Homologs in group_2941

Help

5 homologs were identified in 5 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_14940 FBDBKF_14940 100.0 Morganella morganii S1 rpiR DNA-binding transcriptional regulator, MurR/RpiR family, contains HTH and SIS domains
EHELCC_11305 EHELCC_11305 100.0 Morganella morganii S2 rpiR DNA-binding transcriptional regulator, MurR/RpiR family, contains HTH and SIS domains
NLDBIP_11650 NLDBIP_11650 100.0 Morganella morganii S4 rpiR DNA-binding transcriptional regulator, MurR/RpiR family, contains HTH and SIS domains
LHKJJB_11510 LHKJJB_11510 100.0 Morganella morganii S3 rpiR DNA-binding transcriptional regulator, MurR/RpiR family, contains HTH and SIS domains
PMI_RS14705 PMI_RS14705 91.5 Proteus mirabilis HI4320 - MurR/RpiR family transcriptional regulator

Distribution of the homologs in the orthogroup group_2941

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_2941

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P44540 5.54e-112 328 54 0 280 4 HI_0143 Uncharacterized HTH-type transcriptional regulator HI_0143 Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q8RD36 2.8e-46 160 34 1 259 4 TTE0211 Uncharacterized HTH-type transcriptional regulator TTE0211 Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
P26833 2.11e-41 147 30 1 276 4 CPE0189 Uncharacterized HTH-type transcriptional regulator CPE0189 Clostridium perfringens (strain 13 / Type A)
Q97MK5 6.25e-39 141 33 1 258 4 CA_C0191 Uncharacterized HTH-type transcriptional regulator CA_C0191 Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
A8ADG3 3.38e-36 134 31 2 261 3 murR HTH-type transcriptional regulator MurR Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MIE1 5.62e-33 125 30 2 261 3 murR HTH-type transcriptional regulator MurR Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q45581 1.77e-32 124 29 3 265 1 ybbH Uncharacterized HTH-type transcriptional regulator YbbH Bacillus subtilis (strain 168)
B7NPW3 1.86e-31 121 29 1 246 3 murR HTH-type transcriptional regulator MurR Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B1LMM1 5.04e-31 120 29 1 246 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain SMS-3-5 / SECEC)
C6UMS6 5.04e-31 120 28 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain B / REL606)
C5W7D8 5.04e-31 120 28 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain B / BL21-DE3)
B1IX45 5.6e-31 120 28 1 254 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
P77245 5.66e-31 120 29 1 253 1 murR HTH-type transcriptional regulator MurR Escherichia coli (strain K12)
B1XA98 5.66e-31 120 29 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain K12 / DH10B)
C4ZVV8 5.66e-31 120 29 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain K12 / MC4100 / BW2952)
Q0T281 6.27e-31 119 29 1 248 3 murR HTH-type transcriptional regulator MurR Shigella flexneri serotype 5b (strain 8401)
B7LCH1 8.51e-31 119 28 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain 55989 / EAEC)
Q31Y52 9.44e-31 119 28 1 253 3 murR HTH-type transcriptional regulator MurR Shigella boydii serotype 4 (strain Sb227)
Q83K75 1.03e-30 119 29 1 248 3 murR HTH-type transcriptional regulator MurR Shigella flexneri
Q32DC7 1.88e-30 119 29 1 246 3 murR HTH-type transcriptional regulator MurR Shigella dysenteriae serotype 1 (strain Sd197)
B6I503 1.98e-30 119 28 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli (strain SE11)
B7M6T6 1.98e-30 119 28 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli O8 (strain IAI1)
A7ZPM7 1.98e-30 119 28 1 253 3 murR HTH-type transcriptional regulator MurR Escherichia coli O139:H28 (strain E24377A / ETEC)
B7N617 2.2e-30 118 29 1 246 3 murR HTH-type transcriptional regulator MurR Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
B2TX16 2.32e-30 118 28 1 253 3 murR HTH-type transcriptional regulator MurR Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
A8A2S4 8.56e-30 117 28 1 246 3 murR HTH-type transcriptional regulator MurR Escherichia coli O9:H4 (strain HS)
B7LKK8 1.15e-29 116 28 1 246 3 murR HTH-type transcriptional regulator MurR Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
C6UQ16 1.43e-29 116 28 1 254 3 murR HTH-type transcriptional regulator MurR Escherichia coli O157:H7 (strain TW14359 / EHEC)
B5YZX2 1.43e-29 116 28 1 254 3 murR HTH-type transcriptional regulator MurR Escherichia coli O157:H7 (strain EC4115 / EHEC)
Q8XBJ3 1.43e-29 116 28 1 254 3 murR HTH-type transcriptional regulator MurR Escherichia coli O157:H7
Q3YZB5 1.49e-29 116 28 1 254 3 murR HTH-type transcriptional regulator MurR Shigella sonnei (strain Ss046)
Q9WYG1 9.32e-29 114 30 5 261 4 TM_0326 Uncharacterized HTH-type transcriptional regulator TM_0326 Thermotoga maritima (strain ATCC 43589 / DSM 3109 / JCM 10099 / NBRC 100826 / MSB8)
Q88P32 6.59e-26 107 31 1 211 1 hexR HTH-type transcriptional regulator HexR Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
Q143F8 7.63e-25 107 30 3 214 3 glk Bifunctional protein glk Paraburkholderia xenovorans (strain LB400)
Q2SYA5 7.96e-25 107 30 3 214 3 glk Bifunctional protein glk Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q63RQ7 9.63e-25 107 30 3 214 3 glk Bifunctional protein glk Burkholderia pseudomallei (strain K96243)
