Homologs in group_865

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_04375 FBDBKF_04375 100.0 Morganella morganii S1 rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
EHELCC_05665 EHELCC_05665 100.0 Morganella morganii S2 rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
NLDBIP_05985 NLDBIP_05985 100.0 Morganella morganii S4 rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
LHKJJB_02865 LHKJJB_02865 100.0 Morganella morganii S3 rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
F4V73_RS08820 F4V73_RS08820 93.0 Morganella psychrotolerans rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
PMI_RS10240 PMI_RS10240 77.0 Proteus mirabilis HI4320 rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH

Distribution of the homologs in the orthogroup group_865

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_865

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
B4F119 3.72e-177 495 77 0 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Proteus mirabilis (strain HI4320)
Q7N139 1.49e-175 491 78 1 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Photorhabdus laumondii subsp. laumondii (strain DSM 15139 / CIP 105565 / TT01)
C6DEV1 1.59e-175 491 77 2 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Pectobacterium carotovorum subsp. carotovorum (strain PC1)
Q6D0H5 3.85e-173 484 77 2 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Pectobacterium atrosepticum (strain SCRI 1043 / ATCC BAA-672)
A1JJI5 5.16e-173 484 76 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia enterocolitica serotype O:8 / biotype 1B (strain NCTC 13174 / 8081)
A8ALL4 6.29e-172 481 74 1 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Citrobacter koseri (strain ATCC BAA-895 / CDC 4225-83 / SGSC4696)
A9MQD1 1.85e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella arizonae (strain ATCC BAA-731 / CDC346-86 / RSK2980)
Q8ZRU8 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720)
B4TXH0 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella schwarzengrund (strain CVM19633)
C0Q5H8 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella paratyphi C (strain RKS4594)
B4TJ79 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella heidelberg (strain SL476)
B5RH56 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella gallinarum (strain 287/91 / NCTC 13346)
B5R2L6 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella enteritidis PT4 (strain P125109)
B5FI64 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella dublin (strain CT_02021853)
B5F7V6 2.33e-171 480 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella agona (strain SL483)
B4SU42 3.24e-171 479 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella newport (strain SL254)
A9MZL1 6.83e-171 479 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella paratyphi B (strain ATCC BAA-1250 / SPB7)
B5BLG4 7.21e-171 479 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella paratyphi A (strain AKU_12601)
Q5PDH4 7.21e-171 479 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella paratyphi A (strain ATCC 9150 / SARB42)
Q8Z9H4 1.07e-170 478 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella typhi
C6C9K0 1.25e-170 478 75 2 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Musicola paradisiaca (strain Ech703)
B1JK89 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pseudotuberculosis serotype O:3 (strain YPIII)
Q66EL3 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pseudotuberculosis serotype I (strain IP32953)
Q1CMN5 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pestis bv. Antiqua (strain Nepal516)
A9R132 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pestis bv. Antiqua (strain Angola)
Q8ZIF7 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pestis
B2K4D8 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pseudotuberculosis serotype IB (strain PB1/+)
Q1C206 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pestis bv. Antiqua (strain Antiqua)
A7FM74 1.3e-170 478 74 1 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pseudotuberculosis serotype O:1b (strain IP 31758)
C6CJW6 1.39e-170 478 75 2 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Dickeya chrysanthemi (strain Ech1591)
B5Y1V5 2.28e-170 478 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Klebsiella pneumoniae (strain 342)
B2VD83 3.73e-170 477 75 1 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Erwinia tasmaniensis (strain DSM 17950 / CFBP 7177 / CIP 109463 / NCPPB 4357 / Et1/99)
B7UID2 4.49e-170 477 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O127:H6 (strain E2348/69 / EPEC)
Q326F3 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shigella boydii serotype 4 (strain Sb227)
B2U287 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shigella boydii serotype 18 (strain CDC 3083-94 / BS512)
B7LWH0 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia fergusonii (strain ATCC 35469 / DSM 13698 / CCUG 18766 / IAM 14443 / JCM 21226 / LMG 7866 / NBRC 102419 / NCTC 12128 / CDC 0568-73)
Q1RGB3 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain UTI89 / UPEC)
B1LG19 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain SMS-3-5 / SECEC)
B6HZ59 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain SE11)
B7N7V5 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O17:K52:H18 (strain UMN026 / ExPEC)
P60390 1.13e-169 476 73 1 309 1 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain K12)
B1IR96 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain ATCC 8739 / DSM 1576 / NBRC 3972 / NCIMB 8545 / WDCM 00012 / Crooks)
Q0TLQ7 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O6:K15:H31 (strain 536 / UPEC)
A1A7C7 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O1:K1 / APEC
A7ZW34 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O9:H4 (strain HS)
B1XC59 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain K12 / DH10B)
C4ZQ04 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain K12 / MC4100 / BW2952)
C6UM45 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain B / REL606)
C5W331 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain B / BL21-DE3)
B7M125 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O8 (strain IAI1)
B5YZB8 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O157:H7 (strain EC4115 / EHEC)
P60391 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O157:H7
B7LFV2 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli (strain 55989 / EAEC)
B7MAK5 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O45:K1 (strain S88 / ExPEC)
A7ZHH3 1.13e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O139:H28 (strain E24377A / ETEC)
Q57TD8 1.31e-169 476 74 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Salmonella choleraesuis (strain SC-B67)
A6T4M5 1.36e-169 476 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Klebsiella pneumoniae subsp. pneumoniae (strain ATCC 700721 / MGH 78578)
B7NHI8 2.62e-169 475 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O7:K1 (strain IAI39 / ExPEC)
B7MNU1 4.74e-169 474 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O81 (strain ED1a)
Q3Z5S7 5e-169 474 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shigella sonnei (strain Ss046)
A4W6I5 6.3e-169 474 72 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Enterobacter sp. (strain 638)
Q83SN7 8.74e-169 474 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shigella flexneri
Q32K10 1.21e-168 473 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shigella dysenteriae serotype 1 (strain Sd197)
Q0T8B5 2.19e-168 473 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shigella flexneri serotype 5b (strain 8401)
Q8FL68 1.04e-167 471 73 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Escherichia coli O6:H1 (strain CFT073 / ATCC 700928 / UPEC)
A4TQ91 9.23e-167 469 74 2 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Yersinia pestis (strain Pestoides F)
