Homologs in group_797

Help

6 homologs were identified in 6 genomes with OrthoFinder.
The following table displays the locus tag of each homolog, the organism to which it belongs, the gene name and product.

Locus tag Identity Source Gene Product
FBDBKF_03740 FBDBKF_03740 100.0 Morganella morganii S1 hyfB hydrogenase 4 subunit B
EHELCC_06795 EHELCC_06795 100.0 Morganella morganii S2 hyfB hydrogenase 4 subunit B
NLDBIP_07120 NLDBIP_07120 100.0 Morganella morganii S4 hyfB hydrogenase 4 subunit B
LHKJJB_06655 LHKJJB_06655 100.0 Morganella morganii S3 hyfB hydrogenase 4 subunit B
F4V73_RS11130 F4V73_RS11130 94.5 Morganella psychrotolerans hyfB hydrogenase 4 subunit B
PMI_RS12495 PMI_RS12495 80.5 Proteus mirabilis HI4320 hyfB hydrogenase 4 subunit B

Distribution of the homologs in the orthogroup group_797

Help

Number of homologs in each genome (first column) and amino-acid identity of the closest homolog (second column).

Download SVG

Phylogeny of the RefSeq best hits of group_797

Swissprot accession Eval Score ID (%) N gaps Alignment length Annot score Gene Description Organism
P23482 0.0 786 62 2 672 1 hyfB Hydrogenase-4 component B Escherichia coli (strain K12)
P16429 9.46e-126 388 37 5 602 1 hycC Formate hydrogenlyase subunit 3 Escherichia coli (strain K12)
P9WIW3 7.23e-70 242 31 9 610 3 Rv0083 Uncharacterized protein Rv0083 Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW2 7.23e-70 242 31 9 610 3 MT0090 Uncharacterized protein MT0090 Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9RGZ5 6.29e-40 160 29 12 453 1 mrpA Na(+)/H(+) antiporter subunit A Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
P77437 2.41e-39 155 29 6 361 3 hyfF Hydrogenase-4 component F Escherichia coli (strain K12)
P77416 2.43e-37 149 28 8 430 3 hyfD Hydrogenase-4 component D Escherichia coli (strain K12)
Q9K2S2 4.95e-37 151 28 11 473 1 mrpA Na(+)/H(+) antiporter subunit A Bacillus subtilis (strain 168)
Q9ZCG0 1.91e-36 146 24 5 449 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia prowazekii (strain Madrid E)
Q4L4W7 2.65e-36 149 28 12 455 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus haemolyticus (strain JCSC1435)
B1I6I5 2.64e-34 140 28 14 459 3 nuoN NADH-quinone oxidoreductase subunit N Desulforudis audaxviator (strain MP104C)
Q68VV6 3.49e-34 140 26 7 394 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia typhi (strain ATCC VR-144 / Wilmington)
Q6GJ44 1.83e-33 138 25 9 430 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MRSA252)
P29925 3.04e-33 137 32 6 293 3 nqo13 NADH-quinone oxidoreductase chain 13 Paracoccus denitrificans
Q8CPU8 1.48e-32 137 27 17 469 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HQL0 1.48e-32 137 27 17 469 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q7A725 2.47e-32 134 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain N315)
Q99VY9 2.47e-32 134 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A7WZ79 2.47e-32 134 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
P9WIW1 3.6e-32 135 30 10 420 1 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW0 3.6e-32 135 30 10 420 3 nuoL NADH-quinone oxidoreductase subunit L Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
Q9RGZ2 5.16e-32 133 25 7 400 1 mrpD Na(+)/H(+) antiporter subunit D Alkalihalophilus pseudofirmus (strain ATCC BAA-2126 / JCM 17055 / OF4)
Q49W91 6.23e-32 135 26 14 490 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
P20679 7.17e-32 135 25 25 618 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Podospora anserina (strain S / ATCC MYA-4624 / DSM 980 / FGSC 10383)
Q85T01 9.59e-32 134 27 13 425 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryptococcus neoformans var. grubii serotype A (strain H99 / ATCC 208821 / CBS 10515 / FGSC 9487)
Q8NXT1 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MW2)
A8Z147 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GBK4 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain MSSA476)
A6QET6 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain Newman)
Q5HI42 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain COL)
Q2YSV4 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
A5IQH8 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH9)
Q2G212 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ12 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain USA300)
A6TZA2 1.06e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus (strain JH1)
Q0Q2J7 1.4e-31 132 24 10 461 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus aureus
Q4UK26 1.42e-31 132 23 8 463 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
B1X491 2.88e-31 133 27 12 455 3 ndhF1 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 1 Paulinella chromatophora
P31971 5.77e-31 132 28 14 453 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q92G96 8.2e-31 130 25 8 417 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia conorii (strain ATCC VR-613 / Malish 7)
Q99VZ2 1.6e-30 131 28 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain N315)
Q932F5 1.6e-30 131 28 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IQH5 1.6e-30 131 28 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH9)
A6TZ99 1.6e-30 131 28 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain JH1)
A7WZ76 1.6e-30 131 28 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q35099 1.87e-30 130 30 11 346 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Metridium senile
Q1RKE5 2.11e-30 129 24 5 357 3 nuoM NADH-quinone oxidoreductase subunit M Rickettsia bellii (strain RML369-C)
Q9I0J0 2.83e-30 128 27 7 343 3 nuoM NADH-quinone oxidoreductase subunit M Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
P60675 4.37e-30 130 26 15 459 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain N315)
P60674 4.37e-30 130 26 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A5IRD0 4.37e-30 130 26 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH9)
A6U059 4.37e-30 130 26 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain JH1)
A7X0G4 4.37e-30 130 26 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q49VG9 5.72e-30 129 27 17 458 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q2YST2 5.75e-30 129 27 16 452 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8NXT2 7.18e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MW2)
Q6GBK7 7.18e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MSSA476)
Q0Q2K0 7.44e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus
A8Z144 7.44e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300 / TCH1516)
A6QET3 7.44e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain Newman)
Q5HI45 7.44e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain COL)
Q2G2U8 7.44e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FJ15 7.44e-30 129 27 14 429 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain USA300)
P50974 9.3e-30 127 29 8 362 3 nuoM NADH-quinone oxidoreductase subunit M Rhodobacter capsulatus
Q2YWT4 9.39e-30 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8SHP7 9.96e-30 128 27 16 429 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Hypocrea jecorina
Q9ZNG6 1.05e-29 129 25 15 459 1 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus
Q8NXF6 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MW2)
A8Z059 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300 / TCH1516)