Q3JPP0 9.91e-25 107 30 3 214 3 glk Bifunctional protein glk Burkholderia pseudomallei (strain 1710b)
Q62HW8 1.08e-24 107 30 3 214 3 glk Bifunctional protein glk Burkholderia mallei (strain ATCC 23344)
Q39IQ1 1.19e-24 107 30 3 214 3 glk Bifunctional protein glk Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
Q1BYA7 1.36e-24 106 30 3 214 3 glk Bifunctional protein glk Burkholderia orbicola (strain AU 1054)
P37767 1.91e-24 102 26 1 269 4 yfhH Uncharacterized HTH-type transcriptional regulator YfhH Escherichia coli (strain K12)
P46117 8.14e-24 101 27 1 238 4 None Uncharacterized HTH-type transcriptional regulator in aarA 3'region Providencia stuartii
P0ACS7 1.29e-23 100 26 2 251 1 rpiR HTH-type transcriptional regulator RpiR Escherichia coli (strain K12)
P0ACS8 1.29e-23 100 26 2 251 3 rpiR HTH-type transcriptional regulator RpiR Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
P46118 3.24e-21 94 26 4 281 3 hexR HTH-type transcriptional regulator HexR Escherichia coli (strain K12)
O68281 8.82e-19 87 29 1 211 3 hexR HTH-type transcriptional regulator HexR Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P54717 6.52e-07 53 26 8 203 2 glvR HTH-type transcriptional regulator GlvR Bacillus subtilis (strain 168)
B8DKW0 7.02e-07 52 42 0 63 3 gmhA Phosphoheptose isomerase Nitratidesulfovibrio vulgaris (strain DSM 19637 / Miyazaki F)
O67054 1.41e-06 51 45 0 55 3 gmhA Phosphoheptose isomerase Aquifex aeolicus (strain VF5)
Q55797 1.65e-06 51 30 3 124 3 gmhA Phosphoheptose isomerase Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
B3E5N0 2.8e-05 47 39 1 74 3 gmhA Phosphoheptose isomerase Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
A8EVR5 3.04e-05 47 30 4 151 3 gmhA Phosphoheptose isomerase Aliarcobacter butzleri (strain RM4018)
Q8TZ14 3.04e-05 48 29 6 162 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Methanopyrus kandleri (strain AV19 / DSM 6324 / JCM 9639 / NBRC 100938)
B2UNE0 9.69e-05 45 29 5 133 3 gmhA Phosphoheptose isomerase Akkermansia muciniphila (strain ATCC BAA-835 / DSM 22959 / JCM 33894 / BCRC 81048 / CCUG 64013 / CIP 107961 / Muc)
Q8KG38 0.000135 47 32 3 98 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Chlorobaculum tepidum (strain ATCC 49652 / DSM 12025 / NBRC 103806 / TLS)
A1AV13 0.000148 45 38 1 71 3 gmhA Phosphoheptose isomerase Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
A4IPI2 0.000176 45 31 2 119 3 murQ N-acetylmuramic acid 6-phosphate etherase Geobacillus thermodenitrificans (strain NG80-2)
P9WGG1 0.000304 44 26 5 159 1 gmhA Phosphoheptose isomerase Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WGG0 0.000304 44 26 5 159 3 gmhA Phosphoheptose isomerase Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
A5TYI7 0.000304 44 26 5 159 3 gmhA Phosphoheptose isomerase Mycobacterium tuberculosis (strain ATCC 25177 / H37Ra)
C1AJD9 0.000304 44 26 5 159 3 gmhA Phosphoheptose isomerase Mycobacterium bovis (strain BCG / Tokyo 172 / ATCC 35737 / TMC 1019)
A1KET4 0.000304 44 26 5 159 3 gmhA Phosphoheptose isomerase Mycobacterium bovis (strain BCG / Pasteur 1173P2)
P0A605 0.000304 44 26 5 159 3 gmhA Phosphoheptose isomerase Mycobacterium bovis (strain ATCC BAA-935 / AF2122/97)
O28478 0.000309 44 25 3 139 1 AF_1796 Uncharacterized protein AF_1796 Archaeoglobus fulgidus (strain ATCC 49558 / DSM 4304 / JCM 9628 / NBRC 100126 / VC-16)
Q67RV4 0.000346 45 42 0 42 3 murQ N-acetylmuramic acid 6-phosphate etherase Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q9HJV9 0.000359 44 34 1 73 3 gmhA Probable phosphoheptose isomerase Thermoplasma acidophilum (strain ATCC 25905 / DSM 1728 / JCM 9062 / NBRC 15155 / AMRC-C165)
B8F4V1 0.000401 45 34 1 87 3 murQ N-acetylmuramic acid 6-phosphate etherase Glaesserella parasuis serovar 5 (strain SH0165)
Q0I1F8 0.000418 45 32 2 105 3 murQ N-acetylmuramic acid 6-phosphate etherase Histophilus somni (strain 129Pt)
Q986Q8 0.000447 44 35 1 82 3 murQ N-acetylmuramic acid 6-phosphate etherase Mesorhizobium japonicum (strain LMG 29417 / CECT 9101 / MAFF 303099)
O26351 0.000498 43 22 1 114 3 MTH_249 Uncharacterized protein MTH_249 Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H)
Q9PMT4 0.000523 45 23 5 177 3 glmS Glutamine--fructose-6-phosphate aminotransferase [isomerizing] Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
B5EGN2 0.00066 43 48 0 50 3 gmhA Phosphoheptose isomerase Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B0UW11 0.000726 44 32 2 105 3 murQ N-acetylmuramic acid 6-phosphate etherase Histophilus somni (strain 2336)
A7MTC9 0.000813 43 35 1 78 3 murQ N-acetylmuramic acid 6-phosphate etherase Vibrio campbellii (strain ATCC BAA-1116)
Q2WBD9 0.000865 43 28 4 130 3 gmhA Phosphoheptose isomerase Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q97A25 0.001 43 37 1 67 3 gmhA Probable phosphoheptose isomerase Thermoplasma volcanium (strain ATCC 51530 / DSM 4299 / JCM 9571 / NBRC 15438 / GSS1)
C6E6C5 0.001 43 46 0 50 3 gmhA Phosphoheptose isomerase Geobacter sp. (strain M21)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_10120
Feature type CDS
Gene rpiR
Product DNA-binding transcriptional regulator, MurR/RpiR family, contains HTH and SIS domains
Location 82764 - 83651 (strand: 1)
Length 888 (nucleotides) / 295 (amino acids)

