Homologs in group_1075

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_05630 FBDBKF_05630 90.2 Morganella morganii S1 sapC putrescine export ABC transporter permease SapC
EHELCC_11960 EHELCC_11960 90.2 Morganella morganii S2 sapC putrescine export ABC transporter permease SapC
NLDBIP_12300 NLDBIP_12300 90.2 Morganella morganii S4 sapC putrescine export ABC transporter permease SapC
LHKJJB_12160 LHKJJB_12160 90.2 Morganella morganii S3 sapC putrescine export ABC transporter permease SapC
HKOGLL_10775 HKOGLL_10775 90.2 Morganella morganii S5 sapC putrescine export ABC transporter permease SapC
PMI_RS06665 PMI_RS06665 72.3 Proteus mirabilis HI4320 sapC putrescine export ABC transporter permease SapC

Distribution of the homologs in the orthogroup group_1075

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_1075

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P0AGH7 1.98e-140 400 68 0 296 3 sapC Peptide transport system permease protein SapC Shigella flexneri
P0AGH5 1.98e-140 400 68 0 296 1 sapC Putrescine export system permease protein SapC Escherichia coli (strain K12)
P0AGH6 1.98e-140 400 68 0 296 3 sapC Peptide transport system permease protein SapC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0A2J5 2.35e-139 397 67 0 296 2 sapC Peptide transport system permease protein SapC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P0A2J6 2.35e-139 397 67 0 296 3 sapC Peptide transport system permease protein SapC Salmonella typhi
P45287 2.87e-91 276 47 0 278 3 sapC Peptide transport system permease protein SapC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
A0A0H2ZFV0 4.32e-63 204 42 0 284 1 dppC Di/tripeptide transport system permease protein DppC Pseudomonas aeruginosa (strain UCBPP-PA14)
P51000 1.68e-58 192 38 2 284 3 dppC Dipeptide transport system permease protein DppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P0AEG1 6.05e-53 177 40 0 283 1 dppC Dipeptide transport system permease protein DppC Escherichia coli (strain K12)
P0AEG2 6.05e-53 177 40 0 283 3 dppC Dipeptide transport system permease protein DppC Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P0AEG3 6.05e-53 177 40 0 283 3 dppC Dipeptide transport system permease protein DppC Escherichia coli O157:H7
P94312 5.65e-48 165 34 4 293 3 dppC Dipeptide transport system permease protein DppC Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q3Z3V1 1.17e-46 161 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella sonnei (strain Ss046)
Q323W2 1.17e-46 161 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella boydii serotype 4 (strain Sb227)
Q8X6V6 1.17e-46 161 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O157:H7
Q8FJK8 1.34e-46 161 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
Q0TJL6 1.34e-46 161 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O6:K15:H31 (strain 536 / UPEC)
P75799 2.04e-46 161 33 3 298 1 gsiD Glutathione transport system permease protein GsiD Escherichia coli (strain K12)
Q83S25 2.93e-46 160 35 5 299 3 gsiD Glutathione transport system permease protein GsiD Shigella flexneri
P0C2L2 2.93e-46 160 35 5 299 3 gsiD Glutathione transport system permease protein GsiD Shigella flexneri serotype 5b (strain 8401)
Q1RE93 3.26e-46 160 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli (strain UTI89 / UPEC)
A1A971 3.26e-46 160 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Escherichia coli O1:K1 / APEC
Q32IB8 1.14e-45 159 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Shigella dysenteriae serotype 1 (strain Sd197)
Q6D3B2 9.12e-44 154 34 3 291 3 gsiD Glutathione transport system permease protein GsiD Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
Q7CQV4 3.12e-40 145 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
Q8XF88 3.12e-40 145 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Salmonella typhi
Q5PGP6 3.12e-40 145 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q57RA9 3.12e-40 145 33 3 298 3 gsiD Glutathione transport system permease protein GsiD Salmonella choleraesuis (strain SC-B67)
P77463 8.89e-38 138 33 1 253 1 ddpC Probable D,D-dipeptide transport system permease protein DdpC Escherichia coli (strain K12)
Q7A0Y0 1.69e-33 126 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MW2)
Q6G9H9 1.69e-33 126 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MSSA476)
Q5HG39 1.69e-33 126 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain COL)
Q2FYQ6 1.69e-33 126 33 1 224 1 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FH56 1.69e-33 126 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain USA300)