Q6GAX4 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MSSA476)
A6QFG2 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain Newman)
Q5HHD3 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain COL)
Q2FZV1 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
Q2FIC3 1.16e-29 129 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain USA300)
P48919 1.58e-29 127 28 14 446 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Candida parapsilosis
Q6GID6 1.7e-29 128 25 15 459 3 mnhA1 Na(+)/H(+) antiporter subunit A1 Staphylococcus aureus (strain MRSA252)
P33607 1.72e-29 127 31 18 426 1 nuoL NADH-quinone oxidoreductase subunit L Escherichia coli (strain K12)
P03916 2.4e-29 127 30 16 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan paniscus
Q6GJ47 4.09e-29 127 27 17 455 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus aureus (strain MRSA252)
Q8DHX4 6.14e-29 125 36 1 188 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q5HRA9 8.65e-29 124 24 9 439 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CQ47 9.07e-29 124 24 9 439 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q55429 1.45e-28 125 29 10 359 3 ndhF NAD(P)H-quinone oxidoreductase chain 5 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q52978 1.84e-28 125 27 20 511 3 phaAB Probable K(+)/H(+) antiporter subunit A/B Rhizobium meliloti (strain 1021)
P03915 1.86e-28 124 29 14 358 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Homo sapiens
Q6QU67 1.93e-28 124 25 13 426 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Aspergillus niger
Q35648 2.39e-28 124 30 16 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pan troglodytes
Q8HHD2 2.57e-28 124 24 26 618 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Cryphonectria parasitica
Q6V9D9 2.68e-28 124 27 16 428 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Talaromyces marneffei
F1SVK0 3.02e-28 124 27 18 448 1 fpoL F(420)H(2) dehydrogenase subunit L Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q95885 3.14e-28 123 29 16 361 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Papio hamadryas
Q4L4W4 4.51e-28 122 25 11 403 3 mnhD Na+/H+-antiporter, MnhD subunit Staphylococcus haemolyticus (strain JCSC1435)
Q9I0J1 4.52e-28 123 30 17 456 3 nuoL NADH-quinone oxidoreductase subunit L Pseudomonas aeruginosa (strain ATCC 15692 / DSM 22644 / CIP 104116 / JCM 14847 / LMG 12228 / 1C / PRS 101 / PAO1)
Q9ZCG1 6.04e-28 123 27 11 422 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia prowazekii (strain Madrid E)
Q4L446 1.41e-27 120 24 9 420 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus haemolyticus (strain JCSC1435)
Q6GID9 1.45e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MRSA252)
Q34879 1.63e-27 121 28 13 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Lemur catta
O05229 1.69e-27 120 26 5 336 1 mrpD Na(+)/H(+) antiporter subunit D Bacillus subtilis (strain 168)
P60687 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MW2)
P60686 1.82e-27 120 24 7 376 1 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus
Q6GAX7 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain MSSA476)
P60685 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain N315)
P60684 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu50 / ATCC 700699)
A6QFF9 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Newman)
A5IRC7 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH9)
Q2G2H7 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain NCTC 8325 / PS 47)
A6U056 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain JH1)
A7X0F9 1.82e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain Mu3 / ATCC 700698)
Q2YWT7 1.94e-27 120 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain bovine RF122 / ET3-1)
Q8YM86 2.01e-27 120 27 2 292 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4-3 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
B0JS85 2.25e-27 120 27 5 336 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
Q5HHD6 2.44e-27 119 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain COL)
A8Z056 2.58e-27 119 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300 / TCH1516)
Q2FIC6 2.58e-27 119 24 7 376 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus aureus (strain USA300)
Q3MAR0 2.96e-27 120 27 2 292 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q9TKV7 3.32e-27 120 26 13 445 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nephroselmis olivacea
Q37617 4.14e-27 119 25 5 337 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Prototheca wickerhamii
Q8CQ50 4.73e-27 120 27 12 397 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q5HRB2 4.73e-27 120 27 12 397 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q9XAR5 5.22e-27 120 29 13 448 3 nuoL NADH-quinone oxidoreductase subunit L Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145)
P03917 7.01e-27 119 29 14 359 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gorilla gorilla gorilla
P0AFE8 8.9e-27 118 27 8 343 1 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli (strain K12)
P0AFE9 8.9e-27 118 27 8 343 3 nuoM NADH-quinone oxidoreductase subunit M Escherichia coli O157:H7
Q49VH2 1.05e-26 117 24 8 430 3 mnhD2 Putative antiporter subunit mnhD2 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q1RKE6 1.1e-26 119 26 11 423 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia bellii (strain RML369-C)
O47497 1.16e-26 117 25 7 375 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Metridium senile
P72823 1.21e-26 118 27 4 293 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
Q3M9C7 1.38e-26 117 28 4 293 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q92G97 1.39e-26 119 26 10 420 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia conorii (strain ATCC VR-613 / Malish 7)
P11628 1.64e-26 118 26 16 427 3 nd5 NADH-ubiquinone oxidoreductase chain 5 Emericella nidulans
B1VKJ3 1.9e-26 118 27 13 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cryptomeria japonica
Q4L443 1.94e-26 119 27 20 489 3 mnhA2 Putative antiporter subunit mnhA2 Staphylococcus haemolyticus (strain JCSC1435)
Q6EW03 1.96e-26 118 26 13 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nymphaea alba
Q34313 1.98e-26 118 27 14 435 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium discoideum
Q2JWW3 2.19e-26 117 27 2 284 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-3-3Ab)
Q8YZV7 2.67e-26 117 28 4 293 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
A1XG02 2.84e-26 118 26 13 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nuphar advena
P50365 3.56e-26 117 26 14 428 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Allomyces macrogynus
Q8M9U5 3.59e-26 117 26 13 438 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chaetosphaeridium globosum
Q06GK2 3.64e-26 117 27 10 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Piper cenocladum
Q9B8C9 3.84e-26 116 25 14 443 3 NAD5 NADH-ubiquinone oxidoreductase chain 5 Candida albicans (strain SC5314 / ATCC MYA-2876)
Q85BG0 3.95e-26 116 30 5 252 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Anthoceros angustus
P05510 4.06e-26 117 26 15 396 3 ndh-5 NADH-ubiquinone oxidoreductase chain 5 Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987)
P29924 4.07e-26 117 29 18 452 3 nqo12 NADH-quinone oxidoreductase chain 12 Paracoccus denitrificans