A8G9R9 1.59e-166 468 73 1 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Serratia proteamaculans (strain 568)
A7MIE1 2.24e-164 462 74 1 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Cronobacter sakazakii (strain ATCC BAA-894)
C5B9E8 4.87e-163 459 76 2 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Edwardsiella ictaluri (strain 93-146)
Q2NVV9 6.36e-156 441 71 3 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Sodalis glossinidius (strain morsitans)
P62475 5.07e-154 436 72 2 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Photobacterium profundum (strain SS9)
Q9AJH1 3.69e-153 434 68 5 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633)
Q7MNV9 4.62e-152 431 68 4 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio vulnificus (strain YJ016)
Q8DEK2 4.62e-152 431 68 4 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio vulnificus (strain CMCP6)
B5FB43 5.21e-152 431 69 4 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Aliivibrio fischeri (strain MJ11)
A0KPY0 1.7e-151 430 69 3 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / DSM 30187 / BCRC 13018 / CCUG 14551 / JCM 1027 / KCTC 2358 / NCIMB 9240 / NCTC 8049)
C3LQV4 4.26e-151 429 66 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio cholerae serotype O1 (strain M66-2)
Q9KPF9 4.26e-151 429 66 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961)
B6ELI3 1.93e-150 427 68 4 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Aliivibrio salmonicida (strain LFI1238)
Q5E2P2 2.02e-150 427 68 4 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Aliivibrio fischeri (strain ATCC 700601 / ES114)
C4K744 2.15e-150 427 66 1 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Hamiltonella defensa subsp. Acyrthosiphon pisum (strain 5AT)
A7MWK7 4.53e-150 426 67 5 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio campbellii (strain ATCC BAA-1116)
B7VIZ5 2.7e-149 424 67 4 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio atlanticus (strain LGP32)
A4SI48 2.82e-149 424 69 3 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Aeromonas salmonicida (strain A449)
A1SU11 2.3e-148 422 68 3 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Psychromonas ingrahamii (strain DSM 17664 / CCUG 51855 / 37)
Q9AJG9 2.6e-148 422 67 5 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Vibrio proteolyticus
B8F3A8 1.24e-144 412 66 4 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Glaesserella parasuis serovar 5 (strain SH0165)
A6VQP1 1.64e-143 410 64 3 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Actinobacillus succinogenes (strain ATCC 55618 / DSM 22257 / CCUG 43843 / 130Z)
B0BRG9 2.01e-142 407 64 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Actinobacillus pleuropneumoniae serotype 3 (strain JL03)
B3GZK0 2.53e-142 407 64 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Actinobacillus pleuropneumoniae serotype 7 (strain AP76)
Q65RX8 2.57e-141 404 65 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Mannheimia succiniciproducens (strain KCTC 0769BP / MBEL55E)
A3MY82 4.17e-141 404 64 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Actinobacillus pleuropneumoniae serotype 5b (strain L20)
C6AKG2 1.45e-140 402 63 3 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Aggregatibacter aphrophilus (strain NJ8700)
Q12SD4 2.32e-140 402 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella denitrificans (strain OS217 / ATCC BAA-1090 / DSM 15013)
Q7VP62 2.42e-140 402 64 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Haemophilus ducreyi (strain 35000HP / ATCC 700724)
Q8E9P0 1.2e-139 400 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella oneidensis (strain ATCC 700550 / JCM 31522 / CIP 106686 / LMG 19005 / NCIMB 14063 / MR-1)
Q07WH7 1.21e-139 400 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella frigidimarina (strain NCIMB 400)
C4LA17 2.26e-139 399 64 3 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Tolumonas auensis (strain DSM 9187 / NBRC 110442 / TA 4)
A1S2F1 2.57e-139 399 66 4 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella amazonensis (strain ATCC BAA-1098 / SB2B)
Q0HZS4 5.6e-139 398 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella sp. (strain MR-7)
A0L1Q0 5.6e-139 398 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella sp. (strain ANA-3)
A8H992 5.87e-139 398 65 4 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella pealeana (strain ATCC 700345 / ANG-SQ1)
A8FQ92 8.98e-139 397 65 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella sediminis (strain HAW-EB3)
Q0HE75 1.04e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella sp. (strain MR-4)
A1REY8 1.06e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella sp. (strain W3-18-1)
A4Y2M8 1.06e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella putrefaciens (strain CN-32 / ATCC BAA-453)
B0TQM9 1.1e-138 397 65 4 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella halifaxensis (strain HAW-EB4)
A9KY21 1.16e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella baltica (strain OS195)
A6WIC3 1.16e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella baltica (strain OS185)
A3CZL3 1.16e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella baltica (strain OS155 / ATCC BAA-1091)
B8E4L2 1.16e-138 397 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella baltica (strain OS223)
B0US59 1.56e-138 397 63 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Histophilus somni (strain 2336)
A3QIM9 2.95e-138 396 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella loihica (strain ATCC BAA-1088 / PV-4)
Q9CPB4 8.03e-138 395 63 3 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Pasteurella multocida (strain Pm70)
B1KKY5 2.18e-137 394 65 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella woodyi (strain ATCC 51908 / MS32)
B8CM48 3.13e-137 394 65 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella piezotolerans (strain WP3 / JCM 13877)
Q0I1E1 1.48e-136 392 62 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Histophilus somni (strain 129Pt)
Q9F1N8 2.45e-136 391 64 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Shewanella violacea (strain JCM 10179 / CIP 106290 / LMG 19151 / DSS12)
A5UCX6 3.91e-135 389 61 3 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Haemophilus influenzae (strain PittEE)
Q4QLG6 3.91e-135 389 61 3 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Haemophilus influenzae (strain 86-028NP)
P45057 4.92e-135 388 61 3 311 1 rsmH Ribosomal RNA small subunit methyltransferase H Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd)
Q15Q09 1.9e-133 384 62 4 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudoalteromonas atlantica (strain T6c / ATCC BAA-1087)
B4RWY7 4.26e-132 380 62 4 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Alteromonas mediterranea (strain DSM 17117 / CIP 110805 / LMG 28347 / Deep ecotype)
Q3IFZ6 9.07e-131 377 61 4 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudoalteromonas translucida (strain TAC 125)
Q1LSW0 2.76e-130 376 60 2 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Baumannia cicadellinicola subsp. Homalodisca coagulata
Q47VQ1 1.25e-128 372 61 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Colwellia psychrerythraea (strain 34H / ATCC BAA-681)
Q5R0L7 5.31e-126 365 59 4 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Idiomarina loihiensis (strain ATCC BAA-735 / DSM 15497 / L2-TR)
A5UIQ3 8.55e-120 348 64 2 267 3 rsmH Ribosomal RNA small subunit methyltransferase H Haemophilus influenzae (strain PittGG)
P57319 1.03e-118 347 53 1 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
B8D922 1.03e-118 347 53 1 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Buchnera aphidicola subsp. Acyrthosiphon pisum (strain 5A)
B8D7C6 2.61e-118 345 53 1 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Buchnera aphidicola subsp. Acyrthosiphon pisum (strain Tuc7)
