Homologs in group_1008

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05630 FBDBKF_05630 73.6 Morganella morganii S1 sapC putrescine export ABC transporter permease SapC
EHELCC_11960 EHELCC_11960 73.6 Morganella morganii S2 sapC putrescine export ABC transporter permease SapC
NLDBIP_12300 NLDBIP_12300 73.6 Morganella morganii S4 sapC putrescine export ABC transporter permease SapC
LHKJJB_12160 LHKJJB_12160 73.6 Morganella morganii S3 sapC putrescine export ABC transporter permease SapC
HKOGLL_10775 HKOGLL_10775 73.6 Morganella morganii S5 sapC putrescine export ABC transporter permease SapC
F4V73_RS03675 F4V73_RS03675 72.3 Morganella psychrotolerans sapC putrescine export ABC transporter permease SapC

Distribution of the homologs in the orthogroup group_1008

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1008

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGH7 2.85e-144 410 68 1 297 3 sapC Peptide transport system permease protein SapC Shigella flexneri
P0AGH5 2.85e-144 410 68 1 297 1 sapC Putrescine export system permease protein SapC Escherichia coli (strain K12)
P0AGH6 2.85e-144 410 68 1 297 3 sapC Peptide transport system permease protein SapC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A2J5 5.29e-143 407 68 1 297 2 sapC Peptide transport system permease protein SapC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J6 5.29e-143 407 68 1 297 3 sapC Peptide transport system permease protein SapC Salmonella typhi
P45287 2.43e-92 278 46 0 278 3 sapC Peptide transport system permease protein SapC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZFV0 8.02e-65 208 39 0 284 1 dppC Di/tripeptide transport system permease protein DppC Pseudomonas aeruginosa (strain UCBPP-PA14)
P51000 2.46e-61 199 35 0 283 3 dppC Dipeptide transport system permease protein DppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P94312 1.32e-54 182 35 2 285 3 dppC Dipeptide transport system permease protein DppC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P0AEG1 1.48e-53 179 38 0 283 1 dppC Dipeptide transport system permease protein DppC Escherichia coli (strain K12)
P0AEG2 1.48e-53 179 38 0 283 3 dppC Dipeptide transport system permease protein DppC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG3 1.48e-53 179 38 0 283 3 dppC Dipeptide transport system permease protein DppC Escherichia coli O157:H7
Q3Z3V1 5e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella sonnei (strain Ss046)
Q323W2 5e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella boydii serotype 4 (strain Sb227)
Q8X6V6 5e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O157:H7
Q83S25 5.33e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella flexneri
P0C2L2 5.33e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella flexneri serotype 5b (strain 8401)
Q8FJK8 5.38e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJL6 5.38e-45 157 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P75799 7.57e-45 157 31 3 298 1 gsiD Glutathione transport system permease protein GsiD Escherichia coli (strain K12)
Q1RE93 1.72e-44 156 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli (strain UTI89 / UPEC)
A1A971 1.72e-44 156 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O1:K1 / APEC
Q32IB8 3.59e-44 155 31 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella dysenteriae serotype 1 (strain Sd197)
P77463 1.88e-41 148 33 1 253 1 ddpC Probable D,D-dipeptide transport system permease protein DdpC Escherichia coli (strain K12)
Q7CQV4 5.34e-40 144 32 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF88 5.34e-40 144 32 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella typhi
Q5PGP6 5.34e-40 144 32 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57RA9 5.34e-40 144 32 2 262 3 gsiD Glutathione transport system permease protein GsiD Salmonella choleraesuis (strain SC-B67)
Q6D3B2 8.46e-40 144 29 1 289 3 gsiD Glutathione transport system permease protein GsiD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
P42063 4.36e-38 139 31 6 288 3 appC Oligopeptide transport system permease protein AppC Bacillus subtilis (strain 168)
P26904 3.23e-36 135 30 2 274 2 dppC Dipeptide transport system permease protein DppC Bacillus subtilis (strain 168)
