Homologs in group_1008

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05630 FBDBKF_05630 100.0 Morganella morganii S1 sapC putrescine export ABC transporter permease SapC
EHELCC_11960 EHELCC_11960 100.0 Morganella morganii S2 sapC putrescine export ABC transporter permease SapC
NLDBIP_12300 NLDBIP_12300 100.0 Morganella morganii S4 sapC putrescine export ABC transporter permease SapC
LHKJJB_12160 LHKJJB_12160 100.0 Morganella morganii S3 sapC putrescine export ABC transporter permease SapC
F4V73_RS03675 F4V73_RS03675 90.2 Morganella psychrotolerans sapC putrescine export ABC transporter permease SapC
PMI_RS06665 PMI_RS06665 73.6 Proteus mirabilis HI4320 sapC putrescine export ABC transporter permease SapC

Distribution of the homologs in the orthogroup group_1008

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1008

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGH7 1.94e-142 405 69 0 296 3 sapC Peptide transport system permease protein SapC Shigella flexneri
P0AGH5 1.94e-142 405 69 0 296 1 sapC Putrescine export system permease protein SapC Escherichia coli (strain K12)
P0AGH6 1.94e-142 405 69 0 296 3 sapC Peptide transport system permease protein SapC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A2J5 3.93e-141 402 68 0 296 2 sapC Peptide transport system permease protein SapC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J6 3.93e-141 402 68 0 296 3 sapC Peptide transport system permease protein SapC Salmonella typhi
P45287 2.55e-91 276 48 0 278 3 sapC Peptide transport system permease protein SapC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZFV0 2.17e-64 207 42 0 284 1 dppC Di/tripeptide transport system permease protein DppC Pseudomonas aeruginosa (strain UCBPP-PA14)
P51000 1.15e-56 187 35 0 283 3 dppC Dipeptide transport system permease protein DppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEG1 1.68e-53 179 40 0 283 1 dppC Dipeptide transport system permease protein DppC Escherichia coli (strain K12)
P0AEG2 1.68e-53 179 40 0 283 3 dppC Dipeptide transport system permease protein DppC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG3 1.68e-53 179 40 0 283 3 dppC Dipeptide transport system permease protein DppC Escherichia coli O157:H7
P94312 2.95e-51 173 36 3 286 3 dppC Dipeptide transport system permease protein DppC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q8FJK8 3.59e-48 166 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJL6 3.59e-48 166 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
Q3Z3V1 4.35e-48 165 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Shigella sonnei (strain Ss046)
Q323W2 4.35e-48 165 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Shigella boydii serotype 4 (strain Sb227)
Q8X6V6 4.35e-48 165 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O157:H7
P75799 6.75e-48 165 34 2 290 1 gsiD Glutathione transport system permease protein GsiD Escherichia coli (strain K12)
Q1RE93 7.59e-48 164 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli (strain UTI89 / UPEC)
A1A971 7.59e-48 164 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O1:K1 / APEC
Q83S25 1.46e-47 164 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Shigella flexneri
P0C2L2 1.46e-47 164 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Shigella flexneri serotype 5b (strain 8401)
Q32IB8 2.33e-47 163 34 2 290 3 gsiD Glutathione transport system permease protein GsiD Shigella dysenteriae serotype 1 (strain Sd197)
Q6D3B2 4.76e-44 155 33 2 290 3 gsiD Glutathione transport system permease protein GsiD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7CQV4 6.05e-43 152 35 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF88 6.05e-43 152 35 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella typhi
Q5PGP6 6.05e-43 152 35 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57RA9 6.05e-43 152 35 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella choleraesuis (strain SC-B67)
P77463 1.26e-37 138 34 3 256 1 ddpC Probable D,D-dipeptide transport system permease protein DdpC Escherichia coli (strain K12)
Q8YDG8 1.58e-33 127 33 2 249 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 1.58e-33 127 33 2 249 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 1.58e-33 127 33 2 249 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)
Q8FUW9 1.72e-33 127 34 2 245 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)
Q7A0Y0 2.01e-31 121 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MW2)