A1U3G6 1.2e-117 344 57 6 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Marinobacter nauticus (strain ATCC 700491 / DSM 11845 / VT8)
Q2S9Y4 1.28e-117 344 55 5 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Hahella chejuensis (strain KCTC 2396)
O85295 9.29e-117 342 53 1 305 3 rsmH Ribosomal RNA small subunit methyltransferase H Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
B2JHG8 9.35e-116 339 55 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Paraburkholderia phymatum (strain DSM 17167 / CIP 108236 / LMG 21445 / STM815)
Q1QVF9 3.55e-115 338 58 4 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Chromohalobacter salexigens (strain ATCC BAA-138 / DSM 3043 / CIP 106854 / NCIMB 13768 / 1H11)
A4XQR6 4.44e-115 337 55 5 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas mendocina (strain ymp)
Q4K6I5 5.01e-115 337 56 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas fluorescens (strain ATCC BAA-477 / NRRL B-23932 / Pf-5)
Q83F35 7.12e-115 337 55 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Coxiella burnetii (strain RSA 493 / Nine Mile phase I)
A9NA25 7.12e-115 337 55 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Coxiella burnetii (strain RSA 331 / Henzerling II)
B6J5L7 7.12e-115 337 55 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Coxiella burnetii (strain CbuK_Q154)
Q31I68 1.09e-114 337 56 4 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Hydrogenovibrio crunogenus (strain DSM 25203 / XCL-2)
B3PCM8 1.17e-114 336 56 5 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Cellvibrio japonicus (strain Ueda107)
A9KET2 2.53e-114 335 54 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Coxiella burnetii (strain Dugway 5J108-111)
C1DQ91 3.49e-114 335 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Azotobacter vinelandii (strain DJ / ATCC BAA-1303)
Q1I5B0 3.94e-114 335 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas entomophila (strain L48)
Q13TY4 1.45e-113 334 54 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Paraburkholderia xenovorans (strain LB400)
B0KFT4 1.82e-113 333 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas putida (strain GB-1)
A3NZM3 2.38e-113 333 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia pseudomallei (strain 1106a)
B1J1Y2 2.55e-113 333 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas putida (strain W619)
B6J2R7 3.47e-113 332 54 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Coxiella burnetii (strain CbuG_Q212)
C6BEJ1 3.47e-113 333 55 4 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Ralstonia pickettii (strain 12D)
Q8XVH9 3.83e-113 333 54 4 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Ralstonia nicotianae (strain ATCC BAA-1114 / GMI1000)
A5W8Q8 4.4e-113 332 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas putida (strain ATCC 700007 / DSM 6899 / JCM 31910 / BCRC 17059 / LMG 24140 / F1)
Q493Q9 5.35e-113 333 52 3 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Blochmanniella pennsylvanica (strain BPEN)
B2UCY5 6.12e-113 332 55 4 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Ralstonia pickettii (strain 12J)
Q88N84 6.23e-113 332 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas putida (strain ATCC 47054 / DSM 6125 / CFBP 8728 / NCIMB 11950 / KT2440)
A3NDX2 8.82e-113 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia pseudomallei (strain 668)
Q3JND0 8.82e-113 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia pseudomallei (strain 1710b)
A1V0S6 8.82e-113 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia mallei (strain SAVP1)
Q62GR9 8.82e-113 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia mallei (strain ATCC 23344)
A2S5V3 8.82e-113 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia mallei (strain NCTC 10229)
A3MR55 8.82e-113 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia mallei (strain NCTC 10247)
B2SYY3 1.03e-112 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Paraburkholderia phytofirmans (strain DSM 17436 / LMG 22146 / PsJN)
Q2SZJ1 1.04e-112 332 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia thailandensis (strain ATCC 700388 / DSM 13276 / CCUG 48851 / CIP 106301 / E264)
Q3K736 1.51e-112 331 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas fluorescens (strain Pf0-1)
Q63QI9 1.63e-112 331 53 3 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia pseudomallei (strain K96243)
B8GMM1 8.55e-112 329 59 4 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Thioalkalivibrio sulfidiphilus (strain HL-EbGR7)
C1D5M5 1.58e-111 328 54 3 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Laribacter hongkongensis (strain HLHK9)
A4G8U6 2.03e-111 328 54 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Herminiimonas arsenicoxydans
C3KCS2 2.41e-111 328 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas fluorescens (strain SBW25)
P59522 2.78e-111 328 51 2 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
C5BP42 3.37e-111 327 54 6 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Teredinibacter turnerae (strain ATCC 39867 / T7901)
Q87WX7 4.48e-111 327 54 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas syringae pv. tomato (strain ATCC BAA-871 / DC3000)
Q48EF0 5.34e-111 327 54 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas savastanoi pv. phaseolicola (strain 1448A / Race 6)
A9AJ24 1.04e-110 326 54 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia multivorans (strain ATCC 17616 / 249)
Q21MH7 1.25e-110 326 53 6 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Saccharophagus degradans (strain 2-40 / ATCC 43961 / DSM 17024)
B7UZJ8 3.34e-110 325 55 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas aeruginosa (strain LESB58)
A4JB86 4.73e-110 325 53 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia vietnamiensis (strain G4 / LMG 22486)
Q9JSY9 5.33e-110 325 53 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q9HVZ5 5.39e-110 325 54 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q4ZNY2 5.51e-110 325 54 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas syringae pv. syringae (strain B728a)
A6T2G6 6.19e-110 325 54 5 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Janthinobacterium sp. (strain Marseille)
A6VB93 1.36e-109 323 54 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas aeruginosa (strain PA7)
A4VIH0 1.37e-109 323 53 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Stutzerimonas stutzeri (strain A1501)
Q02H20 1.47e-109 323 54 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Pseudomonas aeruginosa (strain UCBPP-PA14)
Q39JX8 2.8e-109 323 53 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia lata (strain ATCC 17760 / DSM 23089 / LMG 22485 / NCIMB 9086 / R18194 / 383)
A9M2I4 4.52e-109 323 52 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Neisseria meningitidis serogroup C (strain 053442)
B3R6W7 5.44e-109 323 53 4 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Cupriavidus taiwanensis (strain DSM 17343 / BCRC 17206 / CCUG 44338 / CIP 107171 / LMG 19424 / R1)
Q47A96 9.78e-109 321 54 4 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Dechloromonas aromatica (strain RCB)
B4RQD7 1.06e-108 322 52 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Neisseria gonorrhoeae (strain NCCP11945)
Q5F6K7 1.12e-108 321 52 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090)
B1YSR6 2.15e-108 320 53 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia ambifaria (strain MC40-6)
Q9K0Z0 2.34e-108 321 52 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7VQJ5 2.97e-108 320 53 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Blochmanniella floridana
Q0BIK9 4.72e-108 320 53 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia ambifaria (strain ATCC BAA-244 / DSM 16087 / CCUG 44356 / LMG 19182 / AMMD)
A1KVM4 6.6e-108 320 52 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Neisseria meningitidis serogroup C / serotype 2a (strain ATCC 700532 / DSM 15464 / FAM18)
