Homologs in group_1617

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_10165 FBDBKF_10165 74.2 Morganella morganii S1 proW glycine betaine/L-proline ABC transporter permease ProW
EHELCC_04965 EHELCC_04965 74.2 Morganella morganii S2 proW glycine betaine/L-proline ABC transporter permease ProW
NLDBIP_04965 NLDBIP_04965 74.2 Morganella morganii S4 proW glycine betaine/L-proline ABC transporter permease ProW
LHKJJB_13665 LHKJJB_13665 74.2 Morganella morganii S3 proW glycine betaine/L-proline ABC transporter permease ProW
HKOGLL_12870 HKOGLL_12870 74.2 Morganella morganii S5 proW glycine betaine/L-proline ABC transporter permease ProW
F4V73_RS00175 F4V73_RS00175 75.7 Morganella psychrotolerans proW glycine betaine/L-proline ABC transporter permease ProW

Distribution of the homologs in the orthogroup group_1617

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1617

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
E0SCY2 0.0 539 66 5 416 1 ousW Glycine betaine/choline transport system permease protein OusW Dickeya dadantii (strain 3937)
P17327 0.0 518 76 3 356 2 proW Glycine betaine/proline betaine transport system permease protein ProW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P14176 4.23e-176 498 74 3 356 1 proW Glycine betaine/proline betaine transport system permease protein ProW Escherichia coli (strain K12)
P46921 7e-76 240 45 0 275 1 opuAB Glycine betaine transport system permease protein OpuAB Bacillus subtilis (strain 168)
Q9RR45 8.95e-64 209 48 3 279 1 gbuB Glycine betaine/carnitine transport permease protein GbuB Listeria monocytogenes serotype 1/2a (strain 10403S)
Q4FL38 2.25e-35 141 37 0 210 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
Q4FL38 3.21e-28 120 31 8 290 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Pelagibacter ubique (strain HTCC1062)
Q5LT64 2.55e-35 140 33 0 242 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
Q5LT64 2.41e-31 129 35 0 213 1 tmoV Trimethylamine N-oxide transport system permease protein TmoV Ruegeria pomeroyi (strain ATCC 700808 / DSM 15171 / DSS-3)
A0A0H2XK79 1.42e-23 105 40 0 180 3 egtUBC Probable ergothioneine transporter EgtUBC Staphylococcus aureus (strain USA300)
Q8Y775 4.31e-23 104 39 0 179 1 egtUBC Probable ergothioneine transporter EgtUBC Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
P33361 4.3e-21 97 29 2 204 1 yehY Glycine betaine uptake system permease protein YehY Escherichia coli (strain K12)
P39775 3.73e-20 91 33 0 142 2 opuBD Choline transport system permease protein OpuBD Bacillus subtilis (strain 168)
Q837Z8 1.34e-19 94 32 1 181 3 egtUBC Probable ergothioneine transporter EgtUBC Enterococcus faecalis (strain ATCC 700802 / V583)
O34742 3.16e-19 89 33 0 142 1 opuCD Glycine betaine/carnitine/choline transport system permease protein OpuCD Bacillus subtilis (strain 168)
Q9KHT6 5.16e-19 88 31 0 142 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes
G2JZ41 5.16e-19 88 31 0 142 1 opuCD Carnitine transport permease protein OpuCD Listeria monocytogenes serotype 1/2a (strain 10403S)
Q9KHT8 1.27e-18 87 27 1 180 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes
G2JZ43 1.27e-18 87 27 1 180 1 opuCB Carnitine transport permease protein OpuCB Listeria monocytogenes serotype 1/2a (strain 10403S)
Q45461 4.56e-18 85 29 1 175 2 opuBB Choline transport system permease protein OpuBB Bacillus subtilis (strain 168)
O34878 9.52e-18 84 30 0 175 1 opuCB Glycine betaine/carnitine/choline transport system permease protein OpuCB Bacillus subtilis (strain 168)
A0A0H2ZQB9 1.91e-17 87 31 1 167 1 egtUBC Ergothioneine transporter EgtUBC Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
Q8ZPK1 4.28e-16 80 30 1 184 1 osmY Osmoprotectant import permease protein OsmY Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B5Z7I3 2.13e-14 78 27 4 219 1 egtU Ergothioneine transport permease/ergothioneine binding protein EgtU Helicobacter pylori (strain G27)
A9WGD1 1.8e-13 73 32 1 183 1 ribX Riboflavin transport system permease protein RibX Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q47539 1.03e-12 71 31 1 154 3 tauC Taurine transport system permease protein TauC Escherichia coli (strain K12)
P33359 1.85e-12 70 30 3 190 1 yehW Glycine betaine uptake system permease protein YehW Escherichia coli (strain K12)