P26848 4.41e-26 115 23 5 342 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Marchantia polymorpha
Q2JPJ1 4.43e-26 116 25 3 336 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q9TDR1 4.84e-26 117 30 14 350 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Sus scrofa
Q5N5W1 5.57e-26 116 33 1 188 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31NA0 5.57e-26 116 33 1 188 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
Q0H8X0 6.7e-26 116 24 12 423 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Ustilago maydis (strain 521 / FGSC 9021)
Q10ZG8 7.59e-26 115 32 1 188 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Trichodesmium erythraeum (strain IMS101)
F1SVH9 9.07e-26 115 29 9 292 1 fpoM F(420)H(2) dehydrogenase subunit M Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
Q4UK27 9.79e-26 116 26 11 422 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia felis (strain ATCC VR-1525 / URRWXCal2)
Q2LCP6 1.07e-25 116 26 14 435 3 nad5 NADH-ubiquinone oxidoreductase chain 5 Dictyostelium citrinum
P29388 1.07e-25 116 28 11 347 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Arabidopsis thaliana
P50368 1.41e-25 115 27 16 421 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Schizophyllum commune
P24978 1.52e-25 115 27 15 395 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera physalus
P50367 2.15e-25 115 26 16 428 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhizopus stolonifer
B1XHP2 2.81e-25 114 26 6 332 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
Q09MC9 3.05e-25 115 25 18 512 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Citrus sinensis
Q01561 3.28e-25 114 26 16 426 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Trichophyton rubrum
Q9PMA7 3.71e-25 114 26 9 386 3 nuoL NADH-quinone oxidoreductase subunit L Campylobacter jejuni subsp. jejuni serotype O:2 (strain ATCC 700819 / NCTC 11168)
Q9TKV8 3.75e-25 113 25 12 444 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nephroselmis olivacea
P03920 3.92e-25 114 27 12 358 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos taurus
Q37680 3.93e-25 114 28 11 347 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Triticum aestivum
Q5HQL3 4.11e-25 113 23 9 377 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 35984 / DSM 28319 / BCRC 17069 / CCUG 31568 / BM 3577 / RP62A)
Q8CPV1 4.15e-25 113 23 9 377 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus epidermidis (strain ATCC 12228 / FDA PCI 1200)
Q3MCB9 5.19e-25 113 22 7 412 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichormus variabilis (strain ATCC 29413 / PCC 7937)
Q68VV7 5.79e-25 114 26 12 423 3 nuoL NADH-quinone oxidoreductase subunit L Rickettsia typhi (strain ATCC VR-144 / Wilmington)
A7Y3L2 5.84e-25 112 25 4 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ipomoea purpurea
P41299 5.91e-25 113 30 14 333 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Balaenoptera musculus
Q9TA19 7.38e-25 113 28 14 363 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Loxodonta africana
P50939 8.25e-25 113 28 17 451 3 nuoL NADH-quinone oxidoreductase subunit L Rhodobacter capsulatus
O47815 9.18e-25 112 25 15 472 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Geomys personatus
P92699 9.6e-25 112 29 13 333 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo abelii
Q8YQ78 1.09e-24 112 23 6 367 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4-2 Nostoc sp. (strain PCC 7120 / SAG 25.82 / UTEX 2576)
Q576B4 1.22e-24 112 30 10 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Bos indicus
B1XJL9 1.38e-24 112 26 4 306 3 ndhD3 NAD(P)H-quinone oxidoreductase chain 4 3 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P26849 1.57e-24 112 27 10 351 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Marchantia polymorpha
Q85FH9 1.62e-24 112 27 10 374 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adiantum capillus-veneris
Q37372 1.64e-24 112 31 10 292 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Acanthamoeba castellanii
P93313 1.8e-24 111 23 6 342 1 ND4 NADH-ubiquinone oxidoreductase chain 4 Arabidopsis thaliana
A4QJX9 1.8e-24 112 28 15 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Olimarabidopsis pumila
Q9ZZY1 1.86e-24 112 26 11 358 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hippopotamus amphibius
A4QLP4 2.22e-24 112 28 15 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lobularia maritima
Q9TLC2 2.26e-24 112 28 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Tecoma stans
Q9BBP6 2.34e-24 112 29 10 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lotus japonicus
Q6YXQ3 2.37e-24 110 29 4 236 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Physcomitrium patens
O78756 2.86e-24 111 27 12 358 1 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ovis aries
Q859V1 3.23e-24 111 27 10 356 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anthoceros angustus
A4QKP2 3.24e-24 111 28 14 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Capsella bursa-pastoris
Q0G9R5 3.89e-24 111 27 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Daucus carota
P48920 4.19e-24 111 28 11 348 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Chondrus crispus
A4QLF6 4.29e-24 111 28 15 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lepidium virginicum
Q38PR2 4.65e-24 110 28 14 363 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Mammuthus primigenius
Q49KV1 4.78e-24 111 26 15 450 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Eucalyptus globulus subsp. globulus
P56752 4.85e-24 111 28 15 411 1 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabidopsis thaliana
A6H5N8 4.96e-24 111 28 9 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cycas taitungensis
P57262 5.17e-24 110 29 16 439 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS)
P06264 5.23e-24 110 26 14 419 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Marchantia polymorpha
Q9MUK8 5.62e-24 110 25 15 456 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mesostigma viride
Q32126 6.13e-24 110 27 13 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dampiera diversifolia
A4QK67 6.2e-24 110 28 13 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Arabis hirsuta
B0Z5H4 6.86e-24 110 29 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera parviflora
B0Z590 6.86e-24 110 29 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera glazioviana
B0Z506 6.86e-24 110 29 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera biennis
B0Z4S2 6.86e-24 110 29 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera argillicola
A4QL68 7.46e-24 110 28 14 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Draba nemorosa
Q2I3G4 7.95e-24 110 30 12 301 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Elephas maximus
A4QKF4 8.29e-24 110 29 17 414 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Barbarea verna
Q2PMM9 8.5e-24 110 28 10 352 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Glycine max
Q2PMN2 8.76e-24 108 28 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Glycine max
Q9MTI4 9.16e-24 110 29 12 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oenothera elata subsp. hookeri
Q49W88 9.95e-24 108 27 9 348 3 mnhD1 Na(+)/H(+) antiporter subunit D1 Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229 / NCIMB 8711 / NCTC 7292 / S-41)