Q0K6L6 8.41e-108 320 53 4 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Cupriavidus necator (strain ATCC 17699 / DSM 428 / KCTC 22496 / NCIMB 10442 / H16 / Stanier 337)
B4E6K0 1.05e-107 319 52 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia cenocepacia (strain ATCC BAA-245 / DSM 16553 / LMG 16656 / NCTC 13227 / J2315 / CF5610)
B1JUW4 1.12e-107 318 52 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia orbicola (strain MC0-3)
A0K478 1.12e-107 318 52 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia cenocepacia (strain HI2424)
B2SNY6 1.4e-107 319 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas oryzae pv. oryzae (strain PXO99A)
Q2NZB1 1.4e-107 319 55 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas oryzae pv. oryzae (strain MAFF 311018)
Q5GW34 1.69e-107 319 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas oryzae pv. oryzae (strain KACC10331 / KXO85)
Q0VS10 3.79e-107 317 56 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Alcanivorax borkumensis (strain ATCC 700651 / DSM 11573 / NCIMB 13689 / SK2)
Q82VT1 7.23e-107 317 52 4 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Nitrosomonas europaea (strain ATCC 19718 / CIP 103999 / KCTC 2705 / NBRC 14298)
Q46WY6 7.27e-107 317 53 4 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Cupriavidus pinatubonensis (strain JMP 134 / LMG 1197)
Q3SMI1 1.45e-106 316 55 4 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Thiobacillus denitrificans (strain ATCC 25259)
Q1BZH1 1.86e-106 315 52 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Burkholderia orbicola (strain AU 1054)
Q7NPZ1 2.89e-106 315 51 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Chromobacterium violaceum (strain ATCC 12472 / DSM 30191 / JCM 1249 / CCUG 213 / NBRC 12614 / NCIMB 9131 / NCTC 9757 / MK)
Q5WXZ4 3.35e-106 315 53 3 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Legionella pneumophila (strain Lens)
Q5ZX19 3.35e-106 315 53 3 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Legionella pneumophila subsp. pneumophila (strain Philadelphia 1 / ATCC 33152 / DSM 7513)
Q5X6J0 3.35e-106 315 53 3 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Legionella pneumophila (strain Paris)
Q604V0 8.32e-106 313 54 4 305 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylococcus capsulatus (strain ATCC 33009 / NCIMB 11132 / Bath)
Q1LIL8 1.44e-105 314 52 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Cupriavidus metallidurans (strain ATCC 43123 / DSM 2839 / NBRC 102507 / CH34)
Q3BXF9 1.89e-105 314 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas euvesicatoria pv. vesicatoria (strain 85-10)
Q2Y630 3.58e-105 312 52 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849 / C 71)
Q0AJD3 4.36e-105 312 50 4 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Nitrosomonas eutropha (strain DSM 101675 / C91 / Nm57)
Q8PPB5 5.22e-105 313 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas axonopodis pv. citri (strain 306)
A5IFZ9 8.72e-105 311 53 4 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Legionella pneumophila (strain Corby)
Q8PCK7 1.13e-104 312 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas campestris pv. campestris (strain ATCC 33913 / DSM 3586 / NCPPB 528 / LMG 568 / P 25)
B0RVB2 1.13e-104 312 54 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas campestris pv. campestris (strain B100)
Q1GYZ3 1.15e-104 311 52 3 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylobacillus flagellatus (strain ATCC 51484 / DSM 6875 / VKM B-1610 / KT)
Q8D2Y8 1.59e-104 310 48 1 305 3 rsmH Ribosomal RNA small subunit methyltransferase H Wigglesworthia glossinidia brevipalpis
A6VYK6 3.61e-104 310 49 5 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Marinomonas sp. (strain MWYL1)
A1K3T8 9.83e-104 308 52 4 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Azoarcus sp. (strain BH72)
B9MFS0 6.83e-103 306 52 6 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Acidovorax ebreus (strain TPSY)
A2SCX7 1.01e-102 306 51 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylibium petroleiphilum (strain ATCC BAA-1232 / LMG 22953 / PM1)
A1WC14 1.94e-102 305 52 6 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Acidovorax sp. (strain JS42)
Q4UQW3 2.13e-102 306 53 5 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthomonas campestris pv. campestris (strain 8004)
A1WRK3 2.56e-102 306 51 5 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Verminephrobacter eiseniae (strain EF01-2)
Q5P6Y9 4.81e-102 304 53 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Aromatoleum aromaticum (strain DSM 19018 / LMG 30748 / EbN1)
B0V8N7 7.51e-102 303 51 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baumannii (strain AYE)
A3M9K5 7.51e-102 303 51 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baumannii (strain ATCC 17978 / DSM 105126 / CIP 53.77 / LMG 1025 / NCDC KC755 / 5377)
B2I0K7 7.51e-102 303 51 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baumannii (strain ACICU)
B7GVN1 7.51e-102 303 51 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baumannii (strain AB307-0294)
Q3J781 1.61e-101 303 55 4 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Nitrosococcus oceani (strain ATCC 19707 / BCRC 17464 / JCM 30415 / NCIMB 11848 / C-107)
Q12EM3 4.24e-101 301 50 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Polaromonas sp. (strain JS666 / ATCC BAA-500)
B7IAX1 6.64e-101 301 51 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baumannii (strain AB0057)
A1VSU4 6.78e-101 301 50 3 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Polaromonas naphthalenivorans (strain CJ2)
B0VPF9 7.3e-100 298 51 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baumannii (strain SDF)
Q6F7D1 5.59e-99 296 52 7 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Acinetobacter baylyi (strain ATCC 33305 / BD413 / ADP1)
B2FNN0 8.95e-99 296 51 6 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Stenotrophomonas maltophilia (strain K279a)
B4SJW8 1.31e-98 296 51 6 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Stenotrophomonas maltophilia (strain R551-3)
Q0A6J4 3.34e-98 295 50 4 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1)
B0U504 3.42e-98 295 53 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Xylella fastidiosa (strain M12)
B1XY20 6.21e-98 294 51 4 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Leptothrix cholodnii (strain ATCC 51168 / LMG 8142 / SP-6)
A1AVX1 7.57e-98 293 49 4 307 3 rsmH Ribosomal RNA small subunit methyltransferase H Ruthia magnifica subsp. Calyptogena magnifica
Q9PF88 4.51e-97 291 53 6 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Xylella fastidiosa (strain 9a5c)
Q87AF2 1.19e-96 291 53 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Xylella fastidiosa (strain Temecula1 / ATCC 700964)
B2I9C0 1.19e-96 291 53 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Xylella fastidiosa (strain M23)
A5CX97 1.37e-96 290 49 4 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Vesicomyosocius okutanii subsp. Calyptogena okutanii (strain HA)
C5CNE6 1.61e-96 290 49 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Variovorax paradoxus (strain S110)
B1XT01 5.46e-96 289 48 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Polynucleobacter necessarius subsp. necessarius (strain STIR1)
Q21SW1 7.66e-94 283 49 5 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Albidiferax ferrireducens (strain ATCC BAA-621 / DSM 15236 / T118)
Q7VUP6 8.82e-93 283 46 6 334 3 rsmH Ribosomal RNA small subunit methyltransferase H Bordetella pertussis (strain Tohama I / ATCC BAA-589 / NCTC 13251)
Q7W4A7 8.82e-93 283 46 6 334 3 rsmH Ribosomal RNA small subunit methyltransferase H Bordetella parapertussis (strain 12822 / ATCC BAA-587 / NCTC 13253)
Q7WFR5 8.82e-93 283 46 6 334 3 rsmH Ribosomal RNA small subunit methyltransferase H Bordetella bronchiseptica (strain ATCC BAA-588 / NCTC 13252 / RB50)