Q2YXY8 2.68e-33 126 31 2 257 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8YDG8 5.41e-33 125 34 2 246 3 BMEII0207/BMEII0208 Putative peptide transport system permease protein BMEII0207/BMEII0208 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YJK0 5.41e-33 125 34 2 246 3 BAB2_1051 Putative peptide transport system permease protein BAB2_1051 Brucella abortus (strain 2308)
Q8VQK5 5.41e-33 125 34 2 246 3 BruAb2_1032 Putative peptide transport system permease protein BruAb2_1032 Brucella abortus biovar 1 (strain 9-941)
Q6GH26 6.16e-33 125 31 2 257 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain MRSA252)
Q7A5Q7 6.56e-33 125 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain N315)
Q99UA1 6.56e-33 125 33 1 224 3 nikC Nickel import system permease protein NikC Staphylococcus aureus (strain Mu50 / ATCC 700699)
Q8FUW9 7.18e-33 125 34 2 246 3 BRA1093 Putative peptide transport system permease protein BRA1093/BS1330_II1085 Brucella suis biovar 1 (strain 1330)
P26904 2.77e-32 124 28 5 298 2 dppC Dipeptide transport system permease protein DppC Bacillus subtilis (strain 168)
P42063 7.47e-31 120 29 4 281 3 appC Oligopeptide transport system permease protein AppC Bacillus subtilis (strain 168)
P0AFA9 2.76e-28 113 31 5 250 1 nikC Nickel transport system permease protein NikC Escherichia coli (strain K12)
P0AFB0 2.76e-28 113 31 5 250 3 nikC Nickel transport system permease protein NikC Escherichia coli O157:H7
Q53192 1.78e-27 111 31 1 216 3 NGR_a01420 Probable peptide ABC transporter permease protein y4tQ Sinorhizobium fredii (strain NBRC 101917 / NGR234)
P24139 1.12e-25 106 26 1 271 1 oppC Oligopeptide transport system permease protein OppC Bacillus subtilis (strain 168)
Q8FWN9 8.34e-25 104 27 2 278 3 BRA0407 Putative peptide permease protein BRA0407/BS1330_II0404 Brucella suis biovar 1 (strain 1330)
A5VU89 5.43e-24 102 27 2 278 3 BOV_A0350 Putative peptide permease protein BOV_A0350 Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
Q8YBN8 7.3e-24 101 27 2 278 3 BMEII0861 Putative peptide permease protein BMEII0861 Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
Q2YK65 7.3e-24 101 27 2 278 3 BAB2_0815 Putative peptide permease protein BAB2_0815 Brucella abortus (strain 2308)
Q577J7 7.3e-24 101 27 2 278 3 BruAb2_0794 Putative peptide permease protein BruAb2_0794 Brucella abortus biovar 1 (strain 9-941)
Q2FVE9 2.54e-23 100 27 3 278 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain NCTC 8325 / PS 47)
A0A0H3JU73 3.42e-23 99 27 3 278 1 cntC Metal-staphylopine import system permease protein CntC Staphylococcus aureus (strain Mu50 / ATCC 700699)
P08006 8.88e-22 95 27 7 294 1 oppC Oligopeptide transport system permease protein OppC Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
P45053 1.64e-21 95 27 8 296 3 oppC Oligopeptide transport system permease protein OppC Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
P66965 1.41e-20 92 29 6 255 3 BQ2027_MB1313C Putative peptide transport permease protein Mb1313c Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
P9WFZ9 1.41e-20 92 29 6 255 1 Rv1282c Putative peptide transport permease protein Rv1282c Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WFZ8 1.41e-20 92 29 6 255 3 MT1319 Putative peptide transport permease protein MT1319 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
P0AFH6 5.78e-20 90 26 5 292 1 oppC Oligopeptide transport system permease protein OppC Escherichia coli (strain K12)
P0AFH7 5.78e-20 90 26 5 292 3 oppC Oligopeptide transport system permease protein OppC Escherichia coli O157:H7
P0A4P0 1.41e-18 87 27 5 277 3 oppC Oligopeptide transport system permease protein OppC Lactococcus lactis subsp. cremoris (strain SK11)
P0A4N9 1.84e-18 86 27 5 277 1 oppC Oligopeptide transport system permease protein OppC Lactococcus lactis subsp. lactis (strain IL1403)
A2RI76 4.07e-13 72 24 2 220 1 dppC Dipeptide transport system permease protein DppC Lactococcus lactis subsp. cremoris (strain MG1363)
P0A4N0 1.57e-12 70 24 2 221 3 amiD Oligopeptide transport system permease protein AmiD Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
P0A4M9 1.57e-12 70 24 2 221 3 amiD Oligopeptide transport system permease protein AmiD Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
P33915 1.52e-10 64 28 4 222 1 yejE Inner membrane ABC transporter permease protein YejE Escherichia coli (strain K12)
Q7D203 9.42e-10 62 28 4 192 3 yejE Peptidoglycan transport system permease protein YejE Agrobacterium fabrum (strain C58 / ATCC 33970)