Q6G9H9 2.01e-31 121 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MSSA476)
Q5HG39 2.01e-31 121 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain COL)
Q2FYQ6 2.01e-31 121 33 1 224 1 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH56 2.01e-31 121 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain USA300)
Q7A5Q7 4.24e-31 120 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain N315)
Q99UA1 4.24e-31 120 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q2YXY8 5.93e-31 120 32 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain bovine RF122 / ET3-1)
P26904 6.64e-31 120 29 2 274 2 dppC Dipeptide transport system permease protein DppC Bacillus subtilis (strain 168)
Q6GH26 1.27e-30 119 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MRSA252)
P42063 4.72e-30 118 28 4 281 3 appC Oligopeptide transport system permease protein AppC Bacillus subtilis (strain 168)
Q53192 2.23e-28 113 32 1 216 3 NGR_a01420 Probable peptide ABC transporter permease protein y4tQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P0AFA9 2.94e-28 112 29 3 249 1 nikC Nickel transport system permease protein NikC Escherichia coli (strain K12)
P0AFB0 2.94e-28 112 29 3 249 3 nikC Nickel transport system permease protein NikC Escherichia coli O157:H7
P24139 1.01e-25 106 28 3 275 1 oppC Oligopeptide transport system permease protein OppC Bacillus subtilis (strain 168)
Q8FWN9 3.12e-25 105 30 2 233 3 BRA0407 Putative peptide permease protein BRA0407/BS1330_II0404 Brucella suis biovar 1 (strain 1330)
A5VU89 1.47e-24 103 29 2 233 3 BOV_A0350 Putative peptide permease protein BOV_A0350 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBN8 2.37e-24 103 29 2 233 3 BMEII0861 Putative peptide permease protein BMEII0861 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YK65 2.37e-24 103 29 2 233 3 BAB2_0815 Putative peptide permease protein BAB2_0815 Brucella abortus (strain 2308)
Q577J7 2.37e-24 103 29 2 233 3 BruAb2_0794 Putative peptide permease protein BruAb2_0794 Brucella abortus biovar 1 (strain 9-941)
Q2FVE9 8.34e-24 101 29 3 248 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JU73 1.22e-23 100 29 3 248 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain Mu50 / ATCC 700699)
P08006 1.7e-22 97 27 9 304 1 oppC Oligopeptide transport system permease protein OppC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45053 9.64e-21 93 26 5 292 3 oppC Oligopeptide transport system permease protein OppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0A4P0 4.16e-20 91 28 5 277 3 oppC Oligopeptide transport system permease protein OppC Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N9 4.46e-20 91 28 5 277 1 oppC Oligopeptide transport system permease protein OppC Lactococcus lactis subsp. lactis (strain IL1403)
P66965 4.67e-20 91 26 3 247 3 BQ2027_MB1313C Putative peptide transport permease protein Mb1313c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ9 4.67e-20 91 26 3 247 1 Rv1282c Putative peptide transport permease protein Rv1282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ8 4.67e-20 91 26 3 247 3 MT1319 Putative peptide transport permease protein MT1319 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AFH6 9.61e-19 87 28 9 302 1 oppC Oligopeptide transport system permease protein OppC Escherichia coli (strain K12)
P0AFH7 9.61e-19 87 28 9 302 3 oppC Oligopeptide transport system permease protein OppC Escherichia coli O157:H7
P0A4N0 2.68e-13 72 24 2 221 3 amiD Oligopeptide transport system permease protein AmiD Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M9 2.68e-13 72 24 2 221 3 amiD Oligopeptide transport system permease protein AmiD Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
A2RI76 1.89e-12 70 24 2 220 1 dppC Dipeptide transport system permease protein DppC Lactococcus lactis subsp. cremoris (strain MG1363)
Q7D203 7.24e-11 65 29 5 212 3 yejE Peptidoglycan transport system permease protein YejE Agrobacterium fabrum (strain C58 / ATCC 33970)
P33915 5.57e-10 62 27 5 221 1 yejE Inner membrane ABC transporter permease protein YejE Escherichia coli (strain K12)
P75553 0.000886 44 26 5 163 3 oppC Oligopeptide transport system permease protein OppC Mycoplasma pneumoniae (strain ATCC 29342 / M129 / Subtype 1)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10775
Feature type CDS
Gene sapC
Product putrescine export ABC transporter permease SapC
Location 46992 - 47882 (strand: -1)
Length 891 (nucleotides) / 296 (amino acids)