A9BUJ8 3.74e-91 276 50 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Delftia acidovorans (strain DSM 14801 / SPH-1)
A4SV66 1.67e-90 275 48 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Polynucleobacter asymbioticus (strain DSM 18221 / CIP 109841 / QLW-P1DMWA-1)
A1WYV1 5.56e-90 274 48 3 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Halorhodospira halophila (strain DSM 244 / SL1)
Q2KVE4 2.53e-89 273 49 6 303 3 rsmH Ribosomal RNA small subunit methyltransferase H Bordetella avium (strain 197N)
A9I4S5 8.99e-89 272 47 7 334 3 rsmH Ribosomal RNA small subunit methyltransferase H Bordetella petrii (strain ATCC BAA-461 / DSM 12804 / CCUG 43448)
Q5NGY1 1.61e-87 267 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. tularensis (strain SCHU S4 / Schu 4)
Q14ID3 1.61e-87 267 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. tularensis (strain FSC 198)
Q057T6 3.44e-87 266 46 1 304 3 rsmH Ribosomal RNA small subunit methyltransferase H Buchnera aphidicola subsp. Cinara cedri (strain Cc)
A8MH28 5.47e-87 266 46 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Alkaliphilus oremlandii (strain OhILAs)
B2SDL2 9.05e-87 265 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. mediasiatica (strain FSC147)
A0Q5I5 9.98e-87 265 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. novicida (strain U112)
Q0BKT7 2.21e-86 264 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. holarctica (strain OSU18)
Q2A265 2.21e-86 264 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. holarctica (strain LVS)
A7NDP7 2.21e-86 264 46 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. holarctica (strain FTNF002-00 / FTA)
A5WBQ1 1.78e-85 263 45 7 325 3 rsmH Ribosomal RNA small subunit methyltransferase H Psychrobacter sp. (strain PRwf-1)
C0ZGB3 3.54e-85 261 47 7 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Brevibacillus brevis (strain 47 / JCM 6285 / NBRC 100599)
A0L5N9 3.78e-85 261 47 8 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A1TKC3 5.3e-85 261 51 4 290 3 rsmH Ribosomal RNA small subunit methyltransferase H Paracidovorax citrulli (strain AAC00-1)
B0TZ13 6.26e-85 261 45 5 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella philomiragia subsp. philomiragia (strain ATCC 25017 / CCUG 19701 / FSC 153 / O#319-036)
Q65JY8 9.84e-85 260 45 6 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus licheniformis (strain ATCC 14580 / DSM 13 / JCM 2505 / CCUG 7422 / NBRC 12200 / NCIMB 9375 / NCTC 10341 / NRRL NRS-1264 / Gibson 46)
A4IZB0 3.71e-84 258 45 5 305 3 rsmH Ribosomal RNA small subunit methyltransferase H Francisella tularensis subsp. tularensis (strain WY96-3418)
C3KV90 3.92e-84 258 43 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain 657 / Type Ba4)
C1FME6 7.36e-84 258 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Kyoto / Type A2)
A7GDE2 1.12e-83 257 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Langeland / NCTC 10281 / Type F)
B1IKR0 1.56e-83 257 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Okra / Type B1)
C5D8L5 1.66e-83 257 47 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Geobacillus sp. (strain WCH70)
A5I1T3 1.66e-83 257 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Hall / ATCC 3502 / NCTC 13319 / Type A)
A7FTX8 1.66e-83 257 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain ATCC 19397 / Type A)
Q1Q846 2.01e-83 258 43 7 330 3 rsmH Ribosomal RNA small subunit methyltransferase H Psychrobacter cryohalolentis (strain ATCC BAA-1226 / DSM 17306 / VKM B-2378 / K5)
Q4FQ05 3.01e-83 257 42 7 331 3 rsmH Ribosomal RNA small subunit methyltransferase H Psychrobacter arcticus (strain DSM 17307 / VKM B-2377 / 273-4)
B1L164 4.87e-83 256 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Loch Maree / Type A3)
A6LTS0 8.65e-83 255 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q0SRV9 4.46e-82 253 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium perfringens (strain SM101 / Type A)
Q0TP92 4.46e-82 253 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium perfringens (strain ATCC 13124 / DSM 756 / JCM 1290 / NCIMB 6125 / NCTC 8237 / Type A)
Q49WW1 6.65e-82 253 43 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q8XJ96 7.26e-82 253 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium perfringens (strain 13 / Type A)
Q03EX7 7.31e-82 253 44 6 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Pediococcus pentosaceus (strain ATCC 25745 / CCUG 21536 / LMG 10740 / 183-1w)
A9B518 1.62e-81 253 46 7 328 3 rsmH Ribosomal RNA small subunit methyltransferase H Herpetosiphon aurantiacus (strain ATCC 23779 / DSM 785 / 114-95)
Q07876 2.79e-81 251 44 6 314 2 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus subtilis (strain 168)
B3QFN9 7.47e-81 251 47 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhodopseudomonas palustris (strain TIE-1)
C6DZJ8 1.31e-80 249 45 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Geobacter sp. (strain M21)
P60398 1.96e-80 250 47 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhodopseudomonas palustris (strain ATCC BAA-98 / CGA009)
A4XHZ6 2.95e-80 249 43 5 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Caldicellulosiruptor saccharolyticus (strain ATCC 43494 / DSM 8903 / Tp8T 6331)
Q9K9S0 6.02e-80 248 44 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Halalkalibacterium halodurans (strain ATCC BAA-125 / DSM 18197 / FERM 7344 / JCM 9153 / C-125)
A4J2A3 6.98e-80 248 43 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Desulforamulus reducens (strain ATCC BAA-1160 / DSM 100696 / MI-1)
B9MQ93 8.74e-80 247 43 5 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Caldicellulosiruptor bescii (strain ATCC BAA-1888 / DSM 6725 / KCTC 15123 / Z-1320)
Q5HQ13 1.02e-79 247 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8GE08 1.35e-79 247 47 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H (Fragment) Heliobacterium mobile
Q929X6 1.74e-79 247 44 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Listeria innocua serovar 6a (strain ATCC BAA-680 / CLIP 11262)
B9DPQ9 2e-79 246 43 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus carnosus (strain TM300)
Q97H81 2.09e-79 246 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / IAM 19013 / LMG 5710 / NBRC 13948 / NRRL B-527 / VKM B-1787 / 2291 / W)
Q8CSX7 2.41e-79 246 42 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
B2V4W0 2.44e-79 246 40 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Alaska E43 / Type E3)
B0TGB2 3.79e-79 246 47 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
B2TS30 3.81e-79 246 40 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium botulinum (strain Eklund 17B / Type B)
B8G5X3 1.01e-78 244 45 7 324 3 rsmH Ribosomal RNA small subunit methyltransferase H Chloroflexus aggregans (strain MD-66 / DSM 9485)
B8DH88 1.1e-78 245 43 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Listeria monocytogenes serotype 4a (strain HCC23)
Q894B4 1.14e-78 244 41 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium tetani (strain Massachusetts / E88)
A0Q055 1.28e-78 244 42 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium novyi (strain NT)
A8HZ68 1.55e-78 246 46 7 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Azorhizobium caulinodans (strain ATCC 43989 / DSM 5975 / JCM 20966 / LMG 6465 / NBRC 14845 / NCIMB 13405 / ORS 571)
Q2IYL6 2.21e-78 245 46 8 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhodopseudomonas palustris (strain HaA2)
B7GGJ0 2.29e-78 244 44 8 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Anoxybacillus flavithermus (strain DSM 21510 / WK1)
A0AKE1 2.32e-78 244 43 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Listeria welshimeri serovar 6b (strain ATCC 35897 / DSM 20650 / CCUG 15529 / CIP 8149 / NCTC 11857 / SLCC 5334 / V8)