Q2YXY8 9.53e-35 130 30 2 268 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q6GH26 1.83e-34 129 31 2 268 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MRSA252)
Q7A0Y0 8.02e-34 127 34 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MW2)
Q6G9H9 8.02e-34 127 34 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MSSA476)
Q5HG39 8.02e-34 127 34 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain COL)
Q2FYQ6 8.02e-34 127 34 1 224 1 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH56 8.02e-34 127 34 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain USA300)
Q7A5Q7 1.88e-33 126 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain N315)
Q99UA1 1.88e-33 126 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q53192 3.66e-33 126 31 1 226 3 NGR_a01420 Probable peptide ABC transporter permease protein y4tQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q8FUW9 1.67e-32 124 32 1 228 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)
Q8YDG8 1.7e-32 124 32 1 228 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 1.7e-32 124 32 1 228 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 1.7e-32 124 32 1 228 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)
P24139 2.11e-29 116 29 3 273 1 oppC Oligopeptide transport system permease protein OppC Bacillus subtilis (strain 168)
P0AFA9 3.07e-28 112 29 0 227 1 nikC Nickel transport system permease protein NikC Escherichia coli (strain K12)
P0AFB0 3.07e-28 112 29 0 227 3 nikC Nickel transport system permease protein NikC Escherichia coli O157:H7
Q8FWN9 8.91e-26 107 28 2 284 3 BRA0407 Putative peptide permease protein BRA0407/BS1330_II0404 Brucella suis biovar 1 (strain 1330)
A5VU89 4.47e-25 105 27 2 284 3 BOV_A0350 Putative peptide permease protein BOV_A0350 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBN8 5.95e-25 104 27 2 284 3 BMEII0861 Putative peptide permease protein BMEII0861 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YK65 5.95e-25 104 27 2 284 3 BAB2_0815 Putative peptide permease protein BAB2_0815 Brucella abortus (strain 2308)
Q577J7 5.95e-25 104 27 2 284 3 BruAb2_0794 Putative peptide permease protein BruAb2_0794 Brucella abortus biovar 1 (strain 9-941)
Q2FVE9 7.6e-24 101 27 0 218 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JU73 7.92e-24 101 27 0 218 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain Mu50 / ATCC 700699)
P0A4N9 1.15e-21 95 26 7 295 1 oppC Oligopeptide transport system permease protein OppC Lactococcus lactis subsp. lactis (strain IL1403)
P0A4P0 3.2e-21 94 25 5 295 3 oppC Oligopeptide transport system permease protein OppC Lactococcus lactis subsp. cremoris (strain SK11)
P08006 3.88e-21 94 27 3 258 1 oppC Oligopeptide transport system permease protein OppC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P66965 2.28e-20 92 27 2 248 3 BQ2027_MB1313C Putative peptide transport permease protein Mb1313c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ9 2.28e-20 92 27 2 248 1 Rv1282c Putative peptide transport permease protein Rv1282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ8 2.28e-20 92 27 2 248 3 MT1319 Putative peptide transport permease protein MT1319 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P45053 2.45e-20 92 28 2 220 3 oppC Oligopeptide transport system permease protein OppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AFH6 2.14e-19 89 26 2 257 1 oppC Oligopeptide transport system permease protein OppC Escherichia coli (strain K12)
P0AFH7 2.14e-19 89 26 2 257 3 oppC Oligopeptide transport system permease protein OppC Escherichia coli O157:H7
A2RI76 1.58e-15 79 21 2 304 1 dppC Dipeptide transport system permease protein DppC Lactococcus lactis subsp. cremoris (strain MG1363)
P0A4N0 7.84e-11 65 21 5 291 3 amiD Oligopeptide transport system permease protein AmiD Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M9 7.84e-11 65 21 5 291 3 amiD Oligopeptide transport system permease protein AmiD Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q7D203 9.58e-11 65 26 2 221 3 yejE Peptidoglycan transport system permease protein YejE Agrobacterium fabrum (strain C58 / ATCC 33970)
P33915 9.03e-10 62 26 3 229 1 yejE Inner membrane ABC transporter permease protein YejE Escherichia coli (strain K12)