Contig

Accession ZDB_688
Length 181491 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1008
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component
PF12911 N-terminal TM domain of oligopeptide transport permease C

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4171 Defense mechanisms (V) V ABC-type antimicrobial peptide export system, permease component SapC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19228 cationic peptide transport system permease protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters
-

Protein Sequence

MPSDNFYREDRMPSPGRVIWQHFTADIPAMIGFYGVLFLIALAIGGTWIAPYALDQQFAGHQLLPPSWSHYGNVAFFLGTDDLGRDIFSRLILGTQSTFGGALLVTIIAAVAGIIIGCLAGMTTGLRSAIFNHMFDTLLALPSLLLAIIVVAFFGASLSHAMIAVALALLPRIVRMIYIAVHDELDKEYVIAARLDGASNLNILIHTVLPNISAVTVTELTRALSIAILDIAALGFLELGAQLPSPEWGAMLGDSLELIYVAPWTVLLPGTAILISVLLVNLLGTGLQRAINAGVE

Flanking regions ( +/- flanking 50bp)

GTCAGATATTCTGGGGGCCGTCAGCAGCCCGCTGAAACATAAGGAATGGTATGCCTTCAGATAATTTCTACCGTGAAGACCGGATGCCGTCACCGGGGCGGGTTATCTGGCAGCATTTCACCGCAGATATTCCGGCTATGATCGGTTTTTACGGCGTGCTGTTTCTGATTGCGCTGGCGATCGGCGGCACCTGGATAGCCCCTTATGCGCTCGACCAGCAGTTTGCGGGTCATCAGTTACTGCCGCCTTCCTGGTCTCATTACGGGAATGTCGCCTTCTTCCTCGGTACGGACGATCTCGGCCGTGATATTTTCAGCCGTCTGATCCTCGGTACACAATCCACCTTCGGCGGCGCACTGCTGGTGACCATCATTGCCGCTGTCGCCGGGATTATCATCGGCTGTCTGGCAGGGATGACCACCGGTCTGCGCTCAGCCATTTTTAACCATATGTTTGATACCCTGCTGGCGCTGCCCTCTCTGCTGCTGGCGATTATTGTGGTGGCCTTTTTTGGCGCCAGTCTCAGCCACGCCATGATTGCCGTGGCACTGGCACTGCTGCCGCGTATTGTGCGGATGATTTATATCGCAGTTCATGATGAGCTTGATAAGGAATACGTGATTGCCGCCCGGCTCGACGGTGCGTCCAACCTCAATATTCTGATCCATACTGTGCTGCCGAATATCAGTGCCGTGACCGTCACCGAACTGACGCGCGCCCTGTCCATTGCTATCCTTGATATTGCCGCGCTCGGTTTTCTCGAGCTGGGGGCACAGCTGCCGTCCCCGGAATGGGGGGCGATGCTCGGGGATTCTCTGGAACTGATTTATGTGGCGCCCTGGACCGTACTTCTGCCGGGAACCGCCATCCTTATCAGTGTTCTGCTGGTGAATCTGCTCGGTACCGGGTTACAGCGTGCTATTAATGCGGGGGTTGAATAATGCCGTTACTGGATATCCGCAATTTAACCATTGAATTTATGACTGCCGCA