Q71XX2 2.56e-78 244 43 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Listeria monocytogenes serotype 4b (strain F2365)
Q8Y5L7 3.18e-78 243 43 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Listeria monocytogenes serovar 1/2a (strain ATCC BAA-679 / EGD-e)
B5ELD1 3.27e-78 244 48 10 325 3 rsmH Ribosomal RNA small subunit methyltransferase H Acidithiobacillus ferrooxidans (strain ATCC 53993 / BNL-5-31)
B7J3W0 3.27e-78 244 48 10 325 3 rsmH Ribosomal RNA small subunit methyltransferase H Acidithiobacillus ferrooxidans (strain ATCC 23270 / DSM 14882 / CIP 104768 / NCIMB 8455)
A9KM86 3.87e-78 243 41 6 318 3 rsmH2 Ribosomal RNA small subunit methyltransferase H 2 Lachnoclostridium phytofermentans (strain ATCC 700394 / DSM 18823 / ISDg)
A6QG79 1.02e-77 242 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain Newman)
Q5HGQ2 1.02e-77 242 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain COL)
A7Z4D7 1.22e-77 242 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus velezensis (strain DSM 23117 / BGSC 10A6 / LMG 26770 / FZB42)
A8FCX3 1.29e-77 242 45 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus pumilus (strain SAFR-032)
A6TS69 1.67e-77 242 42 6 316 3 rsmH1 Ribosomal RNA small subunit methyltransferase H 1 Alkaliphilus metalliredigens (strain QYMF)
C1KWZ4 2.03e-77 241 43 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Listeria monocytogenes serotype 4b (strain CLIP80459)
A4YZL1 2.71e-77 242 47 8 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Bradyrhizobium sp. (strain ORS 278)
O07104 2.81e-77 241 42 7 319 3 rsmH Ribosomal RNA small subunit methyltransferase H Enterococcus faecalis (strain ATCC 700802 / V583)
P60394 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain MW2)
A8Z3M0 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain USA300 / TCH1516)
Q6GA33 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain MSSA476)
Q6GHQ6 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain MRSA252)
P60392 3.1e-77 241 41 6 313 1 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain N315)
P60485 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IS65 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain JH9)
P60393 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FHQ8 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain USA300)
A6U0Z9 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain JH1)
A7X1B8 3.1e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain Mu3 / ATCC 700698)
O07665 4.05e-77 241 44 7 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Enterococcus hirae
Q2YXE3 4.25e-77 241 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q133W3 5.17e-77 241 46 8 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhodopseudomonas palustris (strain BisB5)
A5EPL2 6.87e-77 241 48 8 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Bradyrhizobium sp. (strain BTAi1 / ATCC BAA-1182)
Q182Z2 7.55e-77 240 42 6 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridioides difficile (strain 630)
B1HPY0 8.34e-77 240 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Lysinibacillus sphaericus (strain C3-41)
Q4L5N0 1.05e-76 239 41 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Staphylococcus haemolyticus (strain JCSC1435)
B9E0V5 2.1e-76 239 39 6 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Clostridium kluyveri (strain NBRC 12016)
Q3A2F8 2.53e-76 239 44 7 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Syntrophotalea carbinolica (strain DSM 2380 / NBRC 103641 / GraBd1)
A5G8K8 3.79e-76 238 44 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Geotalea uraniireducens (strain Rf4)
Q1WT95 4.44e-76 238 42 6 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Ligilactobacillus salivarius (strain UCC118)
B3WDX7 5.53e-76 238 43 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Lacticaseibacillus casei (strain BL23)
Q24TD8 5.68e-76 238 44 5 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Desulfitobacterium hafniense (strain Y51)
B8FT64 5.68e-76 238 44 5 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Desulfitobacterium hafniense (strain DSM 10664 / DCB-2)
Q5L0Y4 5.93e-76 238 45 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Geobacillus kaustophilus (strain HTA426)
A7IGF4 6.16e-76 239 46 7 311 3 rsmH Ribosomal RNA small subunit methyltransferase H Xanthobacter autotrophicus (strain ATCC BAA-1158 / Py2)
Q04B77 1.09e-75 237 42 8 320 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC BAA-365 / Lb-18)
Q1GAU0 1.09e-75 237 42 8 320 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactobacillus delbrueckii subsp. bulgaricus (strain ATCC 11842 / DSM 20081 / BCRC 10696 / JCM 1002 / NBRC 13953 / NCIMB 11778 / NCTC 12712 / WDCM 00102 / Lb 14)
P0DC37 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M3 (strain SSI-1)
Q48RZ0 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M28 (strain MGAS6180)
A2RD40 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M5 (strain Manfredo)
Q1JFK8 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M2 (strain MGAS10270)
Q1JKL7 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M12 (strain MGAS9429)
Q1JAG5 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M12 (strain MGAS2096)
P65433 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M18 (strain MGAS8232)
P0DC36 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M3 (strain ATCC BAA-595 / MGAS315)
P65431 1.81e-75 237 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M1
B3E3Z0 1.86e-75 236 47 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Trichlorobacter lovleyi (strain ATCC BAA-1151 / DSM 17278 / SZ)
B5XML3 1.97e-75 236 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M49 (strain NZ131)
Q2LR39 2.13e-75 236 41 7 320 3 rsmH Ribosomal RNA small subunit methyltransferase H Syntrophus aciditrophicus (strain SB)
Q8E782 2.3e-75 236 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus agalactiae serotype III (strain NEM316)
Q5XAL3 2.95e-75 236 43 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M6 (strain ATCC BAA-946 / MGAS10394)
Q039S2 4.52e-75 236 42 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Lacticaseibacillus paracasei (strain ATCC 334 / BCRC 17002 / CCUG 31169 / CIP 107868 / KCTC 3260 / NRRL B-441)
Q8R9F9 5.61e-75 235 43 8 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Caldanaerobacter subterraneus subsp. tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4)
B5EBP3 8.31e-75 235 46 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Citrifermentans bemidjiense (strain ATCC BAA-1014 / DSM 16622 / JCM 12645 / Bem)
B2IGF2 1.05e-74 236 48 8 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
Q1J5F8 1.23e-74 234 42 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pyogenes serotype M4 (strain MGAS10750)
P60396 1.78e-74 234 44 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Geobacter sulfurreducens (strain ATCC 51573 / DSM 12127 / PCA)
Q8E1R8 3.56e-74 233 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus agalactiae serotype V (strain ATCC BAA-611 / 2603 V/R)
Q3K394 3.56e-74 233 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus agalactiae serotype Ia (strain ATCC 27591 / A909 / CDC SS700)
B9M164 3.63e-74 233 43 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Geotalea daltonii (strain DSM 22248 / JCM 15807 / FRC-32)
C5WIJ4 4.42e-74 233 42 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus dysgalactiae subsp. equisimilis (strain GGS_124)
Q6HEP6 5.2e-74 233 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus thuringiensis subsp. konkukian (strain 97-27)
A5D113 5.66e-74 233 43 6 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Pelotomaculum thermopropionicum (strain DSM 13744 / JCM 10971 / SI)
Q67Q57 6.28e-74 233 43 5 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Symbiobacterium thermophilum (strain DSM 24528 / JCM 14929 / IAM 14863 / T)