Q9KTJ6 2.99e-11 66 33 7 193 3 metI Probable D-methionine transport system permease protein MetI Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
O32168 5.42e-10 62 27 3 166 1 metP Methionine import system permease protein MetP Bacillus subtilis (strain 168)
Q8ZPK3 7.63e-10 62 32 4 188 1 osmW Osmoprotectant import permease protein OsmW Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q57856 2.23e-08 58 27 7 232 3 MJ0413 Putative ABC transporter permease protein MJ0413 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
Q9K9G6 6.16e-08 57 25 5 210 3 thiX Formylaminopyrimidine transport permease protein ThiX Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
P38044 2.5e-07 55 26 3 192 1 nrtB Nitrate import permease protein NrtB Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P46492 2.58e-07 54 29 3 140 3 metI Probable D-methionine transport system permease protein MetI Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P75851 4.05e-07 54 31 2 150 1 ssuC Putative aliphatic sulfonates transport permease protein SsuC Escherichia coli (strain K12)
Q57306 7.25e-07 53 26 3 141 3 HI_0355 Probable ABC transporter permease protein HI_0355 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P40401 6.22e-06 51 28 4 165 2 ssuC Putative aliphatic sulfonates transport permease protein SsuC Bacillus subtilis (strain 168)
P31547 7.93e-06 50 27 3 148 1 metI D-methionine transport system permease protein MetI Escherichia coli (strain K12)
Q8ZRN0 8.08e-06 50 27 3 148 3 metI D-methionine transport system permease protein MetI Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8ZH39 9.29e-06 50 30 5 150 3 metI D-methionine transport system permease protein MetI Yersinia pestis
Q8Z991 9.47e-06 50 27 3 148 3 metI D-methionine transport system permease protein MetI Salmonella typhi
Q55461 1.02e-05 50 24 2 153 2 cmpB Bicarbonate transport system permease protein CmpB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q8X800 1.22e-05 49 27 3 148 3 metI D-methionine transport system permease protein MetI Escherichia coli O157:H7
Q2YJB4 2.55e-05 48 26 1 180 3 BAB2_1148 Probable ABC transporter permease protein BAB2_1148 Brucella abortus (strain 2308)
Q576D9 2.55e-05 48 26 1 180 3 BruAb2_1124 Probable ABC transporter permease protein BruAb2_1124 Brucella abortus biovar 1 (strain 9-941)
Q8YDR8 3.14e-05 48 26 1 180 3 BMEII0107 Probable ABC transporter permease protein BMEII0107 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q9CK96 3.74e-05 48 27 3 140 3 metI Probable D-methionine transport system permease protein MetI Pasteurella multocida (strain Pm70)
P73451 4.04e-05 48 26 1 131 3 nrtB Nitrate import permease protein NrtB Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q6D3B2 5.74e-05 48 29 4 146 3 gsiD Glutathione transport system permease protein GsiD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q5MZ55 7.66e-05 47 27 2 132 3 cmpB Bicarbonate transport system permease protein CmpB Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q55106 7.66e-05 47 27 2 132 1 cmpB Bicarbonate transport system permease protein CmpB Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P45170 8.05e-05 47 35 1 77 3 potB Spermidine/putrescine transport system permease protein PotB Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8FUN2 0.000104 47 26 1 180 3 BRA1188 Probable ABC transporter permease protein BRA1188/BS1330_II1179 Brucella suis biovar 1 (strain 1330)
P46340 0.000117 47 28 3 125 3 yqgI Probable ABC transporter permease protein YqgI Bacillus subtilis (strain 168)
O50501 0.000201 46 28 5 139 1 ngcG Diacetylchitobiose uptake system permease protein NgcG Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
Q51881 0.000238 46 26 1 144 3 nrtB Nitrate import permease protein NrtB Phormidium laminosum
P58655 0.000582 45 27 3 125 3 pstA Phosphate transport system permease protein PstA Yersinia pestis
P07654 0.000656 45 26 2 126 1 pstA Phosphate transport system permease protein PstA Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS02025
Feature type CDS
Gene proW
Product glycine betaine/L-proline ABC transporter permease ProW
Location 478575 - 479804 (strand: -1)
Length 1230 (nucleotides) / 409 (amino acids)
In genomic island -