  • Number of RefSeq hits:

General

Source Morganella psychrotolerans
Locus tag F4V73_RS03675
Feature type CDS
Gene sapC
Product putrescine export ABC transporter permease SapC
Location 780457 - 781347 (strand: -1)
Length 891 (nucleotides) / 296 (amino acids)
In genomic island -

Contig

Accession NZ_VXKB01000001
Length 2012992 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_1075
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00528 Binding-protein-dependent transport system inner membrane component
PF12911 N-terminal TM domain of oligopeptide transport permease C

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG4171 Defense mechanisms (V) V ABC-type antimicrobial peptide export system, permease component SapC

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K19228 cationic peptide transport system permease protein Cationic antimicrobial peptide (CAMP) resistance
ABC transporters
-

Protein Sequence

MHSDKLYREDQMPSPGRVIWQKFTADIPAMIGFYGVLFLLALTISGPYIAPYALDQQFIGYQLLPPSWSHYGNVAFFLGTDDLGRDILSRILIGTQSTFGGALLVTVTVAVSGIVIGCLAGMTHGLRSAIFNHMFDTLLALPSLLLAIIVVAFFGASLGNAMIAVALALLPRIVRMIYIAVHDELDKEYVIAARLDGASSLNIFIRTVLPNISAVTVTELTRALSIAILDIAALGFLELGAQLPSPEWGAMLGDSLELIYVAPWSVILPGTAILISVLLVNLLGTGLQRAINAGVE

Flanking regions ( +/- flanking 50bp)

ATCCGATATCCTGGGCGCCATATCCAACCCGCTGAAACATAAGGAATGGTATGCATTCAGATAAACTCTACCGCGAAGATCAGATGCCGTCGCCGGGACGGGTTATCTGGCAAAAATTTACGGCGGATATTCCGGCCATGATCGGGTTTTACGGCGTGCTGTTTCTGCTGGCGCTGACCATCAGCGGACCCTATATCGCGCCGTATGCGCTTGACCAGCAGTTTATCGGCTATCAGTTGCTGCCGCCATCCTGGTCACACTATGGTAATGTCGCCTTTTTCCTGGGAACAGACGACCTCGGGCGCGATATTTTAAGCCGTATACTAATCGGGACACAATCCACTTTTGGCGGTGCACTGCTTGTGACAGTGACGGTCGCGGTATCCGGCATTGTTATCGGCTGTCTGGCGGGTATGACACACGGTCTGCGCTCCGCTATATTTAATCACATGTTTGATACTCTGCTGGCACTCCCGTCACTGCTGCTGGCTATTATTGTGGTGGCGTTTTTTGGTGCCAGTCTGGGCAACGCCATGATTGCCGTAGCGCTGGCGCTGCTGCCGCGTATTGTGCGCATGATTTATATCGCGGTGCATGATGAACTGGATAAAGAGTATGTGATTGCCGCACGCCTGGATGGCGCATCCAGCCTGAATATTTTTATCCGGACTGTCCTGCCGAATATCAGTGCAGTCACAGTAACAGAACTGACGCGCGCCCTTTCTATTGCTATCCTGGATATTGCCGCACTCGGTTTCCTGGAGCTGGGCGCACAACTGCCGTCGCCGGAATGGGGAGCCATGCTCGGGGATTCGCTGGAGCTTATCTATGTTGCGCCCTGGTCGGTGATCCTGCCGGGAACAGCAATCCTCATCAGTGTGTTGCTGGTCAATCTGCTCGGCACCGGGTTACAGCGCGCAATTAATGCGGGGGTGGAATAATGCCGTTACTGGATATCCGCAATTTAACCATCGAATTTATGACTGCCGCC