  • Number of RefSeq hits:

General

Source Proteus mirabilis HI4320
Locus tag PMI_RS06665
Feature type CDS
Gene sapC
Product putrescine export ABC transporter permease SapC
Location 1458567 - 1459460 (strand: 1)
Length 894 (nucleotides) / 297 (amino acids)

Contig

Accession NC_010554
Length 4063606 nucleotides
Topology circular
Plasmid False

Orthology

Orthogroup group_1008
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component
PF12911 N-terminal TM domain of oligopeptide transport permease C

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4171 Defense mechanisms (V) V ABC-type antimicrobial peptide export system, permease component SapC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19228 cationic peptide transport system permease protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters		 -

Protein Sequence

MPLDSQFYKEKKTPSPAAVIWQCFSKDILSMVGFYGVIFLLILSIVGPYIAPYALDQQFFGHQLTPPSWYQNGNVTFFFGTDDLGRDVFSRILIGTSMTFGGAFIVTFAATLMGLIMGCLAGMTHGLKSAVLNHILDTLLSIPSLLLAIIVVAFVGASLEHAMIAIWLALLPRLVRMIYSAVNDELNKEYVIASRLDGASNISILWYTVLPNITPVLVSELTRAFSIAILDITALGFLNLGAQLPSPEWGAMLGDSLELIYAAPWTVLIPGATIMISVLLVNLLGDGLQRAINEGVE

Flanking regions ( +/- flanking 50bp)

ATCAGATATTGTCGGTGCGATGAGTAATCCAATGAAACACAAGGTGGGATATGCCTTTAGATAGCCAGTTTTATAAAGAGAAAAAAACACCATCACCGGCTGCGGTGATTTGGCAATGTTTTTCTAAAGATATTCTCTCCATGGTGGGCTTTTATGGTGTTATCTTCCTGTTAATATTAAGTATTGTTGGTCCTTATATTGCGCCTTATGCACTCGACCAACAATTCTTCGGTCATCAATTAACACCGCCTTCTTGGTATCAAAACGGTAATGTCACCTTCTTTTTTGGTACTGATGATTTAGGGCGCGATGTCTTTAGCCGTATTTTAATTGGTACGAGTATGACCTTTGGTGGCGCTTTTATTGTCACCTTTGCGGCGACACTGATGGGATTAATTATGGGTTGCCTTGCAGGAATGACCCACGGCCTAAAATCCGCAGTGTTAAATCATATTTTAGATACACTGTTATCCATTCCATCACTCTTATTAGCCATTATTGTGGTCGCTTTTGTAGGGGCAAGTTTAGAGCACGCCATGATAGCAATTTGGCTAGCACTACTCCCCCGCTTAGTGAGAATGATCTATTCAGCGGTAAATGATGAATTAAATAAAGAGTACGTTATTGCCTCACGTCTTGATGGTGCATCAAATATCTCTATTTTATGGTATACCGTATTGCCGAATATTACCCCAGTATTGGTTTCTGAATTAACTCGGGCTTTTTCTATCGCAATATTAGATATCACGGCATTAGGTTTTCTGAATTTAGGCGCTCAATTACCTTCACCTGAATGGGGGGCGATGCTCGGCGATTCCCTAGAGTTAATCTATGCTGCACCTTGGACAGTCCTTATCCCCGGAGCCACCATTATGATCAGTGTATTACTTGTCAATTTATTAGGGGATGGCTTACAACGTGCCATTAATGAGGGGGTGGAATAATGCCGTTATTAGACATACGCAACCTAACTATTGAGTTTATGACACCCGAT