Q32RH9 1.06e-23 110 26 13 421 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zygnema circumcarinatum
P9WIW5 1.06e-23 109 27 5 310 1 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain ATCC 25618 / H37Rv)
P9WIW4 1.06e-23 109 27 5 310 3 nuoM NADH-quinone oxidoreductase subunit M Mycobacterium tuberculosis (strain CDC 1551 / Oshkosh)
O63908 1.28e-23 109 30 16 337 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Glis glis
Q19V61 1.34e-23 108 25 6 344 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chlorokybus atmophyticus
Q68RV9 1.39e-23 109 29 12 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Panax ginseng
Q37710 1.46e-23 108 28 8 286 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Artemia franciscana
B5LMS9 1.49e-23 109 28 14 404 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cicer arietinum
P27572 1.57e-23 108 24 6 342 2 ND4 NADH-ubiquinone oxidoreductase chain 4 Triticum aestivum
Q96069 1.59e-23 108 28 9 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rhinoceros unicornis
O03205 1.71e-23 108 31 14 300 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ceratotherium simum
P06262 1.71e-23 108 26 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tabacum
Q3C1Q4 1.71e-23 108 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana sylvestris
P03918 1.75e-23 108 30 11 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pongo pygmaeus
Q76LN2 1.79e-23 108 27 12 349 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Rousettus amplexicaudatus
Q33BX2 2.08e-23 107 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nicotiana tomentosiformis
B0C4B4 2.12e-23 108 24 3 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Acaryochloris marina (strain MBIC 11017)
Q70XW6 2.24e-23 108 26 12 409 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Amborella trichopoda
Q58705 2.24e-23 107 24 9 383 4 MJ1309 Uncharacterized protein MJ1309 Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440)
A4QJG3 2.31e-23 108 26 20 515 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema cordifolium
P06263 2.37e-23 107 28 4 236 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Marchantia polymorpha
Q9M3J4 2.4e-23 108 27 14 400 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Spinacia oleracea
A2T379 2.76e-23 108 28 10 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Angiopteris evecta
Q2QD43 2.92e-23 108 27 12 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cucumis sativus
P51099 3.06e-23 108 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atractylodes lancea
A4GGE6 3.47e-23 107 28 3 216 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Phaseolus vulgaris
A9L9E4 3.6e-23 108 28 16 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lemna minor
P51095 4.26e-23 108 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Adenocaulon himalaicum
B3TN96 4.55e-23 108 26 13 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Brachypodium distachyon
Q32551 4.91e-23 108 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Mutisia acuminata
Q94RJ2 4.93e-23 107 27 13 350 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Chimaera monstrosa
Q2JTD6 5.09e-23 107 25 4 274 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-3-3Ab)
P46620 6.1e-23 107 25 11 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Zea mays
P03919 6.21e-23 107 30 12 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Hylobates lar
A9QPJ1 6.57e-23 106 24 12 425 3 hyfF Hydrogenase-4 component F homolog Methylacidiphilum infernorum (isolate V4)
B2XWI8 6.75e-23 107 30 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Fagopyrum esculentum subsp. ancestrale
B1A981 6.93e-23 107 27 12 406 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carica papaya
Q2A7B8 7.18e-23 106 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum lycopersicum
A0ZZ82 7.29e-23 107 27 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium barbadense
B2LMQ1 7.3e-23 107 28 12 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Guizotia abyssinica
Q2L960 7.61e-23 107 27 15 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gossypium hirsutum
Q06R80 7.65e-23 106 29 2 212 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Jasminum nudiflorum
O79437 7.83e-23 107 26 11 353 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oryctolagus cuniculus
P03921 7.88e-23 107 29 12 299 1 Mtnd5 NADH-ubiquinone oxidoreductase chain 5 Mus musculus
Q8S8U7 8.37e-23 105 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Atropa belladonna
Q8W8H5 9.16e-23 107 25 11 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Psilotum nudum
Q2VED0 9.67e-23 105 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Solanum tuberosum
Q1HK80 1.04e-22 106 29 12 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus
Q32880 1.14e-22 106 25 12 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Poa pratensis
A4QKY1 1.19e-22 106 28 13 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Crucihimalaya wallichii
Q6YXQ6 1.23e-22 106 26 14 420 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Physcomitrium patens
Q6ENQ0 1.31e-22 106 25 12 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum officinarum
Q0G9R2 1.36e-22 105 27 5 299 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Daucus carota
Q32539 1.36e-22 106 28 11 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lactuca sativa
Q33066 1.37e-22 106 25 12 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Sorghum bicolor
A7Y3K7 1.37e-22 106 28 9 340 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ipomoea purpurea
P51100 1.4e-22 106 28 11 357 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Gerbera jamesonii
Q0G9H2 1.41e-22 106 26 11 356 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Liriodendron tulipifera
Q6L3E3 1.46e-22 106 25 12 411 2 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Saccharum hybrid
Q09FR3 1.51e-22 106 27 13 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nandina domestica
P10330 1.53e-22 106 27 11 347 2 ND5 NADH-ubiquinone oxidoreductase chain 5 Oenothera berteroana
P51098 1.57e-22 106 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Athroisma gracile
B1NWJ6 1.61e-22 106 26 14 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Manihot esculenta
P38602 1.68e-22 105 29 11 297 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Halichoerus grypus
Q09MC6 1.71e-22 105 27 6 277 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Citrus sinensis
Q9MVL6 1.72e-22 106 27 14 412 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Malvaviscus arboreus
Q32440 1.79e-22 106 25 13 415 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Hordeum vulgare
Q0H8X6 1.8e-22 104 22 6 333 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Ustilago maydis (strain 521 / FGSC 9021)
Q1ACE9 1.82e-22 105 25 4 294 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chara vulgaris
Q89AT5 1.9e-22 105 23 11 472 3 nuoM NADH-quinone oxidoreductase subunit M Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
Q3V4Y7 1.99e-22 106 26 13 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus
P15958 2.05e-22 105 28 10 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vicia faba
A9LYE7 2.14e-22 105 26 13 398 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Acorus calamus var. americanus
