Homologs in group_1569

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10165 FBDBKF_10165 100.0 Morganella morganii S1 proW glycine betaine/L-proline ABC transporter permease ProW
EHELCC_04965 EHELCC_04965 100.0 Morganella morganii S2 proW glycine betaine/L-proline ABC transporter permease ProW
NLDBIP_04965 NLDBIP_04965 100.0 Morganella morganii S4 proW glycine betaine/L-proline ABC transporter permease ProW
LHKJJB_13665 LHKJJB_13665 100.0 Morganella morganii S3 proW glycine betaine/L-proline ABC transporter permease ProW
F4V73_RS00175 F4V73_RS00175 89.1 Morganella psychrotolerans proW glycine betaine/L-proline ABC transporter permease ProW
PMI_RS02025 PMI_RS02025 74.2 Proteus mirabilis HI4320 proW glycine betaine/L-proline ABC transporter permease ProW

Distribution of the homologs in the orthogroup group_1569

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1569

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
E0SCY2 0.0 514 70 3 369 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)
P17327 1.08e-173 490 72 3 353 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14176 6.17e-167 473 71 2 353 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
P46921 6.97e-76 239 46 0 273 1 opuAB Glycine betaine transport system permease protein OpuAB Bacillus subtilis (strain 168)
Q9RR45 2.42e-61 201 46 3 277 1 gbuB Glycine betaine/carnitine transport permease protein GbuB Listeria monocytogenes serotype 1/2a (strain 10403S)
Q4FL38 1.16e-38 150 36 0 227 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
Q4FL38 1.96e-31 129 35 2 203 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
Q5LT64 6.55e-37 144 33 0 245 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LT64 1.36e-31 129 35 1 225 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q8Y775 1.57e-23 105 40 0 183 1 egtUBC Probable ergothioneine transporter EgtUBC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
Q9KHT8 3.35e-22 97 29 2 200 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes
G2JZ43 3.35e-22 97 29 2 200 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes serotype 1/2a (strain 10403S)
A0A0H2XK79 1.07e-20 97 36 0 180 3 egtUBC Probable ergothioneine transporter EgtUBC Staphylococcus aureus (strain USA300)
Q9KHT6 1.47e-20 92 33 0 142 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes
G2JZ41 1.47e-20 92 33 0 142 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes serotype 1/2a (strain 10403S)
Q837Z8 1.82e-20 96 31 1 189 3 egtUBC Probable ergothioneine transporter EgtUBC Enterococcus faecalis (strain ATCC 700802 / V583)
Q45461 2.24e-20 91 32 1 175 2 opuBB Choline transport system permease protein OpuBB Bacillus subtilis (strain 168)
O34878 3.83e-19 88 31 0 175 1 opuCB Glycine betaine/carnitine/choline transport system permease protein OpuCB Bacillus subtilis (strain 168)
O34742 4.05e-19 88 31 0 142 1 opuCD Glycine betaine/carnitine/choline transport system permease protein OpuCD Bacillus subtilis (strain 168)
P39775 1.59e-18 87 30 0 142 2 opuBD Choline transport system permease protein OpuBD Bacillus subtilis (strain 168)
A0A0H2ZQB9 1.78e-18 90 32 0 162 1 egtUBC Ergothioneine transporter EgtUBC Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8ZPK1 6.69e-18 85 28 4 228 1 osmY Osmoprotectant import permease protein OsmY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P33361 2.18e-16 83 28 2 191 1 yehY Glycine betaine uptake system permease protein YehY Escherichia coli (strain K12)
P33359 2.48e-14 75 31 3 175 1 yehW Glycine betaine uptake system permease protein YehW Escherichia coli (strain K12)
A9WGD1 1.34e-12 70 30 1 189 1 ribX Riboflavin transport system permease protein RibX Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q47539 4.75e-12 69 30 1 154 3 tauC Taurine transport system permease protein TauC Escherichia coli (strain K12)