Contig

Accession ZDB_687
Length 188522 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_2941
Orthogroup size 6
N. genomes 6

Actions

Genomic region

Domains

PF01380 SIS domain
PF01418 Helix-turn-helix domain, rpiR family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG1737 Transcription (K) K DNA-binding transcriptional regulator, MurR/RpiR family, contains HTH and SIS domains

Protein Sequence

MTKQSVTRLKPGKILDTLGAMKNSLTRVSQRIAEYILFHPVEVTQLSIAQLSRATKAGEATVVRFCRTLGYKGFQDFKMDLAIEMATSDSEESPILDAEVNHQDDIHTIGLKLQATINNVLSETLNLLDMTQVKGAVNALLSSNYVFICGVGSSGITAEDLKNKLMRIGYRVDAVTNNHFMYMQASLLKPGDIAIGISHSGNSPETVHALKLAKEAGATTIVLTHNLGSHIMEYANYYLINGNRQGKLQGDSIGTKTAQLFVLDLLYTLLVQAQPEMVKEQKLRTLNALKSTNSA

Flanking regions ( +/- flanking 50bp)

GTTAGCAGAATTCCACTCCCTTTGAACTTCAGCAAACAAGGATAATTTTCATGACAAAACAGTCAGTTACCAGACTGAAGCCAGGTAAAATACTCGACACACTGGGGGCAATGAAAAATAGCCTGACGCGAGTATCACAGCGTATTGCTGAATATATCCTGTTTCATCCTGTTGAAGTCACTCAGCTTTCCATCGCACAACTTTCCCGGGCGACTAAAGCTGGCGAAGCAACTGTAGTACGTTTTTGCCGCACTCTGGGCTATAAGGGCTTTCAGGACTTTAAAATGGATTTAGCCATTGAAATGGCGACATCGGATAGTGAAGAATCACCAATCCTTGATGCTGAAGTTAACCATCAGGATGATATCCATACTATAGGTTTAAAATTACAAGCAACCATCAATAATGTGTTATCAGAAACATTAAATTTACTTGATATGACGCAAGTTAAAGGCGCTGTAAATGCGTTGCTATCATCGAATTATGTTTTTATCTGCGGCGTGGGTTCCTCGGGGATCACAGCAGAGGATCTAAAAAATAAACTGATGCGTATTGGATATCGGGTGGATGCTGTTACCAATAACCATTTTATGTATATGCAAGCTTCCTTATTGAAACCGGGTGATATCGCGATCGGTATCAGCCATTCCGGAAATTCACCGGAAACAGTTCATGCACTGAAACTTGCAAAAGAAGCAGGGGCTACCACAATTGTGCTAACGCATAATTTAGGTTCACACATTATGGAATATGCCAATTATTATCTGATTAATGGTAATCGCCAGGGGAAATTACAAGGTGATTCTATTGGTACAAAAACAGCACAACTGTTTGTTTTAGATTTACTGTATACCCTACTTGTCCAGGCTCAGCCTGAAATGGTCAAAGAGCAAAAACTGCGTACACTAAATGCATTGAAAAGTACCAATTCAGCATGAGTTTATAATTAGTGTTATGTGGTCTTGAATAAAACCAGCTAAAGATCACA