Q8M9U1 2.29e-22 104 23 4 343 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chaetosphaeridium globosum
A6MMI0 2.35e-22 105 27 11 349 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chloranthus spicatus
Q09FZ9 2.37e-22 105 28 11 344 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Platanus occidentalis
Q0I6X0 2.48e-22 105 24 3 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9311)
Q5SCZ6 2.53e-22 104 26 3 305 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Huperzia lucidula
Q32384 2.63e-22 105 27 10 348 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Helianthus annuus
Q8DKY0 3e-22 104 24 5 308 1 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Thermosynechococcus vestitus (strain NIES-2133 / IAM M-273 / BP-1)
Q953I4 3.02e-22 105 27 12 352 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Episoriculus fumidus
Q8W9M6 3.06e-22 105 29 16 343 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dugong dugon
Q32007 3.07e-22 105 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Cichorium intybus
A4GGE3 3.2e-22 105 26 11 399 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Phaseolus vulgaris
P48921 3.21e-22 105 29 12 297 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Felis catus
Q68RV6 3.24e-22 104 29 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Panax ginseng
Q9BBP3 3.4e-22 103 23 4 328 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lotus japonicus
Q32091 3.77e-22 105 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carthamus tinctorius
Q31849 3.84e-22 105 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ambrosia trifida
A9RAH0 4e-22 104 26 15 419 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Debaryomyces hansenii (strain ATCC 36239 / CBS 767 / BCRC 21394 / JCM 1990 / NBRC 0083 / IGC 2968)
P51097 4.29e-22 105 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Symphyotrichum cordifolium
Q00542 4.66e-22 104 29 12 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Phoca vitulina
B0FWD3 4.67e-22 104 26 12 415 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Aedes aegypti
Q2JK43 4.88e-22 103 25 5 303 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain JA-2-3B'a(2-13))
Q09WW8 5.31e-22 103 29 4 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Morus indica
A0A382 5.46e-22 104 29 14 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Coffea arabica
Q32S08 5.46e-22 103 24 5 344 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Staurastrum punctulatum
A6MMZ5 5.6e-22 103 28 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Illicium oligandrum
A4QLY2 5.72e-22 104 28 15 413 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nasturtium officinale
Q32131 5.81e-22 104 26 13 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Digitalis grandiflora
Q06FL7 5.85e-22 104 24 18 516 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Pelargonium hortorum
O78688 6.31e-22 103 28 19 428 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Carassius auratus
Q32238 6.64e-22 104 27 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Flaveria ramosissima
P51096 6.76e-22 104 28 11 343 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Anisothrix integra
Q95H46 6.85e-22 104 24 11 414 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Triticum aestivum
Q8KX53 7.22e-22 103 22 7 409 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Picosynechococcus sp. (strain ATCC 27264 / PCC 7002 / PR-6)
P0C328 7.61e-22 104 26 13 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. japonica
P0C327 7.61e-22 104 26 13 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa subsp. indica
P0C326 7.61e-22 104 26 13 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza sativa
Q6ENB0 7.61e-22 104 26 13 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Oryza nivara
P18932 7.83e-22 103 29 10 329 1 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila melanogaster
P48656 8.21e-22 103 26 13 371 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus caballus
A2T383 8.3e-22 102 29 2 222 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Angiopteris evecta
A1EA56 8.83e-22 103 24 13 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Agrostis stolonifera
Q9ZZM3 9.3e-22 103 27 18 427 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Salmo salar
Q33BX5 1e-21 103 27 9 350 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tomentosiformis
Q8S8V0 1.05e-21 103 29 11 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Atropa belladonna
Q35813 1.16e-21 103 30 12 303 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Struthio camelus
A8Y9D4 1.16e-21 103 24 12 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Lolium perenne
P92669 1.22e-21 103 27 18 435 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Osphranter robustus
Q1KXQ3 1.25e-21 102 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Helianthus annuus
Q06R83 1.3e-21 103 28 12 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Jasminum nudiflorum
A4QJP7 1.35e-21 103 26 20 515 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Aethionema grandiflorum
Q3AGZ9 1.37e-21 102 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9605)
Q9MVK2 1.4e-21 103 28 13 362 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Pachira aquatica
Q7NP39 1.46e-21 102 27 2 218 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Gloeobacter violaceus (strain ATCC 29082 / PCC 7421)
Q7U413 1.5e-21 102 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Parasynechococcus marenigrum (strain WH8102)
O21335 1.52e-21 102 29 10 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Dasypus novemcinctus
Q0ZIX1 1.75e-21 103 26 13 396 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Vitis vinifera
Q9TLA3 1.81e-21 103 28 14 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ligustrum vulgare
Q1KXG6 1.87e-21 102 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lactuca sativa
A6H5P2 1.94e-21 101 28 5 283 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cycas taitungensis
Q36459 2.04e-21 102 27 18 405 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Ornithorhynchus anatinus
Q32516 2.13e-21 102 27 9 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum lycopersicum
B2LMP8 2.14e-21 101 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Guizotia abyssinica
A6MMR6 2.34e-21 102 27 12 411 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Dioscorea elephantipes
Q2VED3 2.46e-21 102 28 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum tuberosum
Q9MUM8 2.73e-21 101 25 2 250 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Mesostigma viride
Q9ZZ57 2.77e-21 102 28 12 302 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Canis lupus familiaris
Q3B063 2.81e-21 101 24 5 277 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain CC9902)
Q31952 3.07e-21 102 28 11 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Capsicum baccatum
Q1ACF3 3.12e-21 102 27 12 358 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Chara vulgaris
A8SEF0 3.15e-21 102 27 14 402 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ceratophyllum demersum
Q7V4E4 3.41e-21 101 23 5 327 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9313)
Q7VE41 3.44e-21 101 27 1 197 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain SARG / CCMP1375 / SS120)
P41309 3.56e-21 101 26 14 396 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Didelphis virginiana
