGGTGGCGGCAGGCAGCGGTATCACGTTACTGCCGGATCTGGCCATTCCGCCGGAGCACAAACGCGACGGCGTGTGCTACCTCTCCTGCACCAATCCGGAGCCTTTCCGTGAAGTGATCCTGGTTTACCGTCCGGGGTCGCCGCTGCGCAGCCGTTACAGCCAGCTGGCAGAGGCTATCCGTGCAAAAATGTGTGCTTATTACCAGCAGGAGCCTGCGGCTTAAAATAAGCGGTTAAGTCCGTTCAGTGCGGCAACCCGGTAGGCTTCCGCCAT