Q03QH0 7.62e-74 233 42 7 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Levilactobacillus brevis (strain ATCC 367 / BCRC 12310 / CIP 105137 / JCM 1170 / LMG 11437 / NCIMB 947 / NCTC 947)
Q636A8 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain ZK / E33L)
C1EPT2 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain 03BB102)
B7JK06 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain AH820)
Q81WC3 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus anthracis
A0RHT9 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus thuringiensis (strain Al Hakam)
C3L6F3 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus anthracis (strain CDC 684 / NRRL 3495)
C3P688 1.15e-73 232 43 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus anthracis (strain A0248)
C6D563 1.2e-73 232 42 7 323 3 rsmH Ribosomal RNA small subunit methyltransferase H Paenibacillus sp. (strain JDR-2)
B7H6Q4 1.34e-73 232 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain B4264)
Q88V76 1.35e-73 232 40 6 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1)
A8AVS9 1.48e-73 232 41 8 324 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus gordonii (strain Challis / ATCC 35105 / BCRC 15272 / CH1 / DL1 / V288)
A7GRP4 1.55e-73 231 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cytotoxicus (strain DSM 22905 / CIP 110041 / 391-98 / NVH 391-98)
Q819P8 1.81e-73 231 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain ATCC 14579 / DSM 31 / CCUG 7414 / JCM 2152 / NBRC 15305 / NCIMB 9373 / NCTC 2599 / NRRL B-3711)
B7IVF3 1.81e-73 231 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain G9842)
B9DV78 1.99e-73 231 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus uberis (strain ATCC BAA-854 / 0140J)
A5EY11 2.99e-73 231 46 7 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Dichelobacter nodosus (strain VCS1703A)
C4L5T9 3.04e-73 231 44 8 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Exiguobacterium sp. (strain ATCC BAA-1283 / AT1b)
A4IM00 3.78e-73 231 42 6 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Geobacillus thermodenitrificans (strain NG80-2)
Q1MPC6 3.88e-73 231 43 8 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Lawsonia intracellularis (strain PHE/MN1-00)
B9LKK0 8.12e-73 229 45 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Chloroflexus aurantiacus (strain ATCC 29364 / DSM 637 / Y-400-fl)
A9WG80 8.12e-73 229 45 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Chloroflexus aurantiacus (strain ATCC 29366 / DSM 635 / J-10-fl)
Q3AAD7 1.05e-72 229 43 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Carboxydothermus hydrogenoformans (strain ATCC BAA-161 / DSM 6008 / Z-2901)
A9VU80 1.35e-72 229 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus mycoides (strain KBAB4)
Q5WFG1 1.45e-72 229 41 7 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Shouchella clausii (strain KSM-K16)
B7HM39 1.59e-72 229 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain AH187)
B9IVZ5 1.63e-72 229 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain Q1)
P62468 1.63e-72 229 42 6 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Bacillus cereus (strain ATCC 10987 / NRS 248)
Q39YM7 1.86e-72 229 42 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Geobacter metallireducens (strain ATCC 53774 / DSM 7210 / GS-15)
B2GB73 2.11e-72 229 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Limosilactobacillus fermentum (strain NBRC 3956 / LMG 18251)
B4U4K4 2.82e-72 228 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus equi subsp. zooepidemicus (strain MGCS10565)
C0M7A8 3.73e-72 228 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus equi subsp. equi (strain 4047)
A7NIA2 5.22e-72 228 45 6 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Roseiflexus castenholzii (strain DSM 13941 / HLO8)
B1YIU3 7.38e-72 227 42 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Exiguobacterium sibiricum (strain DSM 17290 / CCUG 55495 / CIP 109462 / JCM 13490 / 255-15)
C0MGV8 7.63e-72 227 42 8 319 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus equi subsp. zooepidemicus (strain H70)
Q5M2U6 8.88e-72 227 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus thermophilus (strain ATCC BAA-250 / LMG 18311)
Q5FKV7 9.6e-72 227 40 9 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactobacillus acidophilus (strain ATCC 700396 / NCK56 / N2 / NCFM)
B8CWI8 1.24e-71 227 39 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Halothermothrix orenii (strain H 168 / OCM 544 / DSM 9562)
B6JCF0 1.38e-71 227 46 9 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Afipia carboxidovorans (strain ATCC 49405 / DSM 1227 / KCTC 32145 / OM5)
B7KU77 1.69e-71 228 45 8 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylorubrum extorquens (strain CM4 / NCIMB 13688)
Q03J09 2.2e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus thermophilus (strain ATCC BAA-491 / LMD-9)
Q5LY91 2.2e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus thermophilus (strain CNRZ 1066)
B0T839 2.26e-71 226 47 9 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Caulobacter sp. (strain K31)
A5VDD4 2.75e-71 226 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhizorhabdus wittichii (strain DSM 6014 / CCUG 31198 / JCM 15750 / NBRC 105917 / EY 4224 / RW1)
A4VX71 4.17e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus suis (strain 05ZYH33)
C6GPU1 4.17e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus suis (strain SC84)
C5VZR6 4.17e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus suis (strain P1/7)
C6GW75 4.17e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus suis (strain BM407)
A4W3H4 4.17e-71 226 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus suis (strain 98HAH33)
A9VW37 4.96e-71 226 45 8 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylorubrum extorquens (strain PA1)
C1CIJ8 5.89e-71 225 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain P1031)
B5E6Z2 5.89e-71 225 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae serotype 19F (strain G54)
C5ATZ5 6.43e-71 226 45 8 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylorubrum extorquens (strain ATCC 14718 / DSM 1338 / JCM 2805 / NCIMB 9133 / AM1)
C1CBB2 6.57e-71 225 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain 70585)
A8YUN6 7.66e-71 225 40 8 320 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactobacillus helveticus (strain DPC 4571)
A3CPZ9 7.98e-71 225 40 8 323 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus sanguinis (strain SK36)
A8ZXX1 9.58e-71 224 40 5 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Desulfosudis oleivorans (strain DSM 6200 / JCM 39069 / Hxd3)
Q8DVM7 9.9e-71 224 41 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus mutans serotype c (strain ATCC 700610 / UA159)
C1CPL0 1.18e-70 224 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain Taiwan19F-14)
Q4A667 1.26e-70 224 40 7 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Mycoplasmopsis synoviae (strain 53)
P0CB58 1.41e-70 224 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae serotype 4 (strain ATCC BAA-334 / TIGR4)
Q2RVT6 1.47e-70 224 45 9 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhodospirillum rubrum (strain ATCC 11170 / ATH 1.1.1 / DSM 467 / LMG 4362 / NCIMB 8255 / S1)
Q02ZY9 1.49e-70 224 41 9 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactococcus lactis subsp. cremoris (strain SK11)
A2RLT4 1.49e-70 224 41 9 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactococcus lactis subsp. cremoris (strain MG1363)
Q3Z9L1 1.52e-70 225 40 5 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Dehalococcoides mccartyi (strain ATCC BAA-2266 / KCTC 15142 / 195)
A5VRI5 1.77e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella ovis (strain ATCC 25840 / 63/290 / NCTC 10512)
B6IRH0 1.77e-70 224 42 6 308 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhodospirillum centenum (strain ATCC 51521 / SW)