Q118H6 3.63e-21 101 24 4 306 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Trichodesmium erythraeum (strain IMS101)
P11993 3.7e-21 101 27 11 322 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Patiria pectinifera
Q7YJT6 4.39e-21 102 25 13 410 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Calycanthus floridus var. glaucus
A6MMZ2 4.49e-21 101 28 13 351 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Illicium oligandrum
P33510 4.69e-21 101 26 13 418 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles quadrimaculatus
A1XGU4 4.81e-21 101 26 13 417 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Ranunculus macranthus
Q33113 4.95e-21 101 25 12 401 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic (Fragment) Sesamum indicum
Q32S06 4.97e-21 101 27 17 448 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Staurastrum punctulatum
Q2MIE0 5.17e-21 101 28 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Solanum bulbocastanum
P92485 5.42e-21 101 26 13 371 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Equus asinus
P11661 6.14e-21 100 28 12 297 3 Mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Rattus norvegicus
Q32RL9 6.35e-21 100 25 3 272 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Zygnema circumcarinatum
P48176 6.36e-21 100 27 18 427 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Oncorhynchus mykiss
Q14FB0 6.64e-21 101 25 13 416 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus alba
Q06GU9 6.79e-21 101 26 11 364 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Drimys granadensis
B0Z5H7 8.15e-21 99 26 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera parviflora
Q8K9X7 8.52e-21 100 28 10 315 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Schizaphis graminum (strain Sg)
Q70XV2 8.67e-21 99 24 8 360 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Amborella trichopoda
P06265 9.13e-21 100 28 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana tabacum
Q3C1N9 9.88e-21 100 28 10 347 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Nicotiana sylvestris
P24979 9.99e-21 100 28 10 297 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Cyprinus carpio
A2CD41 1.02e-20 100 23 5 327 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9303)
Q7YJT3 1.08e-20 99 28 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Calycanthus floridus var. glaucus
P55782 1.11e-20 100 28 14 348 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gadus morhua
P18940 1.11e-20 100 28 15 341 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Gallus gallus
A9L9E7 1.51e-20 99 25 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lemna minor
O79411 1.68e-20 99 30 13 296 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Scyliorhinus canicula
Q95917 1.86e-20 98 26 8 368 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Polypterus ornatipinnis
B0Z4S5 1.98e-20 99 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera argillicola
P58419 2.22e-20 98 25 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera elata subsp. hookeri
Q36428 2.31e-20 99 28 8 289 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Locusta migratoria
B0Z593 2.54e-20 98 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera glazioviana
B0Z509 2.54e-20 98 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Oenothera biennis
P34195 2.56e-20 99 29 13 330 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Formosania lacustris
A4GYW4 2.95e-20 99 25 12 407 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Populus trichocarpa
Q9ZZ44 2.95e-20 99 30 13 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Squalus acanthias
P32421 3.4e-20 98 21 8 418 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4-1 Synechocystis sp. (strain ATCC 27184 / PCC 6803 / Kazusa)
A4QJG6 3.67e-20 97 27 2 204 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema cordifolium
A5GP41 3.81e-20 98 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain WH7803)
A4QJQ0 4.01e-20 97 27 2 204 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Aethionema grandiflorum
B1VKI4 4.21e-20 97 28 2 204 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cryptomeria japonica
Q5SCZ9 4.67e-20 98 25 10 355 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Huperzia lucidula
Q4JQH7 4.7e-20 98 27 15 392 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Tetraodon nigroviridis
A4GYW6 4.8e-20 97 25 6 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus trichocarpa
O03174 4.94e-20 98 28 15 374 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Latimeria chalumnae
B0JPG4 4.99e-20 97 22 7 416 3 ndhD1 NAD(P)H-quinone oxidoreductase chain 4 1 Microcystis aeruginosa (strain NIES-843 / IAM M-2473)
O79678 5.94e-20 97 29 12 315 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Pelomedusa subrufa
A1XGU1 6.12e-20 97 28 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ranunculus macranthus
Q14FA8 6.27e-20 97 25 6 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Populus alba
P51899 6.76e-20 95 28 12 331 3 ND5 NADH-ubiquinone oxidoreductase chain 5 (Fragment) Anopheles arabiensis
Q85FH5 6.86e-20 97 24 4 284 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Adiantum capillus-veneris
P34854 7e-20 97 26 15 422 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Anopheles gambiae
Q09FR0 7.11e-20 97 24 2 272 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nandina domestica
A0A385 7.99e-20 97 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Coffea arabica
A1XG05 8.97e-20 96 24 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nuphar advena
Q34947 1.02e-19 97 26 12 387 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Lumbricus terrestris
O79422 1.14e-19 97 29 11 298 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma lanceolatum
Q6EW00 1.18e-19 96 24 4 274 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nymphaea alba
Q04050 1.3e-19 96 22 7 347 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Brassica campestris
B1X5V5 1.38e-19 96 26 13 400 3 ndhF2 NAD(P)H-quinone oxidoreductase subunit 5, organellar chromatophore 2 Paulinella chromatophora
O21047 1.45e-19 96 26 3 234 3 nad4 NADH-ubiquinone oxidoreductase chain 4 Dictyostelium discoideum
Q09FZ6 1.58e-19 95 24 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Platanus occidentalis
A9LYF0 1.92e-19 95 25 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus var. americanus
Q0G9G9 1.93e-19 95 27 3 215 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Liriodendron tulipifera
A2BZX6 2.2e-19 95 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL1A)
Q3V4Y4 2.25e-19 95 28 3 216 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Acorus calamus
Q46HM4 2.32e-19 95 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain NATL2A)
Q89AT6 2.4e-19 95 31 11 305 3 nuoL NADH-quinone oxidoreductase subunit L Buchnera aphidicola subsp. Baizongia pistaciae (strain Bp)
P07706 2.57e-19 95 30 8 291 3 mt:ND5 NADH-ubiquinone oxidoreductase chain 5 Drosophila yakuba
B1NWJ9 2.62e-19 95 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Manihot esculenta
P15552 2.64e-19 95 32 8 187 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Strongylocentrotus purpuratus
A9BD08 2.72e-19 95 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9211)