Q8ZPK3 1.05e-10 64 34 4 187 1 osmW Osmoprotectant import permease protein OsmW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5Z7I3 2.17e-10 65 24 3 195 1 egtU Ergothioneine transport permease/ergothioneine binding protein EgtU Helicobacter pylori (strain G27)
Q9KTJ6 4.13e-09 59 31 6 192 3 metI Probable D-methionine transport system permease protein MetI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
P75851 2.73e-08 57 31 2 151 1 ssuC Putative aliphatic sulfonates transport permease protein SsuC Escherichia coli (strain K12)
O32168 3.9e-08 57 26 3 166 1 metP Methionine import system permease protein MetP Bacillus subtilis (strain 168)
P38044 3.19e-07 54 24 3 197 1 nrtB Nitrate import permease protein NrtB Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P40401 5.03e-07 54 30 4 164 2 ssuC Putative aliphatic sulfonates transport permease protein SsuC Bacillus subtilis (strain 168)
Q57856 7.67e-07 53 25 3 184 3 MJ0413 Putative ABC transporter permease protein MJ0413 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9K9G6 9.18e-07 53 26 4 161 3 thiX Formylaminopyrimidine transport permease protein ThiX Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
O50501 1.52e-06 53 31 5 144 1 ngcG Diacetylchitobiose uptake system permease protein NgcG Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q83RR7 3.59e-06 51 27 2 144 3 potC Spermidine/putrescine transport system permease protein PotC Shigella flexneri
P0AFK6 4.23e-06 51 27 2 144 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli (strain K12)
P0AFK7 4.23e-06 51 27 2 144 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AFK8 4.23e-06 51 27 2 144 3 potC Spermidine/putrescine transport system permease protein PotC Escherichia coli O157:H7
Q55461 6.04e-06 50 23 2 153 2 cmpB Bicarbonate transport system permease protein CmpB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q57306 1.67e-05 49 25 3 145 3 HI_0355 Probable ABC transporter permease protein HI_0355 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q2YJB4 2.22e-05 48 25 1 180 3 BAB2_1148 Probable ABC transporter permease protein BAB2_1148 Brucella abortus (strain 2308)
Q576D9 2.22e-05 48 25 1 180 3 BruAb2_1124 Probable ABC transporter permease protein BruAb2_1124 Brucella abortus biovar 1 (strain 9-941)
Q8YDR8 2.79e-05 48 25 1 180 3 BMEII0107 Probable ABC transporter permease protein BMEII0107 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q5MZ55 3.6e-05 48 25 2 153 3 cmpB Bicarbonate transport system permease protein CmpB Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55106 3.6e-05 48 25 2 153 1 cmpB Bicarbonate transport system permease protein CmpB Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P46340 4.03e-05 48 26 3 137 3 yqgI Probable ABC transporter permease protein YqgI Bacillus subtilis (strain 168)
Q9CK96 4.98e-05 47 27 2 140 3 metI Probable D-methionine transport system permease protein MetI Pasteurella multocida (strain Pm70)
Q8FUN2 7.37e-05 47 25 1 180 3 BRA1188 Probable ABC transporter permease protein BRA1188/BS1330_II1179 Brucella suis biovar 1 (strain 1330)
P07654 0.000124 47 30 2 126 1 pstA Phosphate transport system permease protein PstA Escherichia coli (strain K12)
Q8ZRN0 0.000252 45 25 3 148 3 metI D-methionine transport system permease protein MetI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8Z991 0.0003 45 25 3 148 3 metI D-methionine transport system permease protein MetI Salmonella typhi
P46492 0.00063 44 26 3 140 3 metI Probable D-methionine transport system permease protein MetI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8ZH39 0.000798 43 26 4 148 3 metI D-methionine transport system permease protein MetI Yersinia pestis
P45170 0.00087 44 35 1 77 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_12870
Feature type CDS
Gene proW
Product glycine betaine/L-proline ABC transporter permease ProW
Location 125115 - 126254 (strand: 1)
Length 1140 (nucleotides) / 379 (amino acids)