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1617
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4176 Amino acid transport and metabolism (E) E ABC-type proline/glycine betaine transport system, permease component

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K02001 glycine betaine/proline transport system permease protein ABC transporters -

Protein Sequence

MSKTNNQANPWETDTQEAATENANTTQNSAQETHNNTDTDNDPWATTDSNTTDTDPWSSSAGGDTGGADADPWGTGSGTDGSDLSSGTDWLDAMPTESTPDHFNIMDPFNHTLIPLDSWVTDGIDWIVLHFRPIFQGIRVPVDLVLGGFENFLTSMPAPVAIILFSLIAWQLSGKVMGISAFISLILIGAIGAWSEAMITLALVLTSLLFCLIIGLPLGIWLAHSDRASKIVRPLLDAMQTTPAFVYLVPIVMLFGIGNVPGVVVTIIFALPPIVRLTILGIKQVPEDLIEAAQSFGANPRQMLFKVQLPLAMPTIMAGVNQTLMLALSMVVIASMIAVGGLGQMVLRGIGRLDMGLAAVGGAGIVILAIILDRLTQSLGQNSRLKGNRRWYMTGPIGLICRLFGKKAA

Flanking regions ( +/- flanking 50bp)

TTTAATTTCGAAAGGAATGTTGTTACAAGCACTGGATAAGGAGACACCAAATGAGTAAGACAAATAACCAAGCCAATCCTTGGGAAACGGACACTCAAGAAGCGGCAACAGAAAACGCCAATACAACACAAAATTCAGCGCAAGAAACGCATAACAACACAGATACAGACAATGATCCTTGGGCAACCACGGATAGCAACACTACTGATACCGACCCTTGGAGTAGTAGCGCTGGCGGTGATACCGGTGGAGCTGATGCTGATCCTTGGGGTACAGGGAGTGGCACTGACGGCAGTGATCTCTCTTCTGGTACTGATTGGCTAGATGCCATGCCAACAGAAAGTACACCTGATCACTTTAATATTATGGATCCATTTAATCATACGCTGATCCCACTAGATTCTTGGGTAACGGATGGTATTGACTGGATTGTGCTGCATTTTCGTCCTATTTTCCAAGGGATACGCGTTCCAGTCGATTTAGTATTAGGTGGCTTTGAAAACTTTCTTACCTCAATGCCTGCACCTGTTGCGATTATTTTATTTTCACTGATTGCATGGCAACTTTCAGGTAAGGTGATGGGAATAAGCGCTTTTATTTCACTGATCTTAATCGGTGCTATTGGTGCATGGTCTGAAGCGATGATAACCCTTGCATTAGTGCTGACCTCATTACTATTCTGCCTGATTATTGGTCTCCCCTTAGGGATATGGCTTGCACATAGTGACAGAGCATCAAAAATTGTCAGACCACTTTTAGATGCCATGCAAACAACCCCCGCTTTCGTTTACTTAGTACCTATCGTGATGTTATTCGGGATTGGTAACGTACCCGGTGTAGTTGTCACGATTATTTTCGCCTTACCACCGATAGTGCGATTAACTATTTTAGGTATCAAACAAGTACCGGAAGATCTCATTGAAGCGGCTCAATCATTTGGGGCAAATCCTCGACAAATGTTGTTTAAAGTACAATTACCGCTGGCAATGCCAACGATTATGGCTGGGGTCAACCAAACCTTAATGTTAGCACTGTCAATGGTTGTTATCGCATCAATGATAGCCGTTGGTGGTTTAGGTCAAATGGTATTACGTGGTATTGGTCGCCTAGATATGGGATTAGCGGCTGTAGGTGGTGCCGGTATTGTGATCCTCGCGATTATTCTTGACCGCTTAACTCAATCTTTAGGCCAAAATAGTCGCCTGAAAGGTAATAGACGCTGGTATATGACAGGCCCGATTGGTTTGATCTGCCGCCTGTTTGGTAAAAAAGCCGCATAACTCATACTGGCAATAAGATTAACTAACAATCAAACATATTTATTCAATTA