A6MM84 3.04e-19 95 27 12 361 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Buxus microphylla
A6MMH7 3.3e-19 95 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Chloranthus spicatus
P50366 3.52e-19 95 26 13 349 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Phytophthora infestans
Q31D31 3.87e-19 95 23 5 306 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9312)
A8SEF4 4.06e-19 94 27 3 215 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Ceratophyllum demersum
A2BUC6 4.53e-19 94 25 3 242 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9515)
A8G2F5 5.57e-19 94 23 5 306 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9215)
A2BNU4 6.2e-19 94 23 5 306 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain AS9601)
Q06GU6 8.26e-19 93 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Drimys granadensis
Q9B6D3 8.73e-19 94 22 12 428 1 ND5 NADH-ubiquinone oxidoreductase chain 5 Yarrowia lipolytica (strain CLIB 122 / E 150)
Q06FQ4 9.21e-19 93 28 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Pelargonium hortorum
Q95918 9.75e-19 94 28 11 298 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Polypterus ornatipinnis
Q8WHX8 1.06e-18 93 23 3 287 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Psilotum nudum
Q9JX92 1.06e-18 94 27 14 354 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup A / serotype 4A (strain DSM 15465 / Z2491)
Q598S9 1.09e-18 92 26 8 301 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Caperea marginata
Q9K1B0 1.17e-18 94 27 12 351 3 nuoL NADH-quinone oxidoreductase subunit L Neisseria meningitidis serogroup B (strain ATCC BAA-335 / MC58)
Q7V3C8 1.26e-18 93 27 1 188 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus subsp. pastoris (strain CCMP1986 / NIES-2087 / MED4)
Q0ZIW8 1.29e-18 93 27 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Vitis vinifera
Q9MIY0 1.35e-18 93 29 9 249 3 mt-nd5 NADH-ubiquinone oxidoreductase chain 5 Danio rerio
F1SVL2 1.6e-18 92 24 8 355 1 fpoN F(420)H(2) dehydrogenase subunit N Methanosarcina mazei (strain ATCC BAA-159 / DSM 3647 / Goe1 / Go1 / JCM 11833 / OCM 88)
P12776 1.96e-18 93 31 6 187 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Paracentrotus lividus
O47430 2.01e-18 93 29 11 298 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Branchiostoma floridae
Q9RUA0 2.13e-18 92 27 10 318 3 nuoN NADH-quinone oxidoreductase subunit N Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / CCUG 27074 / LMG 4051 / NBRC 15346 / NCIMB 9279 / VKM B-1422 / R1)
A3PAL7 2.25e-18 92 23 5 306 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Prochlorococcus marinus (strain MIT 9301)
Q09WX1 2.34e-18 93 27 12 359 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Morus indica
Q5N060 2.36e-18 92 26 5 260 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus sp. (strain ATCC 27144 / PCC 6301 / SAUG 1402/1)
Q31LR3 2.36e-18 92 26 5 260 3 ndhD2 NAD(P)H-quinone oxidoreductase chain 4 2 Synechococcus elongatus (strain ATCC 33912 / PCC 7942 / FACHB-805)
P03910 2.91e-18 91 26 8 305 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos taurus
Q576B5 3.13e-18 91 26 8 305 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos indicus
A6MMR3 3.88e-18 91 24 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Dioscorea elephantipes
Q2L955 3.93e-18 91 26 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium hirsutum
A0ZZ85 3.93e-18 91 26 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Gossypium barbadense
B1A984 4.3e-18 91 24 4 273 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Carica papaya
Q37024 4.65e-18 92 25 17 439 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Wickerhamomyces canadensis
P48915 5.06e-18 91 24 2 270 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Chondrus crispus
Q9TL56 5.44e-18 92 26 13 405 3 ndhF NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic Carpenteria californica
A6LXP5 6.08e-18 90 22 9 398 3 nuoN NADH-quinone oxidoreductase subunit N Clostridium beijerinckii (strain ATCC 51743 / NCIMB 8052)
Q49KU8 8.12e-18 90 23 4 328 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Eucalyptus globulus subsp. globulus
A4QKF7 9.57e-18 90 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Barbarea verna
A1AVS5 1.1e-17 90 25 11 357 3 nuoN NADH-quinone oxidoreductase subunit N Ruthia magnifica subsp. Calyptogena magnifica
B3QY38 1.33e-17 90 27 12 355 3 nuoN2 NADH-quinone oxidoreductase subunit N 2 Chloroherpeton thalassium (strain ATCC 35110 / GB-78)
Q37375 1.44e-17 89 24 5 245 3 ND4 NADH-ubiquinone oxidoreductase chain 4 Acanthamoeba castellanii
P26288 1.45e-17 89 26 2 204 1 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabidopsis thaliana
B8J1C7 1.46e-17 89 25 12 373 3 nuoN NADH-quinone oxidoreductase subunit N Desulfovibrio desulfuricans (strain ATCC 27774 / DSM 6949 / MB)
Q56227 1.48e-17 90 27 9 318 1 nqo12 NADH-quinone oxidoreductase subunit 12 Thermus thermophilus (strain ATCC 27634 / DSM 579 / HB8)
O79881 1.91e-17 89 26 8 301 1 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Sus scrofa
A5GQH5 2.33e-17 89 21 5 338 3 ndhD NAD(P)H-quinone oxidoreductase chain 4 Synechococcus sp. (strain RCC307)
A0LDR4 2.44e-17 89 27 12 343 3 nuoN NADH-quinone oxidoreductase subunit N Magnetococcus marinus (strain ATCC BAA-1437 / JCM 17883 / MC-1)
A4QLY5 2.61e-17 89 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Nasturtium officinale
A4QKY4 2.68e-17 89 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Crucihimalaya wallichii
B2IHV3 2.75e-17 89 25 9 343 3 nuoN NADH-quinone oxidoreductase subunit N Beijerinckia indica subsp. indica (strain ATCC 9039 / DSM 1715 / NCIMB 8712)
O79436 3.02e-17 88 24 10 364 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Oryctolagus cuniculus
P41298 3.61e-17 88 26 8 301 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Balaenoptera musculus
A4QLF9 3.62e-17 88 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Lepidium virginicum
A4QKP5 3.69e-17 88 26 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Capsella bursa-pastoris
A6MM87 4.97e-17 88 27 3 216 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Buxus microphylla
Q2RJT7 5.69e-17 87 23 11 417 3 nuoN NADH-quinone oxidoreductase subunit N Moorella thermoacetica (strain ATCC 39073 / JCM 9320)
Q34878 5.86e-17 87 24 10 345 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Lemur catta
Q5Y4Q1 5.91e-17 87 26 8 302 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Bos mutus grunniens
A4QK70 6.68e-17 87 27 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Arabis hirsuta
Q9M3J0 7.57e-17 87 23 4 273 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Spinacia oleracea
B0TH87 8.54e-17 87 26 13 348 3 nuoN NADH-quinone oxidoreductase subunit N Heliobacterium modesticaldum (strain ATCC 51547 / Ice1)
Q9ZYM7 9.71e-17 87 26 10 337 3 ND5 NADH-ubiquinone oxidoreductase chain 5 Rhipicephalus sanguineus
Q35543 1.01e-16 87 26 12 328 3 MT-ND5 NADH-ubiquinone oxidoreductase chain 5 Petromyzon marinus
P05508 1.18e-16 86 23 11 404 3 Mt-nd4 NADH-ubiquinone oxidoreductase chain 4 Rattus norvegicus
A4QJY2 1.24e-16 87 26 2 203 3 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Olimarabidopsis pumila
Q591M5 1.42e-16 86 25 7 295 3 MT-ND4 NADH-ubiquinone oxidoreductase chain 4 Microcebus simmonsi
Q4VZL8 1.69e-16 86 28 4 216 2 ndhD NAD(P)H-quinone oxidoreductase chain 4, chloroplastic Cucumis sativus