Contig

Accession ZDB_690
Length 144397 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1569
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4176 Amino acid transport and metabolism (E) E ABC-type proline/glycine betaine transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02001 glycine betaine/proline transport system permease protein ABC transporters -

Protein Sequence

MSRNNQQDTELDPWAATSEPDPSSVQTAPDAADSSDPWGSAADTGGADADPWGGAADSGSDWLDAAPADTGPAFDWANPFDHSLIPFDNWVTDAINWIVLHFRPVFQGIRVPIDFVLTTFEQGLTAIPAPIAILIFALLAWQMSGKGLGLATVVSLTFIGAIGAWNEAMVTLSLVLTALIFCIIIGLPTGIALARHERAAKFIRPLLDAMQTTPAFVYLVPIVMLFGIGNVPGVVVTIIFALPPVIRLTILGIRQVPADLVEAAESFGANPRQMLFKVQLPLAMPTIMAGINQTLMLALSMVVIASMIAVGGLGQMVLRGIGRLDMGLASVGGAGIVILAIILDRLTQSLGKDSRSKAGRRWYHTGPAGLITRPFRRAP

Flanking regions ( +/- flanking 50bp)

GGTTATCTCAAAAGGGATGCTACTGCAGGCTTTAGATAAGGAGACGCCGAATGAGCCGGAATAATCAACAGGATACAGAACTGGATCCGTGGGCGGCAACATCAGAGCCGGATCCTTCATCAGTACAAACAGCCCCTGACGCCGCAGACAGCAGTGATCCGTGGGGAAGTGCCGCCGATACCGGCGGTGCGGATGCCGACCCGTGGGGTGGCGCGGCGGACAGCGGCAGTGACTGGCTGGATGCCGCACCGGCAGATACCGGCCCCGCGTTTGACTGGGCAAATCCGTTTGACCACTCGCTGATCCCGTTTGACAACTGGGTGACCGATGCCATCAACTGGATTGTGCTGCACTTCCGTCCGGTCTTTCAGGGCATCCGTGTGCCGATCGACTTTGTGCTCACGACCTTTGAACAGGGACTGACCGCCATTCCGGCGCCGATCGCCATTCTTATCTTTGCCCTGCTCGCCTGGCAGATGAGCGGCAAAGGGCTGGGACTTGCCACCGTGGTATCACTGACCTTTATCGGTGCCATCGGGGCATGGAATGAAGCAATGGTGACTCTGTCACTGGTTCTGACCGCCCTGATATTCTGTATTATCATCGGGTTACCGACCGGTATTGCCCTGGCGCGCCATGAACGCGCCGCGAAATTTATCCGTCCGCTGCTTGATGCCATGCAGACAACACCGGCTTTCGTCTATCTGGTGCCGATTGTCATGCTGTTCGGTATCGGTAACGTGCCGGGTGTGGTGGTGACCATTATCTTCGCCCTGCCGCCGGTGATCCGCCTGACTATCCTCGGGATCCGTCAGGTGCCCGCTGACCTGGTCGAAGCCGCAGAATCCTTTGGTGCCAATCCGCGTCAGATGCTGTTTAAAGTCCAGCTGCCGCTGGCAATGCCGACCATCATGGCCGGGATCAACCAGACGCTGATGCTGGCGCTGTCAATGGTGGTTATCGCCTCCATGATCGCCGTCGGCGGTCTGGGACAGATGGTACTGCGCGGTATCGGCCGCCTCGACATGGGGCTGGCGTCTGTCGGCGGTGCGGGGATTGTCATTCTCGCCATTATTCTTGACCGTCTGACACAATCACTCGGGAAAGATTCCCGCAGCAAAGCCGGCCGCCGCTGGTATCACACCGGTCCAGCCGGGCTTATCACCCGTCCGTTCCGCCGCGCGCCGTAACACACGGCAGGGGGCTTCCGCTCCCGCTCATTATCACCCTGCCGCTGTTA