P65428 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella suis biovar 1 (strain 1330)
P65427 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella melitensis biotype 1 (strain ATCC 23456 / CCUG 17765 / NCTC 10094 / 16M)
C0RE78 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella melitensis biotype 2 (strain ATCC 23457)
A9M698 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella canis (strain ATCC 23365 / NCTC 10854 / RM-666)
Q57C70 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella abortus biovar 1 (strain 9-941)
Q2YM63 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella abortus (strain 2308)
B2S6R2 1.95e-70 225 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella abortus (strain S19)
B2ISQ2 1.98e-70 224 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain CGSP14)
B8ZL51 1.98e-70 224 40 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain ATCC 700669 / Spain 23F-1)
B1I953 2.28e-70 224 39 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain Hungary19A-6)
Q5N4L0 3.93e-70 222 44 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31PL4 3.93e-70 222 44 7 314 3 rsmH Ribosomal RNA small subunit methyltransferase H Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q38XN3 5.26e-70 223 40 8 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Latilactobacillus sakei subsp. sakei (strain 23K)
B8I6G6 5.63e-70 223 39 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Ruminiclostridium cellulolyticum (strain ATCC 35319 / DSM 5812 / JCM 6584 / H10)
A6WZP8 6.57e-70 223 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella anthropi (strain ATCC 49188 / DSM 6882 / CCUG 24695 / JCM 21032 / LMG 3331 / NBRC 15819 / NCTC 12168 / Alc 37)
B2G6K1 6.68e-70 223 41 9 320 3 rsmH Ribosomal RNA small subunit methyltransferase H Limosilactobacillus reuteri subsp. reuteri (strain JCM 1112)
A5VJ28 6.68e-70 223 41 9 320 3 rsmH Ribosomal RNA small subunit methyltransferase H Limosilactobacillus reuteri (strain DSM 20016)
Q04ES5 7.52e-70 222 39 7 318 3 rsmH Ribosomal RNA small subunit methyltransferase H Oenococcus oeni (strain ATCC BAA-331 / PSU-1)
B0K3H8 9.69e-70 222 40 8 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Thermoanaerobacter sp. (strain X514)
C1CCA8 1.3e-69 222 39 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain JJA)
P59658 1.3e-69 222 39 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae (strain ATCC BAA-255 / R6)
Q04MC7 1.3e-69 222 39 7 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Streptococcus pneumoniae serotype 2 (strain D39 / NCTC 7466)
B3PTW8 1.54e-69 222 44 8 312 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhizobium etli (strain CIAT 652)
B0K8J9 1.59e-69 221 40 8 315 3 rsmH Ribosomal RNA small subunit methyltransferase H Thermoanaerobacter pseudethanolicus (strain ATCC 33223 / 39E)
Q1ME25 1.63e-69 222 45 8 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Rhizobium johnstonii (strain DSM 114642 / LMG 32736 / 3841)
C4ZD30 1.81e-69 221 40 7 315 3 rsmH2 Ribosomal RNA small subunit methyltransferase H 2 Agathobacter rectalis (strain ATCC 33656 / DSM 3377 / JCM 17463 / KCTC 5835 / VPI 0990)
A1AU69 2.18e-69 221 43 9 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Pelobacter propionicus (strain DSM 2379 / NBRC 103807 / OttBd1)
B0CHM8 3.51e-69 221 43 8 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Brucella suis (strain ATCC 23445 / NCTC 10510)
Q042P4 3.52e-69 221 39 8 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactobacillus gasseri (strain ATCC 33323 / DSM 20243 / BCRC 14619 / CIP 102991 / JCM 1131 / KCTC 3163 / NCIMB 11718 / NCTC 13722 / AM63)
P62471 3.75e-69 220 39 8 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactobacillus johnsonii (strain CNCM I-12250 / La1 / NCC 533)
P62473 8.99e-69 219 41 8 316 3 rsmH Ribosomal RNA small subunit methyltransferase H Mycoplasma mycoides subsp. mycoides SC (strain CCUG 32753 / NCTC 10114 / PG1)
Q9REQ9 9.03e-69 220 45 10 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Zymomonas mobilis subsp. mobilis (strain ATCC 31821 / ZM4 / CP4)
P58745 1.75e-68 219 44 8 309 3 rsmH Ribosomal RNA small subunit methyltransferase H Agrobacterium fabrum (strain C58 / ATCC 33970)
Q03W30 2.02e-68 218 41 6 310 3 rsmH Ribosomal RNA small subunit methyltransferase H Leuconostoc mesenteroides subsp. mesenteroides (strain ATCC 8293 / DSM 20343 / BCRC 11652 / CCM 1803 / JCM 6124 / NCDO 523 / NBRC 100496 / NCIMB 8023 / NCTC 12954 / NRRL B-1118 / 37Y)
C3MEN7 2.72e-68 219 45 8 306 3 rsmH Ribosomal RNA small subunit methyltransferase H Sinorhizobium fredii (strain NBRC 101917 / NGR234)
Q9CH73 5.21e-68 218 40 9 317 3 rsmH Ribosomal RNA small subunit methyltransferase H Lactococcus lactis subsp. lactis (strain IL1403)
Q2W0I1 5.49e-68 218 42 8 305 3 rsmH Ribosomal RNA small subunit methyltransferase H Paramagnetospirillum magneticum (strain ATCC 700264 / AMB-1)
Q2G9A3 6.57e-68 218 44 9 321 3 rsmH Ribosomal RNA small subunit methyltransferase H Novosphingobium aromaticivorans (strain ATCC 700278 / DSM 12444 / CCUG 56034 / CIP 105152 / NBRC 16084 / F199)
Q3ZZA4 7.11e-68 218 40 5 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Dehalococcoides mccartyi (strain CBDB1)
A5FSB7 7.11e-68 218 40 5 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Dehalococcoides mccartyi (strain ATCC BAA-2100 / JCM 16839 / KCTC 5957 / BAV1)
Q0BV17 7.85e-68 218 44 7 313 3 rsmH Ribosomal RNA small subunit methyltransferase H Granulibacter bethesdensis (strain ATCC BAA-1260 / CGDNIH1)
B1Z8U3 8.03e-68 218 48 8 292 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylorubrum populi (strain ATCC BAA-705 / NCIMB 13946 / BJ001)
B8ETL4 8.46e-68 218 47 6 305 3 rsmH Ribosomal RNA small subunit methyltransferase H Methylocella silvestris (strain DSM 15510 / CIP 108128 / LMG 27833 / NCIMB 13906 / BL2)

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_06340
Feature type CDS
Gene rsmH
Product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
Location 65074 - 66015 (strand: -1)
Length 942 (nucleotides) / 313 (amino acids)

Contig

Accession ZDB_683
Length 224720 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_865
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF01795 MraW methylase family

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0275 Translation, ribosomal structure and biogenesis (J) J 16S rRNA C1402 N4-methylase RsmH

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K03438 16S rRNA (cytosine1402-N4)-methyltransferase [EC:2.1.1.199] - -

Protein Sequence

MAESQFQHTSVLLDEAVNGLQIREDGIYIDGTFGRGGHSRLILSKLGPQGRLIAIDRDPQAIAAAAQIDDPRFSIIHGPFSGIAGYVNDLELSGQINGVLLDLGVSSPQLDDAERGFSFMRDGPLDMRMDPTRGISAAQWLTEAKEEDIAWVLKNFGEERFSKRIARAIVERNKTEEPLTRTKQLADLIAAVSPVKEKHKHPATRSFQAIRIYVNSELDEIRQALTGALGILAQGGRLSVISFHSLEDRIVKQFMRDESRGPQVPHGLPLTEEQLKAHGTPALKLAGKMKPSEQEISVNPRARSSVLRFAEKA

Flanking regions ( +/- flanking 50bp)

AGACGGCATCCGGACCTTTATCCGCCCGGTTACAGGATTTATCACTTTAAATGGCAGAGAGTCAGTTTCAGCATACCAGTGTTTTACTGGATGAAGCCGTTAACGGATTACAGATCCGCGAAGACGGCATTTATATCGACGGCACATTCGGCCGCGGCGGGCACTCCCGCCTGATTTTATCAAAACTCGGTCCGCAGGGGCGTCTGATTGCCATTGACCGGGATCCGCAGGCGATTGCCGCTGCGGCACAGATTGACGACCCGCGTTTTTCCATTATTCACGGCCCGTTTTCCGGTATCGCCGGTTATGTGAATGATCTGGAACTGAGCGGACAGATTAACGGCGTTCTGCTGGATCTGGGTGTGTCCTCCCCGCAGTTGGACGACGCGGAACGCGGATTCTCCTTTATGCGTGACGGGCCGCTGGATATGCGGATGGATCCGACCCGCGGGATCTCCGCTGCACAGTGGCTGACTGAAGCCAAAGAAGAAGATATTGCGTGGGTGCTGAAAAATTTCGGCGAAGAGCGTTTTTCGAAACGGATTGCCCGCGCGATTGTTGAACGCAATAAAACCGAAGAGCCGCTGACGCGGACAAAACAGCTGGCGGATTTAATTGCCGCTGTGTCTCCGGTGAAAGAAAAGCACAAGCATCCGGCGACCCGCAGCTTCCAGGCTATCCGCATTTATGTCAACAGCGAGCTGGATGAGATCCGCCAGGCGCTGACCGGCGCACTGGGCATTCTGGCTCAGGGCGGCCGGTTATCGGTTATCAGCTTCCACTCGCTGGAAGACCGGATTGTGAAGCAGTTTATGCGTGATGAAAGCCGCGGACCACAGGTACCGCACGGATTACCGCTGACGGAAGAACAACTGAAAGCGCACGGCACACCGGCACTGAAACTGGCCGGAAAAATGAAACCGTCAGAGCAGGAAATCAGTGTTAACCCGCGTGCCCGCAGTTCGGTACTGCGCTTTGCGGAGAAAGCATGACCACAGAACGGCACAATTTAGCCCGCGTTATTTGTCGTGACCTGCTGCGC