  • Number of RefSeq hits:

General

Source Morganella morganii S5
Locus tag HKOGLL_04275
Feature type CDS
Gene hyfB
Product hydrogenase 4 subunit B
Location 173510 - 175525 (strand: -1)
Length 2016 (nucleotides) / 671 (amino acids)

Contig

Accession ZDB_681
Length 269562 nucleotides
Topology linear
Plasmid False

Orthology

Orthogroup group_797
Orthogroup size 7
N. genomes 7

Actions

Genomic region

Domains

PF00361 Proton-conducting membrane transporter

COG entry Annotation(s)

ID Function(s) descr. Function(s) cat. Description
COG0651 Energy production and conversion (C)
Inorganic ion transport and metabolism (P)
CP Formate hydrogenlyase subunit 3/Multisubunit Na+/H+ antiporter, MnhD subunit

Kegg Ortholog Annotation(s)

KO Description Pathways Modules
K12137 hydrogenase-4 component B [EC:1.-.-.-] - -

Protein Sequence

MTSLELLLWSVALYTAGGFISLLFKQQEKMAVYVAGITAIAGGILGLFSAVPVLMSGETLTFFAQGPFPFAHFVVRLDSLAAFMVMVISLLVTVSALYSLNYVQEYLGRGAWSMGFFLNLFIASMVALVVMDNAFWFIILFEMMSLASWFLVIADQDDKSIRAGLLYFFIAHAGSVLIMIAFFLMWRESGSLDFDSFRQLSLSPAMASVVFLLGFFGFGAKAGMLPLHSWLPQAHPAAPSHASALMSGVMVKIGIFGIIKVGIDLLGATQGWWGIVVLGFGAVSSVLGVMYALAEHDIKRLLAWHTVENIGIILMGVGVAMVGMANDMPVLATIGLLGAIYHLLNHAVFKGLLFLGAGAVIYRIHTRDMEKMGGLAKLMPLTATAFLIGCMAISALPPLNGFVSEWYTYQSLFSMSHDGTFIMKISGPIAIVMLAITGALAAMCFVKVYGVSFCGGPRSEAATHAREVPWTMTAAMLILAVVCVLLGVGASVIAPVLAKVAMTLTAGTDVTVAQGAMLVPDSAAQAMISPAMTFLLLLALPLIPFIIYLVFKGKQMNFRRKGDAWACGYAWERDMSVSAGGFTQPLRSMFAPLYRMRKQLDPSARLAHALDVTKAGAGKVEPFWDERIIYPLVRGINRFAKRIQCLQGGDFRLYCLYVVAALVVLLVVIAA

Flanking regions ( +/- flanking 50bp)

GCGATGCCGCCGGAGTTCGACATTTTCGTCTCAGGACAGGAGAGCAGAAAATGACATCTCTTGAATTACTCTTATGGTCTGTTGCCCTGTATACCGCCGGCGGTTTTATTTCGCTGCTGTTTAAACAGCAGGAAAAAATGGCAGTGTATGTTGCCGGGATCACGGCGATTGCCGGCGGGATCCTCGGTTTATTCAGTGCCGTTCCGGTGCTGATGAGCGGCGAAACACTGACGTTTTTCGCTCAGGGACCTTTCCCGTTCGCCCATTTTGTCGTCCGCCTCGACAGCCTCGCCGCCTTTATGGTGATGGTGATTTCGCTGCTGGTGACCGTCAGCGCTCTGTATTCCCTGAACTATGTGCAGGAATATCTGGGACGCGGCGCGTGGAGCATGGGTTTCTTCCTGAACCTGTTTATCGCCTCCATGGTTGCCCTGGTGGTGATGGACAACGCCTTCTGGTTCATCATTCTGTTTGAAATGATGTCGCTGGCCTCTTGGTTCCTGGTGATCGCGGATCAGGATGACAAATCCATCCGCGCCGGTCTGCTCTACTTCTTTATTGCCCACGCCGGTTCTGTGCTGATTATGATCGCTTTCTTCCTGATGTGGCGCGAAAGCGGCAGTCTGGATTTCGATTCCTTCCGTCAGCTCTCACTGTCTCCGGCGATGGCCTCTGTGGTCTTCCTGCTGGGCTTCTTCGGCTTCGGTGCCAAAGCGGGTATGTTACCGCTGCACAGCTGGCTGCCGCAGGCTCACCCGGCTGCACCGTCTCACGCCTCCGCACTGATGTCCGGTGTGATGGTGAAAATCGGTATCTTCGGGATCATTAAAGTCGGTATCGACCTGCTGGGTGCAACCCAGGGCTGGTGGGGTATCGTGGTACTGGGCTTCGGCGCGGTCTCTTCCGTTCTCGGCGTTATGTATGCGCTGGCGGAGCACGATATCAAACGTCTGCTGGCGTGGCACACCGTGGAAAACATCGGGATTATCCTGATGGGTGTCGGTGTGGCAATGGTTGGTATGGCGAATGATATGCCGGTGCTGGCGACGATTGGTCTGCTCGGCGCGATTTATCACCTGCTCAACCATGCGGTGTTTAAAGGTCTGCTGTTCCTCGGTGCCGGTGCGGTGATTTACCGTATCCACACCCGTGATATGGAAAAAATGGGCGGCCTCGCCAAACTGATGCCGCTGACTGCAACCGCGTTCTTAATCGGTTGTATGGCGATTTCTGCATTACCGCCGCTCAACGGCTTTGTCAGTGAGTGGTACACCTATCAGTCACTGTTCTCAATGAGCCATGACGGCACATTCATCATGAAAATCAGTGGTCCGATCGCCATTGTGATGCTGGCGATTACCGGGGCACTGGCGGCGATGTGTTTCGTGAAAGTGTACGGTGTCAGCTTCTGCGGCGGTCCGCGCAGTGAAGCCGCCACTCATGCCCGCGAAGTGCCGTGGACAATGACTGCCGCGATGCTGATTCTGGCTGTGGTGTGTGTGCTGCTGGGTGTCGGGGCGAGTGTGATTGCACCGGTGCTGGCGAAAGTGGCGATGACCCTGACTGCAGGCACGGATGTGACAGTGGCACAGGGTGCGATGCTGGTACCGGATTCCGCTGCTCAGGCCATGATTTCACCGGCTATGACATTCCTGTTACTGCTGGCACTGCCGCTGATCCCGTTCATCATCTATCTGGTCTTCAAAGGCAAACAGATGAACTTCCGCCGCAAAGGCGACGCCTGGGCGTGCGGTTATGCCTGGGAACGCGATATGTCCGTATCTGCCGGTGGCTTTACCCAGCCGCTGCGCTCAATGTTTGCACCGTTGTACCGCATGCGCAAACAACTTGATCCGTCAGCGCGTCTGGCTCATGCCTTAGACGTGACCAAAGCCGGGGCCGGAAAAGTCGAGCCATTCTGGGATGAACGCATTATTTATCCGCTGGTGCGCGGGATTAACCGTTTCGCCAAACGCATTCAGTGCCTTCAGGGCGGGGATTTCAGACTTTACTGTCTGTATGTCGTGGCCGCGCTGGTTGTTCTGCTTGTTGTGATTGCGGCGTAAGGAGAGAAACCATGTCGATTCAGGATACACCTACATTGATGACGGGGCTC